A Stochastic Model of Cortical Microtubule Anchoring and Mechanics Provides Regulatory Control of Microtubule Shape.

The organization of cortical microtubule arrays play an important role in the development of plant cells. Until recently, the direct mechanical influence of cell geometry on the constrained microtubule (MT) trajectories have been largely ignored in computational models. Modelling MTs as thin elastic rods constrained on a surface, a previous study examined the deflection of MTs using a fixed number of segments and uniform segment lengths between MT anchors. It is known that the resulting MT curves converge to geodesics as the anchor spacing approaches zero. In the case of long MTs on a cylinder, buckling has been found for transverse trajectories. There is a clear interplay between two factors in the problem of deflection: curvature of the membrane and the lengths of MT segments. Here, we examine the latter in detail, in the backdrop of a circular cylinder. In reality, the number of segments are not predetermined and their lengths are not uniform. We present a minimal, realistic model treating the anchor spacing as a stochastic process and examine the net effect on deflection. We find that, by tuning the ratio of growth speed to anchoring rate, it is possible to mitigate MT deflection and even prevent buckling for lengths significantly larger than the previously-derived critical buckling length. We suggest that this mediation of deflection by anchoring might provide cells with a means of preventing arrays from deflecting away from the transverse orientation.

Baseline levels and characterization of hydrocarbons in surface marine sediments along the transportation corridor in Hudson Bay: A multivariate analysis of n-alkanes, PAHs and biomarkers.

Hudson Bay is a small arctic inland shelf sea which receives large amounts of freshwater from riverine discharges, with marine flow from the north and the Atlantic. A warming climate has resulted in an expanded open water season which will result in an increase in shipping of fuel oil and petroleum to communities and mines on the western shore, increasing the risk of hydrocarbon releases. To evaluate the status of hydrocarbons, surface sediments were collected at 34 locations in the transportation route and offshore and analysed for several types of hydrocarbons. Total hydrocarbons varied by over 25 times between sites, reaching a maximum of 1116 µg/g OC (organic carbon basis) in Hudson Strait due to low molecular weight n-alkanes from marine primary production. The gross mean for all sites was 344 µg/g OC (GSD = 173-682), roughly equivalent to other remote sites in the Canadian Arctic with no known local hydrocarbon source. n-alkanes accounted for >90 % of residues. Diagnostic ratios (e.g., Carbon Preference Index (CPI), Odd-Even Predominance (OEP)) indicated mixed sources of n-alkanes, likely due to the input from vascular plants and ombrotrophic peat in northern and western watersheds, and primary production within the Bay. The elevated proportion of high molecular weight n-alkanes at deep water sites is consistent with lotic particulate organic matter deposited in the nearshore environment and redeposited offshore. Æ©36PAHs were a small fraction (1.9 %) of hydrocarbons, with a gross mean of 5.68 µg/g OC (GSD = 3.30-9.79). PCA separated deep water sediments from nearshore and community samples due to 4 alkylated naphthalenes which usually indicate a petrogenic source but probably indicates a natural source due to the lack of other petrogenic markers. Priority PAHs (i.e., Æ©16PAH) varied from 31.5 % to 56.6 % of the Æ©36PAH residues. The concentrations of individual PAHs were well below the Interim Sediment Quality Guidelines recommended by the Canadian Council of Ministers of the Environment.

Saturation transfer difference NMR on the integral trimeric membrane transport protein GltPh determines cooperative substrate binding.

Saturation-transfer difference (STD) NMR spectroscopy is a fast and versatile method which can be applied for drug-screening purposes, allowing the determination of essential ligand binding affinities (KD). Although widely employed to study soluble proteins, its use remains negligible for membrane proteins. Here the use of STD NMR for KD determination is demonstrated for two competing substrates with very different binding affinities (low nanomolar to millimolar) for an integral membrane transport protein in both detergent-solubilised micelles and reconstituted proteoliposomes. GltPh, a homotrimeric aspartate transporter from Pyrococcus horikoshii, is an archaeal homolog of mammalian membrane transport proteins-known as excitatory amino acid transporters (EAATs). They are found within the central nervous system and are responsible for fast uptake of the neurotransmitter glutamate, essential for neuronal function. Differences in both KD's and cooperativity are observed between detergent micelles and proteoliposomes, the physiological implications of which are discussed.

Helix N-Cap Residues Drive the Acid Unfolding That Is Essential in the Action of the Toxin Colicin A.

Numerous bacterial toxins and other virulence factors use low pH as a trigger to convert from water-soluble to membrane-inserted states. In the case of colicins, the pore-forming domain of colicin A (ColA-P) has been shown both to undergo a clear acidic unfolding transition and to require acidic lipids in the cytoplasmic membrane, whereas its close homologue colicin N shows neither behavior. Compared to that of ColN-P, the ColA-P primary structure reveals the replacement of several uncharged residues with aspartyl residues, which upon replacement with alanine induce an unfolded state at neutral pH. Here we investigate ColA-P's structural requirement for these critical aspartyl residues that are largely situated at the N-termini of α helices. As previously shown in model peptides, the charged carboxylate side chain can act as a stabilizing helix N-Cap group by interacting with free amide hydrogen bond donors. Because this could explain ColA-P destabilization when the aspartyl residues are protonated or replaced with alanyl residues, we test the hypothesis by inserting asparagine, glutamine, and glutamate residues at these sites. We combine urea (fluorescence and circular dichroism) and thermal (circular dichroism and differential scanning calorimetry) denaturation experiments with 1H-15N heteronuclear single-quantum coherence nuclear magnetic resonance spectroscopy of ColA-P at different pH values to provide a comprehensive description of the unfolding process and confirm the N-Cap hypothesis. Furthermore, we reveal that, in urea, the single domain ColA-P unfolds in two steps; low pH destabilizes the first step and stabilizes the second.

Redox-dependent control of i-Motif DNA structure using copper cations.

Previous computational studies have shown that Cu+ can act as a substitute for H+ to support formation of cytosine (C) dimers with similar conformation to the hemi-protonated base pair found in i-motif DNA. Through a range of biophysical methods, we provide experimental evidence to support the hypothesis that Cu+ can mediate C-C base pairing in i-motif DNA and preserve i-motif structure. These effects can be reversed using a metal chelator, or exposure to ambient oxygen in the air that drives oxidation of Cu+ to Cu2+, a comparatively weak ligand. Herein, we present a dynamic and redox-sensitive system for conformational control of an i-motif forming DNA sequence in response to copper cations.

Fixing the Conformation of Calix[4]arenes: When Are Three Carbons Not Enough?

Calix[4]arenes are unique macrocycles that through judicious functionalisation at the lower rim can be either fixed in one of four conformations or remain conformationally flexible. Introduction of propynyl or propenyl groups unexpectedly provides a new possibility; a unidirectional conformational switch, with the 1,3-alternate and 1,2-alternate conformers switching to the partial cone conformation, whilst the cone conformation is unchanged, under standard experimental conditions. Using 1 H NMR kinetic studies, rates of switching have been shown to be dependent on the starting conformation, upper-rim substituent, where reduction in bulk enables faster switching, solvent and temperature with 1,2-alternate conformations switching fastest. Ab initio calculations (DFT) confirmed the relative stabilities of the conformations and point towards the partial cone conformer being the most stable of the four. The potential impact on synthesis through the "click" reaction has been investigated and found not to be significant.

A level-set approach to joint image segmentation and registration with application to CT lung imaging.

Automated analysis of structural imaging such as lung Computed Tomography (CT) plays an increasingly important role in medical imaging applications. Despite significant progress in the development of image registration and segmentation methods, lung registration and segmentation remain a challenging task. In this paper, we present a novel image registration and segmentation approach, for which we develop a new mathematical formulation to jointly segment and register three-dimensional lung CT volumes. The new algorithm is based on a level-set formulation, which merges a classic Chan-Vese segmentation with the active dense displacement field estimation. Combining registration with segmentation has two key advantages: it allows to eliminate the problem of initializing surface based segmentation methods, and to incorporate prior knowledge into the registration in a mathematically justified manner, while remaining computationally attractive. We evaluate our framework on a publicly available lung CT data set to demonstrate the properties of the new formulation. The presented results show the improved accuracy for our joint segmentation and registration algorithm when compared to registration and segmentation performed separately.

The Two-State Prehensile Tail of the Antibacterial Toxin Colicin N.

Intrinsically disordered regions within proteins are critical elements in many biomolecular interactions and signaling pathways. Antibacterial toxins of the colicin family, which could provide new antibiotic functions against resistant bacteria, contain disordered N-terminal translocation domains (T-domains) that are essential for receptor binding and the penetration of the Escherichia coli outer membrane. Here we investigate the conformational behavior of the T-domain of colicin N (ColN-T) to understand why such domains are widespread in toxins that target Gram-negative bacteria. Like some other intrinsically disordered proteins in the solution state of the protein, ColN-T shows dual recognition, initially interacting with other domains of the same colicin N molecule and later, during cell killing, binding to two different receptors, OmpF and TolA, in the target bacterium. ColN-T is invisible in the high-resolution x-ray model and yet accounts for 90 of the toxin's 387 amino acid residues. To reveal its solution structure that underlies such a dynamic and complex system, we carried out mutagenic, biochemical, hydrodynamic and structural studies using analytical ultracentrifugation, NMR, and small-angle x-ray scattering on full-length ColN and its fragments. The structure was accurately modeled from small-angle x-ray scattering data by treating ColN as a flexible system, namely by the ensemble optimization method, which enables a distribution of conformations to be included in the final model. The results reveal, to our knowledge, for the first time the dynamic structure of a colicin T-domain. ColN-T is in dynamic equilibrium between a compact form, showing specific self-recognition and resistance to proteolysis, and an extended form, which most likely allows for effective receptor binding.

Heightened Dynamics of the Oxidized Y48H Variant of Human Cytochrome c Increases Its Peroxidatic Activity.

Proteins performing multiple biochemical functions are called "moonlighting proteins" or extreme multifunctional (EMF) proteins. Mitochondrial cytochrome c is an EMF protein that binds multiple partner proteins to act as a signaling molecule, transfers electrons in the respiratory chain, and acts as a peroxidase in apoptosis. Mutations in the cytochrome c gene lead to the disease thrombocytopenia, which is accompanied by enhanced apoptotic activity. The Y48H variant arises from one such mutation and is found in the 40-57 Ω-loop, the lowest-unfolding free energy substructure of the cytochrome c fold. A 1.36 Å resolution X-ray structure of the Y48H variant reveals minimal structural changes compared to the wild-type structure, with the axial Met80 ligand coordinated to the heme iron. Despite this, the intrinsic peroxidase activity is enhanced, implying that a pentacoordinate heme state is more prevalent in the Y48H variant, corroborated through determination of a Met80 "off rate" of >125 s-1 compared to a rate of ∼6 s-1 for the wild-type protein. Heteronuclear nuclear magnetic resonance measurements with the oxidized Y48H variant reveal heightened dynamics in the 40-57 Ω-loop and the Met80-containing 71-85 Ω-loop relative to the wild-type protein, illustrating communication between these substructures. Placed into context with the G41S cytochrome c variant, also implicated in thrombocytopenia, a dynamic picture associated with this disease relative to cytochrome c is emerging whereby increasing dynamics in substructures of the cytochrome c fold serve to facilitate an increased population of the peroxidatic pentacoordinate heme state in the following order: wild type < G41S < Y48H.

Near-complete backbone resonance assignments of acid-denatured human cytochrome c in dimethylsulfoxide: a prelude to studying interactions with phospholipids.

Human cytochrome c plays a central role in the mitochondrial electron transfer chain and in the intrinsic apoptosis pathway. Through the interaction with the phospholipid cardiolipin, cytochrome c triggers release of pro-apoptotic factors, including itself, from the mitochondrion into the cytosol of cells undergoing apoptosis. The cytochrome c/cardiolipin complex has been extensively studied through various spectroscopies, most recently with high-field solution and solid-state NMR spectroscopies, but there is no agreement between the various studies on key structural features of cytochrome c in its complex with cardiolipin. In the present study, we report backbone 1H, 13C, 15N resonance assignments of acid-denatured human cytochrome c in the aprotic solvent dimethylsulfoxide. These have led to the assignment of a reference 2D 1H-15N HSQC spectrum in which out of the 99 non-proline residues 87% of the backbone amides are assigned. These assignments are being used in an interrupted H/D exchange strategy to map the binding site of cardiolipin on human cytochrome c.

Spin Saturation Transfer Difference NMR (SSTD NMR): A New Tool to Obtain Kinetic Parameters of Chemical Exchange Processes.

This detailed protocol describes the new Spin Saturation Transfer Difference Nuclear Magnetic Resonance protocol (SSTD NMR), recently developed in our group to study processes of mutual-site chemical exchange that are difficult to analyze by traditional methods. As the name suggests, this method combines the Spin Saturation Transfer method used for small molecules, with the Saturation Transfer Difference (STD) NMR method employed for the study of protein-ligand interactions, by measuring transient spin saturation transfer along increasing saturation times (build-up curves) in small organic and organometallic molecules undergoing chemical exchange. Advantages of this method over existing ones are: there is no need to reach coalescence of the exchanging signals; the method can be applied as long as one signal of the exchanging sites is isolated; there is no need to measure T1 or reach steady state saturation; rate constant values are measured directly, and T1 values are obtained in the same experiment, using only one set of experiments. To test the method, we have studied the dynamics of the hindered rotation of N,N-dimethylamides, for which much data is available for comparison. The thermodynamic parameters obtained using SSTD are very similar to the reported ones (spin-saturation transfer techniques and line-shape analysis). The method can be applied to more challenging substrates that cannot be studied by previous methods. We envisage that the simple experimental set up and the wide applicability of the method to a great variety of substrates will make this a common technique amongst organic and organometallic chemists without extensive expertise in NMR.

Increased dynamics in the 40-57 Ω-loop of the G41S variant of human cytochrome c promote its pro-apoptotic conformation.

Thrombocytopenia 4 is an inherited autosomal dominant thrombocytopenia, which occurs due to mutations in the human gene for cytochrome c that results in enhanced mitochondrial apoptotic activity. The Gly41Ser mutation was the first to be reported. Here we report stopped-flow kinetic studies of azide binding to human ferricytochrome c and its Gly41Ser variant, together with backbone amide H/D exchange and (15)N-relaxation dynamics using NMR spectroscopy, to show that alternative conformations are kinetically and thermodynamically more readily accessible for the Gly41Ser variant than for the wild-type protein. Our work reveals a direct conformational link between the 40-57 Ω-loop in which residue 41 resides and the dynamical properties of the axial ligand to the heme iron, Met80, such that the replacement of glycine by serine promotes the dissociation of the Met80 ligand, thereby increasing the population of a peroxidase active state, which is a key non-native conformational state in apoptosis.

Reversible DNA i-motif to hairpin switching induced by copper(II) cations.

i-Motif DNA structures have previously been utilised for many different nanotechnological applications, but all have used changes in pH to fold the DNA. Herein we describe how copper(II) cations can alter the conformation of i-motif DNA into an alternative hairpin structure which is reversible by chelation with EDTA.

Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states.

Human cytochrome c is a multi-functional protein with key roles in both the mitochondrial electron transfer chain and in apoptosis. In the latter, a complex formed between the mitochondrial phospholipid cardiolipin and cytochrome c is crucial for instigating the release of pro-apoptotic factors, including cytochrome c, from the mitochondrion into the cytosol. The G41S mutant of human cytochrome c is the only known disease-related variant of cytochrome c and causes increased apoptotic activity in patients with autosomal dominant thrombocytopenia. NMR spectroscopy can be used to investigate the interaction of human cytochrome c with cardiolipin and the structural and dynamic factors, which may contribute to enhanced apoptotic activity for the G41S mutant. We present here essentially full backbone amide resonance assignments for ferric human cytochrome c (98 %) as well as assignments of both the ferric (92 %) and ferrous (95 %) forms of the G41S mutant. Backbone amide chemical shift differences between the wild type and G41S mutant in the ferric state reveals significant changes around the mutation site, with many other amides also affected. This suggests the possibility of increased dynamics and/or a change in the paramagnetic susceptibility tensor of the G41S mutant relative to the wild type protein.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2).

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Biophysical features of bacillithiol, the glutathione surrogate of Bacillus subtilis and other firmicutes.

Bacillithiol (BSH) is the major low-molecular-weight (LMW) thiol in many low-G+C Gram-positive bacteria (Firmicutes). Evidence now emerging suggests that BSH functions as an important LMW thiol in redox regulation and xenobiotic detoxification, analogous to what is already known for glutathione and mycothiol in other microorganisms. The biophysical properties and cellular concentrations of such LMW thiols are important determinants of their biochemical efficiency both as biochemical nucleophiles and as redox buffers. Here, BSH has been characterised and compared with other LMW thiols in terms of its thiol pKa , redox potential and thiol-disulfide exchange reactivity. Both the thiol pKa and the standard thiol redox potential of BSH are shown to be significantly lower than those of glutathione whereas the reactivities of the two compounds in thiol-disulfide reactions are comparable. The cellular concentration of BSH in Bacillus subtilis varied over different growth phases and reached up to 5 mM, which is significantly greater than previously observed from single measurements taken during mid-exponential growth. These results demonstrate that the biophysical characteristics of BSH are distinctively different from those of GSH and that its cellular concentrations can reach levels much higher than previously reported.

Simple computation of reaction-diffusion processes on point clouds.

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Intrinsically disordered proteins: lessons from colicins.

Defining structural features of IDPs (intrinsically disordered proteins) and relating these to biological function requires characterization of their dynamical properties. In the present paper, we review what is known about the IDPs of colicins, protein antibiotics that use their IDPs to enter bacterial cells. The structurally characterized colicin IDPs we consider contain linear binding epitopes for proteins within their target cells that the colicin hijacks during entry. We show that these binding epitopes take part in intramolecular interactions in the absence of protein partners, i.e. self-recognition, and consider the structural origins of this and its functional implications. We suggest that self-recognition is common in other IDPs that contain similar types of binding epitopes.

Structural evidence that colicin A protein binds to a novel binding site of TolA protein in Escherichia coli periplasm.

The Tol assembly of proteins is an interacting network of proteins located in the Escherichia coli cell envelope that transduces energy and contributes to cell integrity. TolA is central to this network linking the inner and outer membranes by interactions with TolQ, TolR, TolB, and Pal. Group A colicins, such as ColA, parasitize the Tol network through interactions with TolA and/or TolB to facilitate translocation through the cell envelope to reach their cytotoxic site of action. We have determined the first structure of the C-terminal domain of TolA (TolAIII) bound to an N-terminal ColA polypeptide (TA(53-107)). The interface region of the TA(53-107)-TolAIII complex consists of polar contacts linking residues Arg-92 to Arg-96 of ColA with residues Leu-375-Pro-380 of TolA, which constitutes a ß-strand addition commonly seen in more promiscuous protein-protein contacts. The interface region also includes three cation-π interactions (Tyr-58-Lys-368, Tyr-90-Lys-379, Phe-94-Lys-396), which have not been observed in any other colicin-Tol protein complex. Mutagenesis of the interface residues of ColA or TolA revealed that the effect on the interaction was cumulative; single mutations of either partner had no effect on ColA activity, whereas mutations of three or more residues significantly reduced ColA activity. Mutagenesis of the aromatic ring component of the cation-π interacting residues showed Tyr-58 of ColA to be essential for the stability of complex formation. TA(53-107) binds on the opposite side of TolAIII to that used by g3p, ColN, or TolB, illustrating the flexible nature of TolA as a periplasmic hub protein.

Characteristics and short-term prognosis of perioperative myocardial infarction in patients undergoing noncardiac surgery: a cohort study.

BACKGROUND: Each year, millions of patients worldwide have a perioperative myocardial infarction (MI) after noncardiac surgery. OBJECTIVE: To examine the characteristics and short-term outcome of perioperative MI. DESIGN: Cohort study. (ClinicalTrials.gov registration number: NCT00182039) SETTING: 190 centers in 23 countries. PATIENTS: 8351 patients included in the POISE (PeriOperative ISchemic Evaluation) trial. MEASUREMENTS: Four cardiac biomarker or enzyme assays were measured within 3 days of surgery. The definition of perioperative MI included either autopsy findings of acute MI or an elevated level of a cardiac biomarker or enzyme and at least 1 of the following defining features: ischemic symptoms, development of pathologic Q waves, ischemic changes on electrocardiography, coronary artery intervention, or cardiac imaging evidence of MI. RESULTS: Within 30 days of random assignment, 415 patients (5.0%) had a perioperative MI. Most MIs (74.1%) occurred within 48 hours of surgery; 65.3% of patients did not experience ischemic symptoms. The 30-day mortality rate was 11.6% (48 of 415 patients) among patients who had a perioperative MI and 2.2% (178 of 7936 patients) among those who did not (P < 0.001). Among patients with a perioperative MI, mortality rates were elevated and similar between those with (9.7%; adjusted odds ratio, 4.76 [95% CI, 2.68 to 8.43]) and without (12.5%; adjusted odds ratio, 4.00 [CI, 2.65 to 6.06]) ischemic symptoms. LIMITATION: Cardiac markers were measured only until day 3 after surgery, and additional asymptomatic MIs may have been missed. CONCLUSION: Most patients with a perioperative MI will not experience ischemic symptoms. Data suggest that routine monitoring of troponin levels in at-risk patients is needed after surgery to detect most MIs, which have an equally poor prognosis regardless of whether they are symptomatic or asymptomatic.