ABSTRACT
The present communication reports the infestation of nasal cavities of sheep by larvae of Oestrus ovis from Kashmir Valley.
ABSTRACT
The physicochemical, oxidative, texture and microstructure properties were evaluated for low fat meat emulsions containing varying levels of guar/xanthan gum mixture (1:1 ratio) as a fat substitute. Partial replacement of fat with guar/xanthan gum resulted in higher emulsion stability and cooking yield but lower penetration force. Proximate composition revealed that high fat control had significantly higher fat and lower moisture content due to the difference in basic formulation. Colour evaluation revealed that low fat formulations containing gum mixture had significantly lower lightness and higher yellowness values than high fat control formulation. However non-significant difference was observed in redness values between low fat formulations and the high fat control. The pH values of the low fat formulations containing gum mixture were lower than the control formulations (T0 and TC). The MetMb% of the high fat emulsion formulation was higher than low fat formulations. The significant increase of TBARS value, protein carbonyl groups and loss of protein sulphydryl groups in high fat formulation reflect the more oxidative degradation of lipids and muscle proteins during the preparation of meat emulsion than low fat formulations. The SEM showed a porous matrix in the treatments containing gum mixture. Thus, the guar/xanthan gum mixture improved the physicochemical and oxidative quality of low fat meat emulsions than the control formulations.
ABSTRACT
Goshtaba is a restructured meat product of Kashmiri wazwan prepared from meat emulsion with added fat (20 %), salt, spices and condiments and cooked in the curd. The present study was undertaken for the development of low fat goshtaba with the addition of xanthan gum as a fat replacer and was evaluated for proximate composition, pH, colour, lipid and protein oxidation, texture, microstructure and sensory properties. Low fat goshtaba formulations containing xanthan gum were higher in protein and moisture contents but, lower in fat content and pH value than the high fat control (p < 0.05). Colour evaluation revealed that high fat goshtaba had significantly higher L* value, but lower a* value than its low fat counterparts (p < 0.05). The significant decrease of TBARS values, protein carbonyls and loss of protein sulphydryl groups in low fat goshtaba formulations reflects the potential antioxidant activity of xanthan gum (p < 0.05). Hardness was significantly higher in high fat control but, cohesiveness, gumminess, and chewiness did not show any significant difference. Springiness increased with the increasing concentration of xanthan gum (0.5-1.5 %) and was higher in low fat product containing 1.5 % xanthan gum. SEM results indicate that xanthan gum lead to formation of an additional gel network which holds more water. Sensory evaluation revealed that goshtaba product with 0.5 % xanthan gum had quality characteristics that were similar to the control product containing 20 % fat.
ABSTRACT
BACKGROUND: Many studies have shown that alien species richness pattern follows that of native species richness patterns along environmental gradients, without taking the specific composition of the two groups into account. OBJECTIVES: To compare species richness patterns of native and alien woody plants along an altitudinal gradient in Kashmir Himalaya, India, and to analyse the specific composition, e.g. proportion of life forms. METHODS: Analysis of secondary data from published floristic inventories. The gradient (500-4800m asl) was split into 100m bands and presence/absence data for each species were obtained, for each band. RESULTS: Species richness of both native and alien species followed a hump-shaped distribution. Alien species richness dropped faster above 2000masl than the native did. The ratio of trees to shrubs decreased monotonically along the gradient in native species, but showed a peak at c. 2500masl in alien species. Alien species flowered in average earlier than native species. CONCLUSIONS: The change of species richness of native and alien species along altitude is similar, but the proportion of life forms is not. Most likely both climatic and socio-economic factors affect alien species richness and its specific composition in the Kashmir Himalaya.
Subject(s)
Altitude , Biodiversity , Introduced Species , Plants , Climate , Ecosystem , India , Socioeconomic FactorsABSTRACT
Bitter gourd (Momordica charantia L.) is widely grown and consumed as a vegetable in Pakistan and other countries in the region. In 2007, a severe disease appeared on bitter gourd that reduced yield significantly. Symptoms of the disease included chlorosis, leaf crumpling, vein thickening, and stunting of plants that were suggestive of a virus infection. Symptomatic leaf samples were collected from fields in the vicinity of Faisalabad, Pakistan (Thikriwala, 12 km from Faisalabad, 31°22'0â³N, 72°53'0â³E). Seven infected samples were tested for the presence of Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus, Papaya ringspot virus, Melon necrotic spot virus, and Squash mosaic virus by double-antibody sandwich-ELISA according to the manufacturer's instructions (Bio-Rad, Hercules, CA). All samples of bitter gourd were found to be negative for all five RNA viruses, whereas melon samples collected from the same area (Thikriwala) were infected by ZYMV as reported earlier (3). Samples were also screened for begomoviruses by molecular tests. Total DNA was extracted with the cetyltrimethylammoniumbromide method (4). All seven symptomatic samples were positive for a begomovirus when DNA A of Tomato leaf curl New Delhi virus (ToLCNDV) was used as a general probe by Southern hybridization. A probe of the movement protein (MP) gene of ToLCNDV was also positive by Southern hybridization, suggesting the infection of a bipartite begomovirus. The presence of a begomovirus was confirmed by PCR with universal primers designed for amplification of begomoviruses (BegomoRe F 5'ACGCGT GCCGTGCTGCTGCCCCCATTGTCC3' and BegomoRe R 5'ACGCGT ATGGGCTGYCGAAGTTSAGACG3'). A fragment of the expected length (approximately 2.8 kb) was cloned in a T/A cloning vector (ptz57R/t; Fermentas, Burlington, Ontario, Canada) and partially sequenced. Sequence analysis of partial sequences (925 bp, GenBank Accession No. FN555137; 719 bp, GenBank Accession No. FN555138) showed maximum identity (97%) with Tomato leaf curl Palampur virus (ToLCPaV) recently reported from India and Iran (1,2). To our knowledge, this is the first report of ToLCPaV in Pakistan and the first report of the virus on bitter gourd. References: (1) J. Heydarnejad et al. Arch. Virol. 154:1015, 2009. (2) Y. Kumar et al. Virus Genes 38:193, 2009. (3) A. H. Malik et al. Plant Pathol. 55:285, 2006. (4) M. G. Murray and W. F. Thompson. Nucleic Acids Res.8:4321, 1980.
ABSTRACT
OBJECTIVE: Bleeding from stapled colonic stapled anastomoses is rare, but occasionally may be severe enough to require re-operation, with associated morbidity. Endoscopic therapy is a potential alternative. METHOD: We examined a large 15-year prospective series of patients who had undergone colorectal resection with stapled anastomosis. We reviewed the management of cases where severe postoperative rectal bleeding had occurred. RESULTS: In six of 777 (0.8%) patients, bleeding occurred that was severe enough to require intervention. In the first three cases, conventional re-operation was performed. In the latter three cases, endoscopic therapy (adrenaline injection, diathermy or endoscopic clipping) was used to control the bleeding. No complications occurred as a result of endoscopic therapy, either patient or anastomosis related. CONCLUSION: Endoscopic management using standard endoscopic techniques appears safe and effective for haemostasis in colorectal stapled anastomotic bleeding. Endoscopic therapy should probably be attempted before re-operation is considered.
Subject(s)
Colon/surgery , Hemorrhage/therapy , Hemostasis, Endoscopic , Rectum/surgery , Sutures , Adult , Aged , Aged, 80 and over , Diathermy , Epinephrine/administration & dosage , Female , Humans , Male , Postoperative Complications , Prospective Studies , ReoperationABSTRACT
OBJECTIVES: To report a case of perinatal tuberculosis that appeared on the 21st day of life of an infant born to a mother with latent tuberculosis. CLINICAL PRESENTATION AND INTERVENTION: A preterm male infant was born by spontaneous vertex delivery at 33 weeks gestational age to a 33-year-old primiparous Philippine woman. The infant was well until the 21st day of life when he developed recurrent episodes of cyanosis and bradycardia. A chest radiograph showed infiltrates which were thought to be bacterial in origin. Blood, urine, and cerebrospinal fluid cultures were normal. Tracheal aspirate revealed acid-fast bacilli by Ziehl-Neelsen stain, later confirmed to be MYCOBACTERIUM TUBERCULOSIS by culture in Lowenstein-Jensen medium. The mother was later diagnosed as a case of tuberculosis with symptoms, signs and radiologic manifestation of hilar lymphadenopathy with mild pleural effusion and positive tuberculin skin test. Both infant and mother were treated with intravenous isoniazid, intravenous rifampicin, oral pyrazinamide, and intravenous pyridoxine. Both recovered. CONCLUSION: A preterm male infant perinatally acquired tuberculosis, most likely by inhalation of the bacteria during delivery. Both infant and mother responded well to antituberculous treatment.
Subject(s)
Tuberculosis/diagnosis , Humans , Infant, Newborn , Infectious Disease Transmission, Vertical , Kuwait , Male , Tuberculosis/transmissionABSTRACT
BACKGROUND: Although fragmentation of a liver biopsy specimen has been considered to be suggestive of cirrhosis, the evidence for this is difficult to find in the published literature. AIM: To determine whether fragmentation of percutaneous liver biopsy specimens correlates with the degree of fibrosis. METHODS: One hundred and eighty-six patients underwent percutaneous liver biopsy prospectively. The specimens were measured for the length and number of fragments. The extent of fibrosis was scored by a pathologist blind to the clinical data. Length and fragmentation data were compared between the different stages. RESULTS: The overall median fragment length was 1.85 cm and the median fragment number was four. Specimens with advanced fibrosis (stages III-IV) had more fragments than those with no or mild fibrosis (stages 0-II) (P < 0.0001). The aggregate fragment length decreased with increasing stage of fibrosis (P < 0.0001). Specimens with greater than 12 fragments were seen only with advanced fibrosis. CONCLUSIONS: Fragmentation of percutaneous liver biopsy specimens is common and increases with progression from early to advanced fibrosis. Fibrotic specimens fragment more often and more extensively.
Subject(s)
Liver Cirrhosis/pathology , Liver/pathology , Adult , Aged , Biopsy, Needle , Hepatitis C, Chronic/pathology , Humans , Middle Aged , Prospective Studies , Specimen HandlingABSTRACT
The occurrence of bilateral extradural hematomas is an uncommon consequence of craniocerebral trauma and its incidence is variable in various studies ranging from 2-25%.1 We studied all cases of head injury brought to our institute over a period of 6 months and found the incidence of bilateral extradural hematomas to be 13.3%.
Subject(s)
Craniocerebral Trauma/complications , Hematoma, Epidural, Cranial/epidemiology , Hematoma, Epidural, Cranial/etiology , Adult , Child , Hematoma, Epidural, Cranial/diagnostic imaging , Humans , Incidence , India , Retrospective Studies , Tomography, X-Ray ComputedABSTRACT
BACKGROUND: Conventional interferon monotherapy fails to achieve virological clearance in most hepatitis C-infected patients. The use of high-dose induction regimens may improve the initial clearance of virus, while the addition of ribavirin appears to improve the rates of sustained response once clearance is achieved. AIM: To compare the efficacy and safety of re-treatment with an induction regimen of high-dose interferon alpha-2b, with or without ribavirin, in chronic hepatitis C patients who have not responded to standard dose interferon monotherapy. METHODS: Previous virological non-responders to standard dose interferon (3-5 MU three times weekly for > or = 12 weeks) were randomized to receive, unblind, either 10 MU interferon alpha-2b daily for 10 days, then 5 MU daily for 74 days, then 5 MU three times weekly for 24 weeks (total 36 weeks) (group A), or the above regimen with the addition of ribavirin, 1000-1200 mg/day, at day 11 (group B). All patients were followed up for 24 weeks after completion of therapy. RESULTS: End of treatment virological response was noted in one of 10 (10%) patients in group A and in eight of 15 (54%) patients in group B (P=0.04). The sole end treatment responder in group A and three in group B relapsed on follow-up. The apparent improvement in response in group B compared to group A nearly reached statistical significance (group B 5/15 vs. group A 0/10; P=0.06). CONCLUSIONS: In this small pilot study, a 36-week high-dose induction interferon monotherapy protocol did not yield sustained responses in previous non-responders to standard dose interferon. However, the same regimen with ribavirin yielded a 33% sustained response rate, nearly reaching statistical significance. The therapy was well tolerated, despite the higher doses of interferon used and the addition of ribavirin. High-dose interferon with ribavirin appears to be a therapeutic option for non-responders to conventional interferon monotherapy.
Subject(s)
Antiviral Agents/administration & dosage , Antiviral Agents/therapeutic use , Hepatitis C, Chronic/drug therapy , Interferon-alpha/administration & dosage , Interferon-alpha/therapeutic use , Ribavirin/therapeutic use , Adult , Antiviral Agents/adverse effects , Drug Therapy, Combination , Female , Humans , Interferon alpha-2 , Interferon-alpha/adverse effects , Male , Middle Aged , Recombinant Proteins , Ribavirin/administration & dosage , Treatment FailureABSTRACT
A variety of illnesses involving the gut and liver follow hematopoietic cell transplantation (HCT). A 20 yr-old white male developed severe acute hepatitis 36 wk (day 252) after matched, unrelated, allogeneic HCT for chronic myelogenous leukemia (CML). Mild skin graft-versus-host disease (GVHD) had occurred at about 20 wk (day 140) after transplant. Liver biopsy showed bile duct injury and a diffuse lobular injury pattern most consistent with a GVHD variant and not reminiscent of drug-induced or viral hepatitis. No findings suggestive of herpesvirus, adenovirus, or varicella-zoster virus were found. High-dose steroids resulted in marked improvement of his liver enzyme levels. We report this patient as representing the acute hepatitic presentation of chronic GVHD of the liver.
Subject(s)
Graft vs Host Disease/complications , Hematopoietic Stem Cell Transplantation , Hepatitis/etiology , Acute Disease , Adult , Biopsy , Chronic Disease , Hematopoietic Stem Cell Transplantation/adverse effects , Hepatitis/drug therapy , Hepatitis/pathology , Humans , Leukemia, Myelogenous, Chronic, BCR-ABL Positive/therapy , Liver/pathology , Male , Prednisone/therapeutic use , Time FactorsABSTRACT
Chronic hepatitis B virus (HBV) infection is a leading cause of cirrhosis and hepatocellular carcinoma worldwide. Its prevalence approaches 10% in hyperendemic areas, such as southeast Asia, China, and Africa. Although chronic HBV infection is seen less frequently in North America and Europe, an estimated 1.25 million persons in the United States are infected. In the past decade, revolutionary strides have been made toward the treatment of chronic HBV infection. Interferon-alpha was once the only available therapy but has recently been joined by the nucleoside analogues, the most extensively studied of which is lamivudine. Interferon therapy continues to have a role in the treatment of a carefully selected group of patients. Lamivudine therapy, which has less stringent selection criteria, suppresses HBV DNA in almost all treated patients: Seventeen percent to 33% experience loss of hepatitis B e antigen, and 53% to 56% have a histologic response. Extended lamivudine treatment leads to the development of a specific lamivudine-resistant virus with base-pair substitutions at the YMDD locus of the DNA polymerase. Newer nucleoside analogues and other immunomodulator therapies are being investigated. In the future, combination therapy with different classes of agents may yield improved response rates and delay the development of resistance.
Subject(s)
Hepatitis B, Chronic/drug therapy , Adjuvants, Immunologic/therapeutic use , Amino Acid Motifs/genetics , Antiviral Agents/therapeutic use , Drug Therapy, Combination , Hepatitis B virus/physiology , Hepatitis B, Chronic/virology , Humans , Interferon alpha-2 , Interferon-alpha/therapeutic use , Lamivudine/therapeutic use , Mutation , RNA-Directed DNA Polymerase/genetics , Recombinant Proteins , Virus Replication/drug effectsSubject(s)
Chemical and Drug Induced Liver Injury/etiology , Chromans/adverse effects , Diabetes Mellitus, Type 2/drug therapy , Hypoglycemic Agents/adverse effects , Thiazoles/adverse effects , Thiazolidinediones , Chemical and Drug Induced Liver Injury/pathology , Chromans/therapeutic use , Female , Humans , Hypoglycemic Agents/therapeutic use , Liver/pathology , Middle Aged , Thiazoles/therapeutic use , TroglitazoneABSTRACT
The mega cisterna magna is one cause of a midline, extra-axial, posterior fossa cyst. The computed tomographic features and differential diagnosis of midline posterior fossa cystic structures are reviewed, and the clinical features of the mega cisterna magna are discussed. We describe a method of metrizamide cisternography and report a case of mega cisterna magna that was diagnosed by this technique.