Comparative study on effect of pomegranate peel powder as natural preservative and chemical preservatives on quality and shelf life of muffins.

This research aims to investigate the potential of utilizing pomegranate peel powder (PPP) as a natural preservative in muffin preparation. Pomegranate peel is a rich source of bioactive compounds, including phenolics, flavonoids, and tannins, which possess high antioxidant and antimicrobial properties. The In-Vitro antifungal activity of pomegranate peel powder (8% PPP), potassium sorbate (0.1% PS) and calcium propionate (0.5% CP) was assessed against Penicillium sp. and Aspergillus sp. using poison food technique. The PPP showed the anti-fungal activity by delaying the growth of microorganism on media plate similar to the PS and CP. The effect of utilization of PPP on quality characteristics of muffins were compared with the muffins with chemical preservatives (0.1% PS and 0.5% CP). The viscosity and specific gravity of batter significantly increased from 7.98 to 11.87 Pa s and 1.089-1.398 respectively on addition of 8% PPP. The optical microscopic structure of PPP added batter revealed the decrease in the number of air cells from 24 to 12 with radius range of 6.42-72.72 µm and area range of 511.03-15,383.17 µm2. The functional properties of flour with PPP had higher water absorption capacity, foaming stability, emulsification activity and emulsion stability than others. The addition of PPP significantly increase the weight (32.83 g), and decrease the height (31.3 mm), volume (61.43 cm3), specific volume (1.67 cm3/g) and baking loss (10.19%). The 418.36% increase in fibre content, 14.46% and 18.46% decrease in carbohydrates and energy value was observed in muffin with 8% PPP as compared to control respectively. The total phenols was increased from 0.92 to 12.5 mg GAE/100 g, total tannin from 0.2 to 8.27 mg GAE/100 g, In-vitro antioxidant activity by DPPH from 6.97 to 29.34% and In-vitro antioxidant activity by FRAP from 0.497 to 2.934 mg AAE/100 g in muffins added with 8% PPP. The muffin with PPP was softer than control and muffin with 0.1% PS. The addition of PPP resulted to improve in muffin texture but taste slightly bitter. During the storage of muffins at room temperature (27-30 °C), the moisture content of muffin with PPP was reduced from 17.04 to 13.23% which was higher than the rest of the treatments. Similarly, the hardness of sample with PPP was higher than the sample with 0.5% CP, but lowers than control and sample with 0.1% PS throughout the storage period. The results suggest that pomegranate peel powder can be successfully used as a natural preservative in place of chemical preservatives in muffins, to extend the shelf life. This study provides the opportunity to use PPP as functional ingredient and natural preservative in different bakery products.

Impact of Technology Driven Mental Health Task-shifting for Accredited Social Health Activists (ASHAs): Results from a Randomised Controlled Trial of Two Methods of Training.

Mental health task shifting is a potential way to address the burgeoning treatment gap for mental illness. Easily available and accessible digital technology can be utilised to continuously engage grassroot level health workers (for example, Accredited Social Health Activists (ASHAs). However, the impact of such a strategy is not yet systematically evaluated. In this randomised controlled trial, longitudinal hybrid training of ASHAs [1 day in-person classroom training and seven online sessions (ECHO model), aimed to screen and refer to commonly prevalent mental health issues in communities] was compared with traditional one-day in-person classroom training. ASHAs (n = 75) from six Primary Health Centres in Ramanagara district, Karnataka, India were randomized into study (SG-ASHAs) and control (CG-ASHAs) groups. After excluding drop-outs, 26 ASHAs in each group were included in the final analysis of the scores on their Knowledge, attitude, and practices (KAP) in mental health. Two house-to-house surveys were conducted by both groups to identify and refer possible cases. The number of screen positives (potential persons with mental illnesses) and the KAP scores formed the outcome measures. Online sessions for SG-ASHAs were completed over 18 months, the COVID-19 pandemic being the main disruptor. SG-ASHAs identified significantly higher number of persons with potential alcohol use disorders [n = 873 (83%); p ≤ 0.001] and common mental disorders [n = 96(4%); p = 0.018], while CG-ASHAs identified significantly higher number of those with potential severe mental disorders [n = 61(61.61%); p ≤ 0.001]. As regards KAP, after controlling for baseline scores, the time effect in RMANOVA favoured SG-ASHAs. Mean total KAP score increased from 16.76 to18.57 (p < 0·01) in SG-ASHAs and from 18.65 to 18.84 (p = 0.76) in CG-ASHAs. However, the Time-group interaction effect did not favour either (F = 0.105; p = 0.748). Compared to traditional training, mentoring ASHAs for extended periods is more impactful. Easily accessible digital technology makes the latter feasible. Scaling up such initiatives carry the potential to considerably improve treatment access for those in need.

A report on successful introduction of tele mental health training for primary care doctors during the COVID 19 pandemic.

Treatment gaps of 60-70%, reflecting, amongst many other factors, Human Resources shortfalls means that 150 million India never accessed mental healthcare. In Punjab, mental health training is required in primary health centers. A short-term synchronous training was conceptualized by the National Institute of Mental Health and Neurosciences. A total of 114 primary care doctors participated for the training. Substantial positive changes in knowledge, attitudes and practices were noted. Task sharing and capacity building initiatives can be undertaken during the pandemic to meet the demand for mental healthcare service delivery.

Spillover of ebolaviruses into people in eastern Democratic Republic of Congo prior to the 2018 Ebola virus disease outbreak.

BACKGROUND: The second largest Ebola virus disease (EVD) outbreak began in the Democratic Republic of Congo in July 2018 in North Kivu Province. Data suggest the outbreak is not epidemiologically linked to the 2018 outbreak in Equateur Province, and that independent introduction of Ebola virus (EBOV) into humans occurred. We tested for antibodies to ebolaviruses in febrile patients seeking care in North Kivu Province prior to the EVD outbreak. METHODS: Patients were enrolled between May 2017 and April 2018, before the declared start of the outbreak in eastern DRC. Questionnaires were administered to collect demographic and behavioural information to identify risk factors for exposure. Biological samples were evaluated for ebolavirus nucleic acid, and for antibodies to ebolaviruses. Prevalence of exposure was calculated, and demographic factors evaluated for associations with ebolavirus serostatus. RESULTS: Samples were collected and tested from 272 people seeking care in the Rutshuru Health Zone in North Kivu Province. All patients were negative for filoviruses by PCR. Intial screening by indirect ELISA found that 30 people were reactive to EBOV-rGP. Results were supported by detection of ebolavirus reactive linear peptides using the Serochip platform. Differential screening of all reactive serum samples against the rGP of all six ebolaviruses and Marburg virus (MARV) showed that 29 people exhibited the strongest reactivity to EBOV and one to Bombali virus (BOMV), and western blotting confirmed results. Titers ranged from 1:100 to 1:12,800. Although both sexes and all ages tested positive for antibodies, women were significantly more likely to be positive and the majority of positives were in February 2018. CONCLUSIONS: We provide the first documented evidence of exposure to Ebola virus in people in eastern DRC. We detected antibodies to EBOV in 10% of febrile patients seeking healthcare prior to the declaration of the 2018-2020 outbreak, suggesting early cases may have been missed or exposure ocurred without associated illness. We also report the first known detection of antibodies to BOMV, previously detected in bats in West and East Africa, and show that human exposure to BOMV has occurred. Our data suggest human exposure to ebolaviruses may be more frequent and geographically widespread.

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Pharmacological preconditioning with intralipid in patients undergoing off-pump coronary artery bypass surgery.

Aims and Objectives: The objective of the study was to determine the preconditioning myocardial protective effects of intralipid (IL) in off-pump coronary artery bypass (OPCAB) surgery by measuring highly sensitive troponin T (hsTnT) and cardiac-specific creatine kinase (CK-MB) as markers of myocardial injury. Materials and Methods: : Thirty patients, scheduled to undergo elective OPCAB surgery, were randomly assigned to the IL group (n = 15) or control (C) group (n = 15); the IL group received an infusion of 20% IL 2 ml/kg, 30 min prior to revascularization and the control group received an equivalent volume of normal saline. Serum levels of hsTnT and CK-MB were measured before surgery and at 6 h, 24 h, 48 h, and 72 h postoperatively. Also, intraoperative hemodynamic parameters, inotrope use, ventilatory hours, ICU stay, postoperative left ventricular ejection fraction, postoperative lipid profile, renal and hepatic function tests were measured. Results: The hsTnT values at the 24 h, 48 h, and 72 h in IL group were significantly lower as compared with the control group. The decline in plasma levels of CK-MB mirrored the hsTnT levels post revascularization at 24 h and 48 h in the IL group compared with the control group; however, at 72 h, level was comparable in both the groups. None of the treated patients had abnormal lipid metabolism, deranged renal, and hepatic function. Conclusion: The study revealed Intralipid as a safe pharmacological preconditioning agent for OPCAB surgeries which can reduce the postischemic myocardial injury indicated by the reduction in postischemic cardiac enzymes hsTnT and CK-MB.

Comparison of pectoral Nerve (PECS1) block with combined PECS1 and transversus thoracis muscle (TTM) block in patients undergoing cardiac implantable electronic device insertion - A pilot study.

Background: Pectoral nerve (PECS1) block has been used for patients undergoing cardiac implantable electronic device (CIED) insertions, however, PECS1 block alone may lead to inadequate analgesia during tunneling and pocket creation because of the highly innervated chest wall. Transversus thoracis muscle plane (TTM) block targeting the anterior branches of T2-T6 intercostal nerves can be effectively used in combination with PECS1 for patients undergoing CIED insertion. The present study hypothesized that combined PECS1 and TTM blocks would provide effective analgesia for patients undergoing CIED insertion compared to PECS1 block alone. Materials and Methods: Thirty adult patients between the age group of 18-85 years undergoing CIED insertion were enrolled in the study. A prospective, randomized, comparative, pilot study was conducted. A total of 30 patients were enrolled, who were randomized to either Group P: PECS1 block (n = 15) or Group PT: PECS1 and TTM blocks (n = 15). The intraoperative requirement of midazolam and local anesthetic and level of sedation by Ramsay sedation score were noted. The pain was assessed by visual analog scale (VAS) at rest and during a cough or deep breathing at 0 h, 3 h, 6 h, 12 h, and 24 h after the procedure. Results: VAS scores at rest were significantly lower in group PT at 0, 3, 6, and 12 h postprocedure, and during cough at 0, 6, and 12 h after the procedure (P < 0.05). At 24 h, VAS scores were comparable between both groups. Intraoperative midazolam consumption was higher in group P compared to group PT (P= 0.002). Fourteen patients in group P received local anesthetic supplementation in comparison to only one patient in group PT (P = 0.0001). Thirteen patients in group P received the first rescue analgesia in comparison to three patients in group PT (P = 0.0003). Conclusion: Combined PECS1 and TTM blocks provide superior analgesia, reduced net consumption of local anesthetic, sedative agents, and rescue analgesics compared to PECS1 block alone in patients undergoing CIED insertion.

Comparision of upper thoracic epidural analgesia versus low thoracic epidural analgesia in off-pump coronary artery bypass graft for perioperative pain management and fast tracking.

Background: Upper thoracic epidural analgesia (TEA) is compared with lower thoracic epidural analgesia for the perioperative pain management and fast tracking in patients undergoing off pump coronary artery bypass grafting (OPCAB) surgery for the intraoperative hemodynamic, quality of analgesia, incentive spirometry, time to awakening & extubation and intensive care unit (ICU) duration. Materials and Methods: A prospective, randomized comparative clinical study was conducted with total of 60 patients randomized to either Group U: Upper TEA (n = 30) or Group L: Lower TEA (n = 30). Visual analog scale (VAS) was recorded in both the groups during rest and deep breathing at the various time intervals postextubation. Both the groups were also compared for intraoperative hemodynamics, incentive spirometry, time to awakening, and extubation and ICU duration. Statistical analysis was performed using the independent Student's t-test. A value of P < 0.05 was considered statistically significant. Results: Postextubation VAS score at rest and deep breathing at 0, 3, 6, 12, 24, 36, and 48 h were statistically significant in both groups (P ≤ 0.05). Incentive spirometry, time to awakening and extubation and duration of ICU stay were also statistically significant (P ≤ 0.05) between the groups. Conclusion: Lower thoracic epidural was better than upper thoracic epidural in perioperative pain management and fast tracking in OPCAB surgery.

Transesophageal echocardiographic evaluation of pulmonary vein diastolic wave deceleration time - As a predictor of left atrial pressure.

Background: The deceleration time of the pulmonary venous diastolic flow has been well-correlated with invasive pulmonary capillary wedge pressure in several studies regardless of left ventricular systolic function. This study was conducted to correlate deceleration time of pulmonary venous diastolic wave, DT(D), and left atrial pressure (LAP), obtained noninvasively from mitral early diastolic inflow velocity-to-early diastolic mitral annulus velocity ratio (E/e'), and to assess the ease of each method in patients with coronary artery disease undergoing off-pump coronary artery bypass grafting (OPCAB) by transesophageal echocardiography. Methods: Forty-five adult patients with coronary artery disease, with left ventricular ejection fraction of ≥50% posted for elective OPCAB were enrolled in the study. Results: Forty values of LAP and DT(D) were analyzed. A significant linear correlation (r = -0.64) was found between DT(D) and LAP. Area under the curve of DT(D) of ≤183 ms for predicting elevated LAP (>15) was 0.903 (95% confidence interval: 0.767 to 0.974, P < 0.0001). Conclusion: Deceleration time of pulmonary venous flow diastolic waveform, DT(D), feasible promising echocardiographic measure in determining elevated LAP and DT(D)≤183 ms predicts elevated LAP.

Portal venous pulsatility fraction, a novel transesophageal echocardiographic marker for right ventricular dysfunction in cardiac surgical patients.

Background: Right ventricular (RV) has a vital role in maintaining optimal tissue perfusion. Assessment of portal venous flow characteristics can be alternative and emerging technique to assess RV function. Aims: To investigate if portal venous pulsatility fraction (PF) could serve as effective and complementary tool in identifying RV dysfunction. Materials and Methods: Thirty adult patients aged 18-65 years undergoing cardiac surgery under general anesthesia were enrolled in study. Intraoperative transesophageal echocardiographic examination was performed. Tricuspid annular plane systolic excursion (TAPSE), RV fractional area change (FAC), RV ejection fraction (EF), and portal vein flow pulsatility were assessed. Portal vein PF was used to quantify degree of pulsatility. Results: Portal vein was demonstrated in 27 patients (90%). 27 values of portal vein PF, RV EF, FAC, and TAPSE were analyzed. Portal vein PF demonstrated significant linear correlation with TAPSE (r = -0.55, P = 0.003), RV FAC (r = -0.44, P = 0.02), and RV EF (r = -0.53, P = 0.004). ROC curve was constructed to calculate sensitivity and specificity of portal vein PF for assessing RV function. Portal vein PF value of ≥45% indicated RV dysfunction with sensitivity of 92.3%, specificity of 71.4%, positive predictive value of 75%, and negative predictive value of 90.9%. Area under ROC curve was 0.819 (95% confidence interval = 0.624 - 0.939, P = 0.0006). Conclusion: Portal vein PF is simple and feasible method for assessment of RV function. It complements the existing echocardiographic measures to diagnose RV dysfunction.

Role of urinary PO2 analysis during conventional versus conventional and modified ultrafiltration techniques in adult cardiac surgery.

Background: Medullary hypoxia is the initial critical event for kidney injury during cardiopulmonary bypass, and therefore urinary PO2 with its potential of detecting medullary oxygenation for its management. Therefore, we tested the role of urinary PO2 in predicting kidney injury in those undergoing conventional versus combined (conventional and modified) ultrafiltration during cardiac surgery in adults. Methodology: We prospectively evaluated 32 adults between 18 and 65 years of age undergoing elective on-pump cardiac surgery with ejection fraction >35% by conventional (group C) versus combined ultrafiltration (group CM). Urine samples were analyzed for PO2 after induction, 30 min, 3 h, and 6 h post filtration along with blood urea and serum creatinine after induction, at 6 h, 24 h, and 48 h post filtration. Demographic variables, cardiopulmonary bypass duration, flow rates, inotropic score, ventilation duration, diuretic use, and intensive care unit (ICU) stay were assessed between two groups. Results: Both the groups (16 in each group) had comparable urinary PO2 after induction (P = 0.387) with significant decrease in group C at 30 min, 3 h, and 6 h post filtration (P < 0.05). There was a statistically significant increase in serum creatinine (mg/dL) at 48 h in group C compared with group CM (1.57 vs. 1.25, respectively; P ≤ 0.05). There was an increased diuretic usage and length of ICU stay in group C. Conclusion: Combined ultrafiltration technique had renoprotective effect in cardiac surgery analyzed by urinary PO2 levels.

A Report on a Series of workshops on "Mental Health Leadership" for Maharashtra State.

The article is a report on a series of workshops conducted by the National Institute of Mental Health And Neurosciences (NIMHANS), Bengaluru, India in collaboration with the Government of Maharashtra for the local leaders responsible for leading, organizing and delivering public mental health services throughout the state of Maharashtra. The overarching aim of these workshops was to sensitize and orient the participants on the mental health services offered/provided by NIMHANS, the collaborative activities between NIMHANS and Govt. of Karnataka to further the cause of public mental health and also to showcase the scope of DMHP (District Mental Health Program) activities in Karnataka. The professionals were divided into 5 batches as per their specialty or role i.e. Psychiatrists, Psychologists and Social Work besides the health administrators (Civil Surgeons and District Health Officers). Each batch underwent the training 2-3 days. Major areas covered included: Farmers' suicide, programs, policies and laws for the elderly, orientation to the new Mental Health Care Act 2017 and a fully functioning District Mental Health Program (DMHP).

Health insurance and mental illness.

One of the important provisions of the Mental Healthcare Act, 2017, in section 21 (4), is the inclusion of "mental illnesses" for health insurance coverage. This is a progressive step toward considering mental illness at par with physical illness, which will, in turn, ensure better access to mental health care. In this context, the article summarizes the concept of "health insurance" and then goes on to talk about various provisions for persons with mental illnesses in India. We also discuss some of the relevant concerns that may arise in this context. Whereas insurance for mental illness is a welcome step toward achieving universal health coverage, there is a need to deliberate on various issues before we can achieve that.

Case vignette-based evaluation of psychiatric blended training program of primary care doctors.

INTRODUCTION: The need to integrate psychiatry in primary care is increasingly recognized as the favorable strategy worldwide. The contribution of primary care doctors (PCDs) is extremely important toward it. However, majority PCDs find it difficult to diagnose and treat common psychiatric disorders. Many training programs developed for PCDs, with different methods employed for posttraining evaluation. One of such program is blended psychiatric training program developed at our center. AIM: Case vignette-based outcome evaluation of on-site section of blended psychiatric training of PCDs at the end of 2 weeks. MATERIALS AND METHODS: Two qualified psychiatrists designed the ten case vignettes after pilot use. Data were collected at baseline and at the end of 2 weeks on-site-training program. Major psychiatric diagnoses and treatments were covered. The responses to each vignette were evaluated with maximum marks 10 (5 each for diagnosis and treatment). RESULTS: The mean age of the 21 participants was 43.1 ± 7.3 years. The posttraining score (83.42 ± 10.38) was significant higher than the baseline score (42.4 ± 23.10). CONCLUSION: Blended program for training of PCDs in psychiatric disorders significantly improves their diagnostic and treatment capabilities.

Quantitative RT-PCR assays for identification and typing of the Equine encephalosis virus.

Equine encephalosis (EE) is an acute, arthropod-borne, noncontagious, febrile disease of equids. The clinical signs of EE are similar to milder forms of African horse sickness (AHS) and the two diseases can be easily confused. The Equine encephalosis virus (EEV) is a distinct virus species within the genus Orbivirus, family Reoviridae, with ten linear segments of dsRNA genome. Seven distinct serotypes of EEV have been recognised on the basis of sequence analyses of Seg-2. The need for differential diagnosis of similar forms of EE and AHS warranted the development of molecular diagnostic methods for specific detection and identification of EEV. We report the development of quantitative real-time RT-PCR assay for detection of any member of the EEV species targeting the highly conserved EEV Seg-9. Similar serotype-specific qRT-PCR assays were designed for each of the seven EEV serotypes targeting genome Seg-2, encoding the serotype determining VP2 protein. These assays were evaluated using different EEV serotypes and other closely related orbiviruses. They were shown to be EEV virus species-specific, or EEV type-specific capable of detecting 1 to 13 copies of viral RNA in clinical samples. The assays failed to detect RNA from closely related orbiviruses, including AHSV and Peruvian horse sickness virus (PHSV) isolates.

Evaluation of risk scores in predicting perioperative blood transfusions in adult cardiac surgery.

Objective: Allogeneic blood product transfusions are associated with an increased morbidity and mortality risk in cardiac surgery. At present, a few transfusion risk scores have been proposed for cardiac surgery patients. The present study is aimed to develop a new score and to compare with preexisting scores - Transfusion Risk and Clinical Knowledge (TRACK) and Transfusion Risk Understanding Scoring Tool (TRUST) score. Methodology: A total of 1014 adult patients undergoing cardiac surgery were enrolled in the retrospective study. Independent predictors of allogeneic blood transfusions were selected from TRACK and TRUST scores. A predictive score was developed from six variables using logistic regression analysis, and new score was compared to the other existing scores - TRACK and TRUST. Results: The new score had following predictors: age >58 years, weight <63 kg for males and <49 kg for females, gender (female), complex surgery, hemoglobin <13.5 g/dl, and creatinine >1.36 mg/dl. Validation of new score demonstrated an acceptable predictive power (area under the curve [AUC] 0.749) and a good calibration at the Hosmer-Lemeshow test. New score was comparable with TRACK score with P = 0.578 (AUC of TRACK 0.756 and AUC of new score 0.749). There was a significant difference between new score and TRUST score, P = 0.01 (AUC of TRUST 0.72 and AUC of new score 0.749). Conclusion: New score is a simple risk model based on six predictors having a similar accuracy and calibration in predicting the transfusion rate in cardiac surgery as compared to TRACK score.

ANSiscope™: Can it be the crystal ball of cardiac anesthesia?

Background: : Autonomic dysfunction (AD) is infrequently evaluated preoperatively despite having profound perioperative implications. The ANSiscope™ is a monitoring device that quantifies AD. This study aims to determine the potential of the device to predict hypotension following anesthetic induction, occurrence of arrhythmias, and inotrope requirement for patients undergoing off-pump coronary artery bypass surgery (OPCAB). Study Design: : Prospective observational double-blinded study. Materials and Methodology: Seventy-five patients undergoing OPCAB had their autonomic function assessed by ANSiscope™. They were classified into four groups based on their AD and compared to perioperative adverse events. Results: Patients with diabetes had a higher ANSindex (P = 0.0263). They had a greater decrease in systolic blood pressure (P = 0.001) and mean arterial pressure (P = 0.004) postinduction, had an increased incidence of arrhythmias (P = 0.009), required higher inotropic support immediately (P = 0.010) and at 24 h after surgery (P = 0.018), and longer duration of postoperative ventilation (P < 0.001). They also had a higher incidence of emergency conversion of OPCAB to on-pump surgery (P = 0.009). Conclusions: An increased association between AD as quantified by the ANSiscope™ and perioperative adverse outcomes was observed. An increased rate of emergency conversion of OPCAB to on-pump surgery with higher dysfunction was noted. The authors opine that the threshold for conversion must be lower in patients deemed to be at a higher risk. Proper evaluation of the autonomic nervous system empowers the anesthesiologist to anticipate and adequately prepare for complications.

Author Correction: The discovery of Bombali virus adds further support for bats as hosts of ebolaviruses.

In the version of this Article originally published, the bat species for 12 individuals were incorrectly identified in Supplementary Table 1 and 2. After resequencing the MT-CytB and MT-CO1 segments and reviewing the data, the authors have corrected the errors for these 12 animals. In the amended version of the Supplementary Information, Supplementary Tables 1 and 2 have been replaced to include the corrected host species information. None of the 12 bats affected were positive for the Bombali virus, and the conclusions of the study are therefore unchanged.