Avaliação do efeito do uso de conservante e dos diferentes momentos de coleta para a determinação de iodo na urina / The effect of the use of preservative and of the different samples collection times on the iodine determination in urine

A determinação do iodo urinário é o marcador bioquímico mais utilizado para avaliação de suas concentrações, auxiliando em estudos epidemiológicos e na clínica médica. Neste trabalho, foi avaliado o efeito do uso de conservante na coleta de urina em frasco coletor, nos períodos antes (A) e após (B) o almoço, e nas amostras distribuídas em tubos com (C) e sem (S) conservante para determinar as concentrações de iodo e creatinina. A dosagem de creatinina foi utilizada para aferir a função renal. Foram analisadas amostras de 20 indivíduos entre 18 a 40 anos de ambos os sexos. Houve concordância nas concentrações de iodo no (A), sendo o coeficiente de correlação intraclasse (CCI) = 0,769 nos tubos (C) e CCI = 0,724 nos tubos (S), assim como entre (A) CCI = 0,941 e (B) CCI = 0,983. Não houve concordância nas concentrações de creatinina nos tubos (C) CCI = 0,369 e (S) CCI = 0,264 nos dois períodos e, também, entre (A) (CCI =0,916) e (B) (CCI = 0,998). Por não terem sido detectadas variações nas concentrações de iodo nas amostras de urina, ambos os tubos, (C) ou (S), podem ser utilizados com igual confiabilidade. Não foi detecta da variabilidade na determinação de iodo na amostras de urina coletadas nos períodos (A) e (B).

Associação entre idade ao início da atividade sexual e subseqüente infecção por papilomavírus humano: resultados de um programa de rastreamento brasileiro / Association between age at first sexual intercourse and subsequent human papillomavirus infection: results of a Brazilian screening program

OBJETIVO: descrever a idade de início da atividade sexual (sexarca) e a sua associação com a idade das mulheres com a infecção por papilomavírus humano (HPV) e com as alterações citológicas no exame de papanicolaou. MÉTODOS: mulheres da população geral foram recrutadas para participar de um estudo de rastreamento de câncer cervical e lesões pré-malignas. Após a aplicação de questionário comportamental, foram submetidas ao rastreamento com gia cervical e teste para DNA de HPV de alto risco, por meio de Captura Híbrida 2. Este projeto faz parte do Latin American Screening Study, que envolve mulheres do Brasil e da Argentina, e os dados aqui apresentados referem-se aos centros brasileiros nas cidades de Porto Alegre, São Paulo e Campinas. RESULTADOS: de 8.649 mulheres entrevistadas, 8.641 relataram atividade sexual prévia e foram incluídas na análise. A média de idade no momento da entrevista foi de 38,1±11,04 anos, com início da atividade sexual em média aos 18,5±4,0 anos. Identificamos que a idade do início da atividade sexual aumenta de acordo com o aumento da faixa etária no momento da entrevista, isto é, mulheres mais novas relataram sexarca mais precoce que mulheres mais velhas (p<0,001). Em relação à infecção por HPV de alto risco, do total de mulheres que haviam iniciado as relações sexuais, 3.463 foram testadas, com 17,3 por cento de positividade para HPV. Notadamente, em todos os centros, as mulheres com idade ao início da atividade sexual abaixo da média da população entrevistada apresentaram positividade maior para HPV (20,2 por cento) do que as mulheres com sexarca em idade acima da média (12,5 por cento) - Odds Ratio (OR)=1,8 (IC95 por cento=1,5-2,2; p<0,001). Em relação à citologia, mulheres com sexarca abaixo da média de idade apresentaram também maior percentual de citologia alterada > ou = ASC-US (6,7 por cento) do que mulheres com sexarca em idade maior que a média...

PURPOSE: to investigate women’s age at their first sexual intercourse and its correlation with their present age, human papillomavirus (HPV) infection and cytological abnormalities at Pap smear. METHODS: women from the general population were invited to be screened for cervical cancer and pre-malignant lesions. After answering a behavior questionnaire, they were submitted to screening with cervical cytology and high-risk HPV testing with Hybrid Capture 2 (HC2). This report is part of the Latin American Screening (LAMS) study, that comprises centers from Brazil and Argentina, and the data presented herein refer to the Brazilian women evaluated at the cities of Porto Alegre, São Paulo and Campinas. RESULTS: from 8,649 women that answered the questionnaire, 8,641 reported previous sexual activity and were included in this analysis. The mean age at the interview was 38.1±11.0 years and the mean age at the first sexual intercourse was 18.5±4.0 years. The age at the first sexual intercourse increased along with the age at the interview, i.e., younger women reported they had begun their sexual life earlier than older women (p<0.001). From the total of women who had already begun having sexual intercourse, 3,643 patients were tested for high-risk HPV infection and 17.3 percent of them had positive results. In all the centers, it became clear that the women with the first sexual intercourse at ages below the mean age of all the population interviewed presented higher rates of HPV infection (20.2 percent) than the women with the first sexual intercourse at ages above the mean (12.5 percent) - Odds Ratio (OR) 1.8 (IC95 percent 1.5-2.2;p<0,001). According to the cytology, the women with first sexual intercourse at ages under the mean, presented higher percentage of abnormal cytology > or = ASC-US (6.7 percent) than the women with the first sexual intercourse at ages above the mean...

Human papillomavirus (HPV) infections as risk factors for cytological and histological abnormalities in baseline PAP smear-negative women followed-up for 2 years in the LAMS study.

OBJECTIVE: To assess the role of HPV as determinant of the incident cytological abnormalities (SIL) and cervical lesions (CIN) during a 24-month follow-up of baseline PAP smear-negative subgroup of women included in the Latin American Screening study (LAMS). STUDY DESIGN: A group of 365 women with normal Pap smear and negative or positive high-risk Hybrid Capture II test were prospectively followed-up for 24 months at Campinas and São Paulo (Brazil). The incidence rate (IR) and risk ratio (RR and 95% CI) of developing cytological or histological abnormality during the follow-up was calculated for HPV-negative and HPV-positive women. RESULTS: During the 12-month follow-up, women HPV-positive at baseline had developed a significantly higher rate of incident LSIL (IR=3.5%, RR=1.4; 95% CI 1.1-1.7) and HSIL (IR=0.7%, RR=1.5; 95% CI 1.4-1.7) abnormality. For HSIL, the IR increased to 2.1% and the RR increased to 1.7 (95% CI 1.5-1.9) among those followed for 24 months. Similarly, women with positive HPV tests were at a higher risk of developing CIN 2-3 (IR=2.6%, RR=1.5; 95% CI 1.4-1.6) during the first 12 months of follow-up, and for those followed for 24 months, this RR increased further to 1.7 (95% CI 1.5-1.9) although the IR was 0.7%. CONCLUSIONS: Oncogenic HPV infections comprise a significant risk factor for incident cervical abnormalities, and HPV test is a useful adjunct to cytology in detecting the high-risk patients among baseline PAP smear-negative women.

Pero Vaz de Caminha: an-interchange program for quality control between Brazil and Portugal.

OBJECTIVE: To start an interexchange program for quality control in cervical cytology and discuss conceptual criteria for diagnosis. STUDY DESIGN: Slides were selected in the archives of the 2 institutes and included cases with unsatisfactory, negative and positive results. Sets of slides were changed between the partners every 3 months. At the end of each year a senior cytopathologist was invited to discuss the major discrepancies found in the study. RESULTS: A total of 1,041 cases were analyzed. Full concordance was obtained in 74.4% (774) of cases and discrepancies in 25.6% (267 cases). Full agreement was achieved in 276 (39%) of 707 cases categorized as negative. In 421 negative cases from laboratory A, this concordance represents 65.5% and 96.5% for laboratory B, which submitted 286 negative cases. The main discordance was the high number of atypical squamous cells of undetermined significance cases: 3.1% for A and 128 (33.2%) for B. Samples with discrepancies related to the quality of the material was another controversial issue: of 16 cases from laboratory A, 6 (37.5%) unsatisfactory cases were the same and 10 (62.5%) different. Laboratory B presented 20 unsatisfactory cases, and 14 (70.0%) had other diagnoses. Low grade squamous intraepithelial lesion and high grade squamous intraepithelial lesion concordance ranged from 75% to 80%, and invasive carcinoma has 4 discordances (28.5%), 3 previously screened as high grade squamous intraepithelial lesion and 1 as atypical squamous cells of undetermined significance. The kappa value obtained was 0.65, indicating substantial agreement. CONCLUSION: Our results indicated that atypical squamous cells of undetermined significance diagnoses are the crucial point of controversies and concern the quality of routine diagnosis in cytopathology.

Conventional Pap smear and liquid-based cytology as screening tools in low-resource settings in Latin America: experience of the Latin American screening study.

OBJECTIVE: To evaluate the performance of the conventional Pap test and liquid-based cytology (LBC) in an ongoing multicenter trial testing optional screening tools (cytology, screening colposcopy, visual inspection with acetic acid, visual inspection with Lugol's Iodine, cervicography and Hybrid Capture II [HCII] (Digene Brazil, São Paulo, Brazil) conventional and self-sampling), for cervical cancer in Brazil and Argentina. STUDY DESIGN: A cohort of 12,107 women attending four clinics (Campinas, São Paulo, Porto Alegre, Buenos Aires) were randomized into the 8 diagnostic arms. Women testing positive with any of the tests were referred for colposcopy, and cervical biopsies were used as the gold standard to assess performance characteristics of the diagnostic tests. Conventional Pap smears were sampled by all clinics (n = 10,240), and LBC (Autocyte PREP, [TriPath Imaging, Burlington, North Carolina, U.S.A.], n=320, and DNA-Citoliq [Digene Brazil], n =1,346) was performed by 1 of the clinics. RESULTS: Conventional Pap smears showed no squamous intraepithelial lesions (normal) in 8,946 (87.4%) and LBC in 1,373 (82.4%). Using high grade squamous intraepithelial lesions (HSIL) as the cutoff, Pap smears predicted high grade (cervical intraepithelial neoplasia [CIN] 3) with OR 63.0 (95% CI, 36.90-107.70), standard error (SE) 59%, SP 97.8%, positive predictive value (PPV) 68.1% and negative predictive value (NPV) 96.7%. The same figures for Autocyte PREP were: OR 9.0 (95% CI, 2.43-33.24), sensitivity (SE) 33.3%, specificity (SP) 100%, PPV 100% and negative PV (NPV) 88.8%. DNA-Citoliq detected CIN 3 as follows: OR 11.8 (95% CI 2.60-53.26), SE 40.0%, SP 94.6%, PPV 40.0% and NPV 94.6%. Lowering the cutoff to low grade squamous intraepithelial lesions increased SE and NPV but compromised SP and PPV. The detection rates for high grade lesions after an atypical squamous cells of undetermined significance diagnosis were similar with the 3 techniques. In our settings, the 3 methods of cervical cytology were slightly different in performance. The conventional Pap smear had the highest SE, while Autocyte PREP had 100% SP and PPV in detecting CIN3 with the HSIL cutoff. All 3 tests had lower SE but higher SP as compared to HCII.

Molecular strategies for identifying human papillomavirus infection in routinely processed samples: focus on paraffin sections.

OBJECTIVE: To optimize the protocols of human papillomavirus (HPV) detection in clinical samples, we used polymerase chain reaction (PCR)-based techniques in paraffin-embedded tissue sections and compared the results with those obtained with PCR and Hybrid Capture II (HC2) performed in liquid-based cytology (LBC) preservation medium. MATERIALS AND METHODS: Forty-five consecutive cervical biopsy specimens were taken from women participating in the ongoing Latin American Screening Study at Leonor Mendes de Barros Hospital, São Paulo, Brazil, during 2003 and 2004. The biopsy specimens were analyzed for HPV by a modified GP5+/GP6+ PCR protocol, and the results were compared with those obtained by PGMY PCR and HC2 in samples collected in LBC preservation medium. RESULTS: beta-Globin was detected in 100% of the multiplex PCR system from LBC samples and 66.7% with PCO4+/PCO3+ PCR in biopsy specimens. Of the three methods, PGMY PCR system and HC2 were equally effective in detecting HPV; both detected 13 cases in 45 samples (28.9%). The GP5+/GP6+ PCR applied in biopsy specimens showed a 20% HPV detection rate (9/45). CONCLUSIONS: Our PCR protocols worked reasonably well and allowed us to compare the three molecular methods with histological and cytological findings. The reproducibility of the results makes the technique applicable in archival materials.

Is agNOR and DNA ploidy analysis useful for evaluating thyroid neoplasms?

OBJECTIVE: To correlate the subjective AgNOR counting method and DNA content with histologic diagnoses of thyroid cancer and invasion. STUDY DESIGN: Eighty-one consecutive cases of thyroid carcinoma were selected for DNA and AgNOR analysis. The diagnoses were: papillary carcinoma (n = 40), follicular carcinoma (n = 31), Hürthle cell adenocarcinoma (n = 4), and undifferentiated carcinoma (n = 6). Seven normal thyroids were used as controls. DNA quantitative measurement was performed with Vidas 2.0 software (Kontron Bildanalyse, Munich, Germany) connected to an MPM 210 photometer microscope (Carl Zeiss, Oberkochen, Germany). The DNA index was obtained using histograms. Counting the NORs was performed by subjectively counting the NORs in 200 malignant cells. RESULTS: DNA ploidy analysis showed all Hürthle cell adenocarcinomas, 21 (67%)follicular tumors, 23 (57%) papillary tumors and 4 (67%) undifferentiated carcinomas to be aneuploid. DNA analysis correlated with histologic type of the tumor (p = 0.032). There was no statistical significance to the AgNOR counting variables studied. Statistical analysis showed correlation between ploidy and histologic diagnosis, but not AgNOR counting, to have prognostic value. CONCLUSION: DNA ploidy is more useful than subjective counting of NORs as an adjunct method for thyroid lesion analysis.

Immunocytochemical expression of p16INK4A and Ki-67 in cytologically negative and equivocal pap smears positive for oncogenic human papillomavirus.

This study was designed to analyze the cross-sectional comparison of the p16 and Ki-67 immunocytochemical expression in negative and equivocal (atypical squamous cells of undetermined significance (ASC-US)) liquid-based cytology (LBC) samples testing positive for high-risk human papillomavirus (HPV) types with HC2 assay or polymerase-chain reaction (PCR). A series of 199 consecutive LBC specimens derived from the same number of women participating in the ongoing Latin American Screening Study at Leonor Mendes de Barros Hospital, Sao Paulo, were analyzed using immunocytochemistry for expression of p16 and Ki-67 in negative and equivocal LBC samples testing positive for high-risk HPV types with hybrid capture II test (HC2) or PCR. All patients with at least one test positive (cytology, PCR, and/or HC2) were followed each 6 months for 3 years. The follow-up procedure consisted of visual examination, colposcopic inspection, cytology, and HC2 assay. Among the negative cytologic samples, 101 were HPV-positive and 55 HPV-negative. Of the HPV-positive group, 59 of 101 cases (58.4%) were positive for both p16 and Ki67 immunostaining, and 17 of 101 (16.8%) were negative for both. The proportion of Ki-67-positivity increased almost in parallel with the increasing grade of p16-positivity (p = 0.0001 for linear trend). In the HPV-negative group, both markers were negative in 41 of 55 cases (74.5%), and no statistical relationship was observed between the two markers (Pearson, p = 0.595). HPV-positive ASC-US samples demonstrated a simultaneous positive immunoreaction for p16 and Ki67 in 11 of 16 cases (68.7%), whereas 3 (18.7%) were concurrently negative. The relationship between the two markers was of borderline significance (Pearson, p = 0.053), but no linear relationship was found between the graded p16 and Ki-67 expression (p = 0.065 for linear trend). In the HPV-negative ASC-US group, there was no statistical association between the graded p16 and Ki-67 positivity (Pearson, p = 0.281). After 36 months of follow-up of the ASC-US patients, 6 women still displayed ASC-US smear, of which 4 of 6 were HPV-positive and expressed both p16 and Ki-67 markers. Two of 43 ASC-US smears had high-grade squamous intraepithelial lesions diagnosed (4.6%), and 1 had low-grade squamous intraepithelial lesion (2.3%). All of those were positive for HPV, p16 and Ki-67. Patients with ASC-US diagnosis and positive high-risk HPV status and positive for p16 Ki67 should be carefully observed to exclude occurrence of a squamous intraepithelial lesion. The combination of these two markers can be a useful implement for management of women with equivocal cytology.

Estudo preliminar do SISCOLO-Qualidade na rede de saúde pública de São Paulo / SISCOLO-quality control system in the health public laboratories: preliminary study

Analisar criticamente os primeiros resultados do Sistema de Informação Laboratorial do Programa Nacional de Combate ao Câncer de Colo Uterino (SISCOLO-Qualidade). Foram utilizados esfregaços cervicovaginais corados pelo método de Papanicolaou, provenientes da rotina diagnóstica do Laboratório de Anatomia Patológica da Fundação Oncocentro de São Paulo (FOSP) e referentes a março de 2000. Esses casos foram reavaliados em estudo cego pela equipe do Setor de Citologia Oncótica da Divisão de Patologia do Instituto Adolfo Lutz/São Paulo. O Programa SISCOLO-Qualidade seleciona, entre os casos analisados no período, todas as citologias positivas (ASCUS, AGUS, NIC e carcinomas) e, para completar 10 por cento do total das lâminas, todos os casos insatisfatórios e negativos aleatoriamente. Dos 8.370 casos da rotina da FOSP, o SISCOLO-Qualidade selecionou 837 amostras. Entre as amostras selecionadas, 23,4 por cento apresentaram material representativo da junção escamocolunar, 5 por cento foram considerados material insatisfatório e 71,1 por cento, material satisfatório, mas limitado. O resultado da análise foi 86,62 por cento de concordância, 12,42 por cento de discordância de um grau e 0,96 por cento de discordância de mais de um grau. Concluímos que o Programa SISCOLO-Qualidade é aplicável na rede de saúde pública para monitoramento externo, atendendo às expectativas de qualidade exigidas pelo Ministério da Saúde.

High-risk HPV detection by Hybrid Capture and ploidy determination by a computer-assisted system in cervical biopsies.

OBJECTIVE: To correlate high-risk HPV (hrHPV) detection by Hybrid Capture II (HC2) (Digene, Gaithersburg, Maryland, U.S.A.) with DNA content (ploidy) of cervical biopsies analyzed by a computer-assisted system. STUDY DESIGN: Cervical biopsies from 54 women examined at Leonor Mendes de Barros Hospital, São Paulo, as part of the Latin American Screening study during 2002--2003, were tested for hrHPV with HC2. All patients had been referred for colposcopic examination due to an abnormal cervical cytology. The final diagnosis included 30 cervicitis, 14 cervical intraepithelial neoplasia (CIN) 1, 5 CIN 2, 4 CIN 3 and 1 squamous cell carcinoma (SCC). Five-micrometer sections of each biopsy were stained with Feulgen-tionine and evaluated with the CAS 200 System (Becton Dickinson, U.S.A.), using the 3.0 software (version 8.1) of the DNA Quantitative Measurement Program (Becton Dickinson). Ploidy was evaluated from histograms obtained by analyzing atypical nuclei. RESULTS: Of the 30 cervicitis cases, 28 (93.3%) were diploid, and hrHPV was detected in 8 (28.5%) of the cases. Two tetraploid cervicitis lesions were observed, 1 positive and 1 negative for hrHPV. Among the CIN 1 lesions, 8 (57.1%) were diploid and 6 (42.8%) aneuploid. Of the latter, 4 (66.6%) were negative and 2 (33.3%) positive for hrHPV. Of the 5 CIN 2 lesions, 2 were diploid, 2 aneuploid and 1 tetraploid; all were positive for hrHPV. All CIN 3 lesions and the SCC proved to be aneuploid and positive for hrHPV. CONCLUSION: The data suggest that the majority of cervicitis and CIN 1 lesions are diploid and negativef or hrHPV. This is in sharp contrast to high grade CIN 2-3 lesions, all of which were positive for hrHPV in this study and also aneuploid, consistent with their progressive potential.

A morphological protocol and guide-list on uterine cervix cytology associated to Papillomavirus infection.

The present study was designed to further assess the validity of the cytological description of morphological lesions said to be related to Papillomavirus (HPV) infections in senior women. The casuistic comprised 196 cervical smears from a group of women with no clinical or morphological evidence of neoplasia, collected simultaneously with samples submitted to detection of HPV DNA by PCR in a previous study. Three experienced cytologists studied each slide in two different conditions, with an interval of 20 months between them. The first approach was performed under routine laboratory standards, whereas the second was guided by a list of 16 well-defined parameters indicative of HPV-related cytological lesions. When suspicious cases of HPV-related alterations were grouped with positive cases, they showed on average: sensitivity of 25.5%, specificity of 84.4% and positive predictive value (PPV) of 26.8%. When suspicious cases were grouped with negative cases, sensitivity decreased, whereas specificity and PPV increased, as expected. In the second reading, which followed a "guide-list", a decrease in sensitivity was observed, contrasting with a sharp increase of positive predictive value. Among the 16 cytomorphological criteria tested, "koilocytosis", "mild koilocytosis" and "condylomatous parabasal cells" yielded the best predictive value for HPV DNA detection by PCR. In conclusion, despite the low sensitivity, cytopathologic assessment of cervico-vaginal smears leads to a highly specific diagnosis of HPV infection in menopausal women, with PPV of 91.0% when directed by a guide-list of well-defined morphologic criteria.

Pap test in a high-risk population comparison of conventional and liquid-base cytology.

Liquid-based cytology (LBC) is believed to have better sensitivity than conventional smears (CSs) and offers the possibility to perform molecular assay. The goal of this work was to study the performance of CS and LBC in a high-risk population and to compare the results with the hybrid capture (HC) II for high-risk human papillomavirus (HPV). Samples were collected from selected women with clinical suspicions of low genital tract lesion at Pérola Biygnton Hospital (São Paulo, Brazil). After CS preparation, the brush was introduced in the endocervix and a new sample was collected and rinsed in the preservative medium of the system. The residual material was used to HC2. From 925 cases, LBC was unsatisfactory in 4 (1.51%) cases and CS was unsatisfactory in 100 cases (10.81%); among theses cases HC2(+) reactions was observed in 54 (54%) CSs and 3 (21.4%) LBCs. Considering cases with atypia of undetermined significance (squamous and glandular), 85 (77.27%) cases from LBC and 44 (86.4%) from CS were positive for HC2 assay for high-risk DNA-HPV. The difference among the methods was not significant (P < 0.38). The diagnosis improvement of LBC in comparison with CS was 86% in satisfactory samples, 92.76% in undetermined atypical lesions (including glandular), 83% in positive low-grade squamous intraepithelial lesions (LSIL(+)), and 86.84% in high-grade SIL(+) (HSIL(+)). HC2(+) reactions were observed in 144 CS cases and 266 LBC cases with abnormalities. Our results have showed that LBC was superior to CS in a high-risk population to detect lesions with high concordance with HC2(+) reactions; CSs also exhibit a high concordance with HC2 assay but with inferior performance to detect lesions.

A morphological protocol and guide-list on uterine cervix cytology associated to Papillomavirus infection

O presente estudo analisou aspectos relacionados ao valor da citologia cervical na identificação de alteraçäes cito-morfológicas relacionadas à infecção por Papilomavírus humano (HPV) em mulheres com idades avançadas. A casuística compreendeu 196 amostras cérvico-vaginais provenientes de uma população de mulheres sem evidências clínicas ou citológicas de neoplasia cervical. As amostras foram coletadas simultaneamente para pesquisas para DNA-HPV por Reação de Polimerização em Cadeia (PCR) e citologia. Três observadores experientes efetuaram análise das lâminas em duas etapas com intervalo de 20 meses: a primeira em condiçäes de rotina laboratorial e a segunda dirigida por um roteiro de critérios pré-estabelecidos. Quando os casos suspeitos para alteraçäes relacionadas ao HPV foram agrupados com os casos positivos, eles mostraram em média: 25,5 de sensibilidade, 84,4 de especificidade e valor preditivo positivo (VPP) de 26,8. Quando os casos suspeitos foram agrupados com os negativos, a sensibilidade diminuiu, e a especificidade e o VPP aumentaram. Na segunda leitura, a sensibilidade diminuiu, contrastando com o aumento do VPP. Entre os 16 critérios cito-morfológicos avaliados, coilocitose, coilocitose leve e célula parabasal coilocitótica foram os que apresentaram melhor VPP para HPV em comparação ao PCR. Concluímos que, apesar da baixa sensibilidade, o painel de critérios cito-morfológicos poderá elevar a especificidade do teste de Papanicolaou para triagem das alteraçäes relacionadas à infecção por HPV em pacientes de mais idade.

Citologia de base líquida associada à captura de híbridos para DNA-HPV pode otimizar a qualidade diagnóstica do método de Papanicolaou? / Could liquid based cytology associated with hybrid capture II assay for HPV-DNA optimize the cytological diagnosis?

A associação da citologia de base líquida (BL) e o teste de Captura de Híbridos II (HC2) para DNA HPV poderão otimizar o diagnóstico citológico, sobretudo os de origem indeterminada (ASCUS/AGUS). Avaliamos as amostras colhidas com o sistema DNA-CITOLIQ (DIGENE - Brasil) para citologia de BL e HC2, de pacientes atendidas no Hospital Leonor Mendes de Barros. Foram realizados 842 exames de citologia de BH e HC2, onde 64 (7,6%) amostras apresentaram atipias de significado indeterminado (ASCUS/AGUS)de citologia na BL. O HC2 para DNA HPV de alto risco foi positiva em 16 (25%) amostras de ASCUS e quatro (6,2%) de atipia glandular (AGUS). De 748 amostras 88,8% foram citologicamente negativas e destas 97 (11,5%) foram positivas para HPV de alto risco. Essas alterações estão associadas à infecção pelo HPV e, portanto, colocam a paciente em um grupo com conduta diferenciada da população normal. Adicionalmente, os casos com resultados negativos no exame citológico, que nos testes de DNA HPV foram positivos, demonstraram a elevada sensibilidade das técnicas biomoleculares em relação à morfologia. Concluímos que a citologia de BL associada a HC2, pode melhorar a sensibilidade do método de Papanicolau

Revisão de esfregaços cervicais negativos em pacientes com lesöes intra-epiteliais de alto grau / Review of previous negative smears from patients with high grade intraepithelial neoplasia

Entre as estratégias de controle de qualidade, a revisäo de exames negativos anteriores em pacientes com exame atual positivo é considerada uma das mais eficientes para detecçäo de falsos negativos. No presente estudo foram revistos os esfregaços prévios negativos de pacientes com NIC 2 ou NIC 3 nos anos de 1998 e 1999. Durante este período o Instituto Adolfo Lutz realizou 113.619 exames colpocitológicos, sendo 233 casos diagnosticados como NIC 2 ou NIC 3. Entre estes casos apenas 36 tinham exames prévios no Instituto Adolfo Lutz no período de 36 meses antes do diagnóstico original. Obtivemos 22 casos de NIC (12 NIC 1, sete NIC 2 e três NIC 3) e 14 casos com diagnóstico negativo (normal ou inflamatório), os quais pertenciam a 12 pacientes. Após revisäo destes esfregaços obtivemos os seguintes resultados: insatisfatório (dois casos), inflamatório (cinco casos), NIC 1 (três casos), NIC 2 (um caso). Concluindo, a revisäo dos exames anteriores negativos é uma estratégia altamente eficiente para detectar os resultados falsos negativos. Sua prática pode ser útil para orientar diversas medidas de educaçäo continuada

Computer-assisted analysis of p53 and PCNA expression in oral lesions infected with human papillomavirus.

OBJECTIVE: To carry out a retrospective study to determine whether human papillomavirus (HPV) infection and immunohistochemical expression of p53 and proliferating cell nuclear antigen (PCNA) are related to the risk of oral cancer. STUDY DESIGN: Fifty-seven oral biopsies, consisting of 30 oral squamous papillomas (OSPs) and 27 oral squamous cell carcinomas (OSCCs) were tested for the presence of HPV 6/11 and 16/18 by in situ hybridization using catalyzed signal amplification and in situ hybridization. p53 And PCNA expression was analyzed by immunohistochemistry and evaluated quantitatively by image analysis. RESULTS: Nineteen of the 57 oral lesions (33.3%) were positive for HPV. HPV 6/11 was found in 6 of 30 (20%) OSPs and 1 of 27 (3.7%) OSCCs. HPV 16/18 was found in 10 of 27 (37%) OSCCs and 2 of 30 (6.7%) OSPs. Sixteen of the 19 HPV-positive cases (84.2%) were p53 negative; 5 (9%) were HPV 6/11 and 11 (19%) HPV 16/18, with an inverse correlation between the presence of HPV DNA and p53 expression (P = .017, P < .05). PCNA expression appeared in 18 (94.7%) of HPV positive cases, showing that HPV 16/18 was associated with intensity of PCNA expression and with OSCCs (P = .037, P < .05). CONCLUSION: Quantitative evaluation of p53 by image analysis showed an inverse correlation between p53 expression and HPV presence, suggesting protein degradation. Image analysis also demonstrated that PCNA expression was more intense in HPV DNA 16/18 OSCCs. These findings suggest involvement of high-risk HPV types in oral carcinogenesis.

Detecção de ß-globina PCR em amostras citológicas cérvico-uterinas: estudo retrospectivo / PCR ß-globin detection in cytological uterine cervix samples: retrospective study

Estudos retrospectivos com a sensível técnica da polymerase chain reaction (PCR) feitos em esfregaços previamente corados por Papanicolaou pode revelar importantes parãmetros sobre o comportamento biológico das alterações citológicas provocadas por infecções virais e outros agentes mutagênicos. Para isso, o domínio metodológico das reações deve ser confiável e factível. O objetivo do presente estudo foi avaliar a extração do DNA da ß-globina por PCR nas amostras cérvico-uterinas em várias condições de preparo para avaliação da qualidade do DNA sob a ação de fixadores, corantes e sua relação com o protocolo utilizado. Para tanto, testou-se esfregaços citológicos preparados sob diferentes condições técnicas de fixação, coloração e montagem. As principais condições envolveram fixação em álcool e carbowax esfregaços corados e não corados, montagem com lamínula ou não, e ainda descoloração com HCI. Os primers usados para identificação da ß-globina foram PCO3 5' - ACACAACTGTGTTCACTAGC - 3' e PCO 4 5' - CAACTTCATCCACGTTCACC - 3'. O conteúdo de DNA extraído e quantificado variaram de 23,46 ng/µL. Somente amostras fixadas em álcool 100% e carbowax sem a coloração pelo método de Papanicolaou amplificaram 110 pares de bases do gene de ß-globina. Pelo protocolo analisado ficou evidente que estudos retrospectivos em séries previamente coradas pelo método de Papanicolaou apresentam importantes limitações para suas realizações. Para superar essas limitações temos que estudar novos protocolos que superem os fatores inibitórios oriundos dos processos de fixação e sobre tudo coloração.

Retrospective studies with polymerize chain reaction (PCR) methodology in cytological smears previously stained with Papanicoloau could reveal important parameters about the biological behavior of cytological alterations induced by viral infection and another mutagenic agents. To obtain such informations, methodology should be reliable. The goal of this study was to evaluate the extraction...

Papilomavírus humano (HPV) em lesões benignas e malignas de mucosa oral pelos métodos de imuno-histoquímica e hibridização in situ / Human papillomavirus (HPV)in benign and malignant oral lesions by immunohistochemistry and in situ hybridization methods

Quinze biópsias orais com diagnóstico histopatológico de papiloma (n=7), e carcinoma espinocelular invasivo (n=8) foram investigadas para a presença do papilomavírus humano (HPV) por imuno-histoquímica (IHQ) e hibridização in situ (HIS). As proteínas do capsídeo viral foram avaliadas por imuno-histoquímica com anticorpo policlonal e o DNA do vírus analisado por hibridização in situ com sondas biotiniladas de amplo espectro, 6/11 e 16/18. O HPV foi detectado por IHQ em 13 por cento (n=2) e, por HIS, em 60 por cento (n=9) das lesões orais. As duas biópsias positivas na IHQ também foram positivas para a presença do DNA de HPV 6/11. Além disso, o HPV 16/18 foi encontrado em 20 por cento dos carcinomas orais e em 7 por cento dos papilomas, enquanto o HPV 6/11 foi detectado em 7 por cento dos carcinomas e 26 por cento dos papilomas. Pode-se concluir deste estudo que a reação imuno-histoquímica é pouco sensível para o diagnóstico de HPV e que a presença do HPV 16/18 em lesões benignas e malignas sugere a participação deste vírus na carcinogênese oral.

Celularidade dos esfregaços cervicovaginais: importância em programas de garantia de qualidade em citopatologia / Cellularity of the cervicovaginal smear: importance to the quality assurance proceedings in cytopathology

A importância da composiçäo celular nos esfregaços rotineiros de Papanicolaou foi estudada com o intuito de se observar o papel representado pela presença ou näo de células da junçäo escamocolunar do reconhecimento citológico de lesöes neoplásicas e pré-neoplásicas do colo uterino. Estudou-se, retrospectivamente, a celuraridade de 309.452 esfregaços cervicovaginais analisados no Setor de Citologia Oncótica do Instituto Adolfo Lutz em cinco anos consecutivos: 1992 a 1996. A classificaçäo utilizada foi a da Organizaçäo Mundial de Saúde de 1984. Os casos foram divididos em dois grupos: com e sem representaçäo da junçäo escamocolunar (JEC). A detecçäo de neoplasia intraepitelial cervical (NIC) foi crescente ao longo dos anos em ambos os grupos, sendo ao redor de 10 vezes maior no grupo com representaçäo da JEC nos cinco anos estudados. Neste grupo, a detecçäo de NIC variou de 1,22 por cento (1992) a 4,63 por cento (1996) enquanto que no grupo sem apresentaçäo de JEC variou de 0,15 por cento (1992) a 0,36 por cento (1996). As diferenças de dados obtidos entre os grupos estudados foi significativa, apontando para maior frequência de lesöes pré-neoplásicas em casos com representaçäo da JEC. Esse dado é de extrema importância para as estratégias de garantia de qualidade em citopatologia, pois revela um parâmetro inequívoco para adequaçäo das amostras

Atipias glandulares em esfregaços cérvicos-vaginais: correlaçao cito-histológica / Atypical glandular in cervicovaginal squamous: cyto-histological correlation

A presença de células glandulares com hipercromasia e ansiocariose em culturas cervicais é uma descoberta cujo diagnóstico é de difcil interpretaçao. No presente estudo, analisaram-se 14 casos de pacientes do Serviço de Saúde Pública do Estado de Sao Paulo, com correlaçao cito-histológica. A citologia cervical desses casos apresentava células glandulares e escamosas atípicas (três casos). O diagnóstico citológico inicial foi respectivamente neoplasia cervical intra-epitelial de Grau 1 (CIN 1) com HPV, e CIN 1 com displasia endocervical ou metaplasia atípica. As pacientes foram submetidas à biopsia cervical e os diagnósticos histopatológicos foram: seis casos com lesao sem CIN (cinco cervicites com metaplasia e um pólipo endometrial), dois casos de CIN 1 (diagnóstico do mesmo grau da citologia) e seis casos com lesóes de alto grau (1 CIN II, 4 CIN III e 1 carcinoma "in situ"). Cinco dos seis casos apresentavam extensao glandular. A revisao dos slides citológicos revelou que alguns grupos de células interpretadas como célula glandulares devido à disposiçao das escamas (sheets) de células parabasais escamosas atípicas. Em duas delas, a presença de leucócitos e sanguineas abundantes dificultou a visualizaçao de células escamosas atípicas. Conclui-se que as culturas cervicais com presença de células glandulares atípicas devem ser cuidadosamente examinadas. Deve-se recomendar o exame histopatológico da lesao por biópsia para correlaçao cito-histológica. Por outro lado, os critérios morfológicos para diagnóstico citológico devem ser aperfeiçoados