Comparative physiological and transcriptome analysis in cultivated and wild sugarcane species in response to hydrogen peroxide-induced oxidative stress.

BACKGROUND: Sugarcane is an important energy crop grown worldwide,supplementing various renewable energy sources. Cultivated and wild sugarcane species respond differently to biotic and abiotic stresses. Generally, wild species are tolerant to various abiotic stresses. In the present study, the physiological and molecular responses of cultivated and wild sugarcane species to oxidative stress at the transcriptional levels were compared. Transcriptional responses were determined using RNAseq. The representative RNA-seq transcript values were validated by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) and confirmed through physiological responses. RESULTS: Oxidative stress causes leaf-rolling and -tip drying in cultivated sugarcane, but the wild species are tolerant. Higher chlorophyll fluorescence was observed in the wild species than that in the cultivated varieties under stress. Wild species can maintain a higher chlorophyll stability index than the cultivated species, which was confirmed by the lower transcripts of the chlorophyllase gene in the wild species than that in the cultivated variety. Transcription factor genes (NAC, MYB, and WRKY) were markedly expressed in response to oxidative stress, revealing their involvement in stress tolerance. The analysis revealed synchronized expression of acetyl-transferase, histone2A, cellulose synthase, and secondary cell wall biosynthetic genes in the wild species. The validation of selected genes and 15 NAC transcription factors using RT-qPCR revealed that their expression profiles were strongly correlated with RNA-seq. To the best of our knowledge, this is the first report on the oxidative stress response in cultivated and wild sugarcane species. CONCLUSION: Physiological and biochemical changes in response to oxidative stress markedly differ between cultivated and wild sugarcane species. The differentially expressed stress-responsive genes are grouped intothe response to oxidative stress, heme-binding, peroxidase activity, and metal ion binding categories. Chlorophyll maintenance is a stress tolerance response enhanced by the differential regulation of the chlorophyllase gene.There is a considerable difference in the chlorophyll stability index between wild and cultivated varieties. We observed a substantial regulation of secondary wall biosynthesis genes in the wild species compared with that in the cultivated variety, suggesting differences in stress tolerance mechanisms.

QTL mapping and identification of candidate genes linked to red rot resistance in sugarcane.

Sugarcane (Saccharum species hybrid) is one of the most important commercial crops cultivated worldwide for products like white sugar, bagasse, ethanol, etc. Red rot is a major sugarcane disease caused by a hemi-biotrophic fungus, Colletotrichum falcatum Went., which can potentially cause a reduction in yield up to 100%. Breeding for red rot-resistant sugarcane varieties has become cumbersome due to its complex genome and frequent generation of new pathotypes of red rot fungus. In the present study, a genetic linkage map was developed using a selfed population of a popular sugarcane variety CoS 96268. A QTL linked to red rot resistance (qREDROT) was identified, which explained 26% of the total phenotypic variation for the trait. A genotype-phenotype network analysis performed to account for epistatic interactions, identified the key markers involved in red rot resistance. The differential expression of the genes located in the genomic region between the two flanking markers of the qREDROT as well as in the vicinity of the markers identified through the genotype-phenotype network analysis in a set of contrasting genotypes for red rot infection further confirmed the mapping results. Further, the expression analysis revealed that the plant defense-related gene coding 26S protease regulatory subunit is strongly associated with the red rot resistance. The findings can help in the screening of disease resistant genotypes for developing red rot-resistant varieties of sugarcane. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03481-7.

Recent Advances in Sugarcane Genomics, Physiology, and Phenomics for Superior Agronomic Traits.

Advances in sugarcane breeding have contributed significantly to improvements in agronomic traits and crop yield. However, the growing global demand for sugar and biofuel in the context of climate change requires further improvements in cane and sugar yields. Attempts to achieve the desired rates of genetic gain in sugarcane by conventional breeding means are difficult as many agronomic traits are genetically complex and polygenic, with each gene exerting small effects. Unlike those of many other crops, the sugarcane genome is highly heterozygous due to its autopolyploid nature, which further hinders the development of a comprehensive genetic map. Despite these limitations, many superior agronomic traits/genes for higher cane yield, sugar production, and disease/pest resistance have been identified through the mapping of quantitative trait loci, genome-wide association studies, and transcriptome approaches. Improvements in traits controlled by one or two loci are relatively easy to achieve; however, this is not the case for traits governed by many genes. Many desirable phenotypic traits are controlled by quantitative trait nucleotides (QTNs) with small and variable effects. Assembling these desired QTNs by conventional breeding methods is time consuming and inefficient due to genetic drift. However, recent developments in genomics selection (GS) have allowed sugarcane researchers to select and accumulate desirable alleles imparting superior traits as GS is based on genomic estimated breeding values, which substantially increases the selection efficiency and genetic gain in sugarcane breeding programs. Next-generation sequencing techniques coupled with genome-editing technologies have provided new vistas in harnessing the sugarcane genome to look for desirable agronomic traits such as erect canopy, leaf angle, prolonged greening, high biomass, deep root system, and the non-flowering nature of the crop. Many desirable cane-yielding traits, such as single cane weight, numbers of tillers, numbers of millable canes, as well as cane quality traits, such as sucrose and sugar yield, have been explored using these recent biotechnological tools. This review will focus on the recent advances in sugarcane genomics related to genetic gain and the identification of favorable alleles for superior agronomic traits for further utilization in sugarcane breeding programs.

Phytoplasma diseases of plants: molecular diagnostics and way forward.

Phytoplasmas are obligate phytopathogenic bacteria associated with devastating diseases in hundreds of crops across the world. They have been responsible for huge economic losses in many crop plants for decades now. Isolation and establishment of axenic culture of phytoplasma in complex media is a recent progress in phytoplasma research. Earlier methods for phytoplasma disease detection included symptom profiling, microscopy, serology and dodder transmission studies. With advancement in the field of molecular biology, phytoplasma diagnostics and characterisation witnessed radical improvement. Starting from PCR amplification which often necessities a nested PCR on account of low titre of phytoplasmas, to the closed tube quantitative PCR assays and then the ddPCR, an array of diagnostics have been developed for phytoplasma. The isothermal diagnostic platforms are the latest addition to this and the Loop Mediated Isothermal Amplification (LAMP) assay has been applied for the detection of phytoplasma from several hosts. The futuristic approach in phytoplasma detection will be very likely provided by an integration of nanotechnology and molecular diagnostics. Phytoplasma disease management majorly relies on early detection, vector control, use of disease free planting materials and cultivation of resistant varieties. Hence understanding the molecular mechanism of phytoplasma-host interaction is as important as timely and accurate detection, in the management of phytoplasma diseases. Further, the changing climatic scenario and global warming may lead to an upsurge in the phytoplasma diseases spread and severity across the world, making disease management even more challenging.

Genetic diversity of phytoplasma strains infecting chrysanthemum varieties in India and their possible natural reservoirs.

Symptoms typical of phytoplasma infection such as phyllody, virescence, witches' broom and yellowing were observed in 12 varieties of Chrysanthemum morifolium in floral nurseries and experimental fields at New Delhi, Karnataka, Maharashtra and Andhra Pradesh, India, during surveys made from 2015 to 2017. Disease incidence ranged from 15 to 30%. Phytoplasma presence was confirmed in all symptomatic chrysanthemum varieties by molecular identification assays. Sequence comparison, phylogenetic and in silico RFLP analyses of 16S rDNA sequences allowed the identification of the chrysanthemum infecting phytoplasma strains into different ribosomal groups and subgroups, namely 16SrI, 16SrII-D, 16SrVI-D and 16SrXIV. Detection of phytoplasma strains of 16SrII-D subgroup were also confirmed in symptomatic Chenopodium album and Parthenium hysterophorus plants grown in and around the surveyed chrysanthemum fields at New Delhi, whereas 16SrVI-D phytoplasma strains were detected in symptomatic Cannabis sativa weed and leafhopper Hishimonus phycitis individuals collected from the symptomatic chrysanthemum fields at New Delhi. This is the first report on the presence of 16SrVI and 16SrXIV groups of phytoplasmas in chrysanthemum plants. Studies on genetic diversity of phytoplasmas infecting the major chrysanthemum varieties in India and their epidemiological aspects had previously not been reported. The detection and identification of phytoplasmas in different chrysanthemum varieties could contribute to increase the awareness among farmers in the management of these diseases.

Comparative analysis of drought-responsive transcriptomes of sugarcane genotypes with differential tolerance to drought.

Water stress causes considerable yield losses in sugarcane. To investigate differentially expressed genes under water stress, two sugarcane genotypes were subjected to three water-deficit levels (mild, moderate, and severe) and subsequent recovery and leaf transcriptome was generated using Illumina NextSeq sequencing. Among the differentially expressed genes, the tolerant genotype Co 06022 generated 2970 unigenes (p ≤ 0.05, functionally known, non-redundant DEGs) at 2-day stress, and there was a progressive decrease in the expressed genes as the stress period increased with 2109 unigenes at 6-day stress and 2307 unigenes at 10-day stress. There was considerable reduction at recovery with 1334 unigenes expressed at 10 days after recovery. However, in the susceptible genotype Co 8021, the number of unigenes expressed at 2 days was lower (2025) than the tolerant genotype and a further reduction was seen at 6-day stress (1552). During recovery, more differentially expressed genes were observed in the susceptible cultivar indicating that the cultivar has to activate more functions/processes to recover from the damage caused by stress. Comparison of DEGs between all stages of stress and recovery in both genotypes revealed that, the commonly up- and down-regulated genes across different stages were approximately double in the tolerant genotype. The most enriched gene ontology classes were heme binding, peroxidase activity and metal ion binding in the biological process and response to oxidative stress, hydrogen peroxide catabolic process and response to stress in the molecular function category. The cellular component was enriched with DEGs involved in extracellular region followed by integral component of membrane. The KEGG pathway analysis revealed important metabolic activities and functionally important genes involved in mitigating water-deficit stress in both the varieties. In addition, several unannotated genes in important pathways were detected and together may provide novel insights into water-deficit tolerance mechanisms in sugarcane. The reliability of the observed expression patterns was confirmed by qRT-PCR. The results of this study will help to identify useful genes for improving drought tolerance in sugarcane.

NIR light active ternary modified ZnO nanocomposites for combined cancer therapy.

Recent developments in nanomedicine for cancer therapy enable nanoparticles for tumour specific therapeutics. Certain nanoparticles with their inherent physical/chemical properties can themselves act as drugs. Also they can be designed to respond to either tumor microenvironment or externally applied physical stimuli such as temperature, light, magnetic field, and ultrasound for tumor-targeted and enhanced anticancer efficacy. In this study, a simple design of cost-effective ternary modified zinc oxide nanocomposites possessing near-infrared (NIR) absorbance were synthesized using simple, fast, thermal decomposition route with hydrazine precursors. The in vitro cytotoxicity of these nanocomposites studied on human breast cancer cells (MCF-7) and the human embryonic kidney normal cells (HEK 293) by MTT assay show that they are highly selective and are dose dependent against both the cell lines. The developed nanocomposites can be used for combined photothermal (PTT) and photo dynamic (PDT) cancer therapy.

Crystal growth and spectroscopic characterization of Aloevera amino acid added lithium sulfate monohydrate: a non-linear optical crystal.

Non-linear optical crystals of lithium sulfate monohydrate added with Aloevera amino acid were grown successfully by slow evaporation technique moderately at low cost. Initially the Aloevera amino acid extract was prepared from the 3 years old plant leaves and the amino acids present in that were identified by high performance liquid chromatography. The grown crystal was clear, transparent and they attained the size about 1.3×0.8×0.6 cm(3) within a time span of 20-25 days. The crystal was subjected to Fourier Transform Infrared Spectroscopy, UV-Vis-NIR, thermal and mechanical studies. Proton nuclear magnetic resonance, thin layer chromatography and colorimetric estimation techniques are carried out to confirm and identify the amino acid in the grown crystal.

Growth and spectral characterization of ethylene diamine tetra acetic acid (EDTA) doped zinc sulphate hepta hydrate - a semi organic NLO material.

Semi-organic non-linear optical single crystals of ethylene diamine tetra acetic acid (EDTA) doped zinc sulphate hepta hydrate crystals were grown by slow evaporation solution growth technique, at room temperature, using de-ionized water as solvent. The modes of vibrations of different molecular groups present in the grown crystal were identified by FT-IR technique. The optical absorbance/transmittance was recorded in the wavelength range of 190-1100 nm. Thermal properties of the grown crystal were studied by thermo gravimetric analysis and differential thermal analysis. The melting point of the grown crystal was estimated by differential scanning calorimetric analysis. The inclusion of the dopant (EDTA) was confirmed by colorimetric estimation method. The second harmonic generation efficiency is about 30% of potassium dihydrogen orthophosphate.

Diverse targets of phytoplasma effectors: from plant development to defense against insects.

Phytoplasma research begins to bloom (75). Indeed, this review shows that substantial progress has been made with the identification of phytoplasma effectors that alter flower development, induce witches' broom, affect leaf shape, and modify plant-insect interactions. Phytoplasmas have a unique life cycle among pathogens, as they invade organisms of two distinct kingdoms, namely plants (Plantae) and insects (Animalia), and replicate intracellularly in both. Phytoplasmas release effectors into host cells of plants and insects to target host molecules, and in plants these effectors unload from the phloem to access distal tissues and alter basic developmental processes. The effectors provide phytoplasmas with a fitness advantage by modulating their plant and insect hosts. We expect that further research on the functional characterization of phytoplasma effectors will generate new knowledge that is relevant to fundamental aspects of plant sciences and entomology, and for agriculture by improving yields of crops affected by phytoplasma diseases.

Molecular Detection of Phytoplasma Associated with Yellow Leaf Disease in Areca Palms (Areca catechu) in India.

The arecanut palm (Areca catechu L.), Arecaceae family, is one of the most important commercial crops in the world, which yields fruits called arecanut that are used as a medicine and chewing substance (1). Yellow leaf disease (YLD) is one of the most serious diseases in areca palms in India. It reduces the yield as much as 50% over a period of 3 years immediately following disease incidence. Foliar yellowing, the most conspicuous symptom, begins from the inner whorl and spreads to the outer parts of the crown. Chlorosis is observed on almost all leaves in the whorl from edges of the leaflet to the midrib region. Stems become spongy and friable and the conducting strands are destroyed. Microscopic detection is evidence of the association of phytoplasma in YLD-affected areca palms (3). There is no evidence for molecular level detection of phytoplasma in YLD-affected palms. To prove the phytoplasma association in YLD-affected palms in India, samples (inflorescence, spindle leaf, mature leaf, and root) were collected from 15 (5 severe, 5 middle, and 5 early stage of the disease) YLD-affected areca palms and two symptomless palms at Sullia District, Karnataka. DNA was extracted from rachis of inflorescence, midrib of spindle leaf, and meristem of root samples as previously described (2). With universal primers there was no consistency in amplification. Then we used two sets of seminested primers, 1F7/7R3-1F7/7R2 and 4Fwd/3Rev-4Fwd/5Rev, which were designed to amplify the coconut root (wilt) disease (RWD) phytoplasma (2). With the seminested primers, 1F7/7R3-1F7/7R2, a 493-bp amplicon was obtained from 15 of 15 palms. With the seminested primers, 4Fwd/3Rev-4Fwd/5Rev, a 1.3-kb amplicon was seen in 11 samples and the positive control sample (sugarcane grassy shoot DNA). The amplicons were cloned and sequenced and two representative sequences were deposited in GenBank (GU552782 and HM215624). A BLAST search showed that the sequence has 99% nt identity with sugarcane white leaf phytoplasma (FM208260, 16sr XI), coconut RWD phytoplasma (GQ850122, 16sr XI), 98% nt identity with bermuda grass white leaf phytoplasma (AJ550986, 16sr XIV), and only 91% nt identity with YLD-affected areca phytoplasma reported from China (FJ998269 and FJ694685). The phylogenetic analysis revealed the clustering of YLD phytoplasma with 16s rRNA XI and 16s rRNA XIV groups. However, the YLD phytoplasma is closely related to the 16s rRNA XI group. PhytoDB-group identifier tool (http://220.227.88.253/phytodb) showed YLD phytoplasma from India belongs to the 16sr XI group. Earlier we reported the association of 16sr XI group phytoplasma with coconut RWD in India (2) and the YLD phytoplasma reported here has 99% nt identity with RWD phytoplasma. In southern India, coconut and arecanut are grown together in adjacent fields and there is a possible occurrence of the same phytoplasma in two different hosts. The current study proved the association of phytoplasma through nested PCR in YLD-affected areca palms in India and it is clustered with 16sr RNA XI group. Purushothama et al. (4) couldn't detect the phytoplasma with YLD-affected areca palms. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the arecanut YLD in India. References: (1) M. Hattori et al. Pharm. Soc. Wakan-yaku 10:141, 1993. (2) R. Manimekalai et al. Plant Dis. 94:636, 2010. (3) R. Nayar and C. E. Selsikar. Eur. J. For. Pathol. 8:125, 1978. (4) C. R. D. Purushothama et al. Bull. Insectol. 60:161, 2007. ERRATUM: On 27 October 2010, at the request of the authors, the title of this note was changed.

Molecular Detection of 16SrXI Group Phytoplasma Associated with Root (Wilt) Disease of Coconut (Cocos nucifera) in India.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev-3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.