First report of milkweed (Euphorbia geniculata) as an alternative host for Colletotrichum truncatum in soybean fields in India.

Soybean (Glycine max, L.), a major oilseed crop of India faces anthracnose disease caused by Colletotrichum truncatum (Nataraj et al. 2021). Several weeds serve as alternative hosts for Colletotrichum spp. (Hartman et al. 1986). Around 24.67% of soybean fields in the study area were infested with Euphorbia geniculata (Kutariye et al. 2021). In September 2021, milkweed plants died in the field, showing irregular circular lesions with wavy margins on the stem, change in color of veins and veinlets from brown to black and leaves exhibiting a twisted appearance at ICAR-Indian Institute of Soybean Research, India. Later on plants completely died and acervuli of average size 284 µm were visualized under stereo microscopy. Twenty milkweed samples were collected, rinsed, and surface sterilized with NaOCl (1%). Fungus isolation was done from leaf and stem and transferred to sterilized Petri plates with Potato dextrose agar (PDA). The plates were incubated at 25 ± 2°C for 48 h with dark/light (10h/14h) cycle. The fungi produced circular, raised, black to light grey colonies. Sickle shaped aseptate conidia, measuring 23.14 µm length, 3.18 µm width and hyphal width 5.49 µm were confirmed using a compound microscope with 20X magnification. The fungus was purified via hyphal tip method and pure culture was maintained on PDA at (26 ± 2°C). Milkweed seedlings in clay pots were inoculated with a conidial suspension of the fungus (106 conidia/mL) prepared from ten days old culture using serial dilution technique. Soybean variety JS 95-60 was inoculated by atomizing 20 ml of the same suspension on each plant. The negative controls for both milkweed and soybean were inoculated with sterile distilled water. Veinal necrosis and acervuli formation were observed on both milkweed and soybean, but no signs or symptoms of disease were observed in the controls. The re-isolated fungus from both the diseased hosts resembled original culture as they produced black to light grey colonies, sickle shaped aseptate conidia and ITS sequence (OR124845) exhibiting 100% resemblance to C. truncatum isolate C-17 (MN736513), thus confirming Koch's postulates. The pathogen was classified as Colletotrichum spp. based on morphological and cultural characters and the pathogenicity test (Rajput et al. 2021). To confirm identity of the pathogen infecting milkweed, DNA was extracted from the reisolated fungus using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The internal transcribed spacer (ITS) region, beta-tubulin (TUB2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified (Kumar et al. 2021). The GAPDH gene was amplified under similar reaction conditions except for annealing temp 59°C. For species level identification, the ITS, TUB2 and GAPDH gene sequences were submitted to GenBank with accession numbers OR004468, OQ869780 and OQ869781, respectively. The BLAST analysis of TUB2 and GAPDH gene showed sequence homology of 100% and 98.43% respectively with C. truncatum culture-collection CBS:151.35 (GU228156, GU228254). The isolate was identified as C. truncatum on the basis of molecular analysis, corroborating the above morphological identification. This is the first report of C. truncatum infecting milkweed in India, indicating milkweed as an alternative host in soybean fields, potentially raising inoculum levels and carryover between crops.

Breeding for higher yield, early maturity, wider adaptability and waterlogging tolerance in soybean (Glycine max L.): A case study.

Breeding for higher yield and wider adaptability are major objectives of soybean crop improvement. In the present study, 68 advanced breeding lines along with seven best checks were evaluated for yield and attributing traits by following group balanced block design. Three blocks were constituted based on the maturity duration of the breeding lines. High genetic variability for the twelve quantitative traits was found within and across the three blocks. Several genotypes were found to outperform check varieties for yield and attributing traits. During the same crop season, one of the promising entries, NRC 128,was evaluated across seven locations for its wider adaptability and it has shown stable performance in Northern plain Zone with > 20% higher yield superiority over best check PS 1347. However, it produced 9.8% yield superiority over best check in Eastern Zone. Screening for waterlogging tolerance under artificial conditions revealed that NRC 128 was on par with the tolerant variety JS 97-52. Based on the yield superiority, wider adaptability and waterlogging tolerance, NRC 128 was released and notified by Central Varietal Release Committee (CVRC) of India, for its cultivation across Eastern and Northern Plain Zones of India.

First report of root rot and damping off disease in soybean (Glycine max) caused by Pythium deliense in India.

Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen's identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as mentioned by White et al. (1990). Amplification was performed in a 12.5 µL reaction volume containing 1.5 µL of 10X PCR buffer, 3 µL of 25 mM MgCl2, 1.2 µL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 µL of 10 pM each primer (ITS 1 and ITS 4), and 1 µL of DNA template, 0.3 µL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5'GCTGGCCTTGATGTTGTTCG3') and BtR (5'CGTGA AGAGTACCCAGAC CG3'). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5'GGTGCTTTTTCAGGTGTAGTTGG3') and COXR (5'GCTCCTGCTAATACTGGTAATG T3'). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.

Introgression of null allele of Kunitz trypsin inhibitor through marker-assisted backcross breeding in soybean (Glycine max L. Merr.).

BACKGROUND: Presence of Kunitz trypsin inhibitor (KTI) in soybean seeds necessitates pre-heat treatment of the soy-flour for its inactivation before using it in food and feed products. The heat treatment not only enhances processing costs of the soy-based foods and feeds but also affects seed-protein quality and solubility. Genetic elimination of KTI is an important and effective approach. Therefore, molecular marker-assisted backcross breeding (MABB) approach was adopted for genetic elimination of KTI from two popular soybean genotypes, DS9712 and DS9814. PI542044, an exotic germplasm line was used as donor of the kti allele which inhibits functional KTI peptide production. RESULTS: Foreground selection for the kti allele was performed with three closely linked SSR markers while background selection was done with 93 polymorphic SSR markers. Plants in the BC1F1 generation were found to recover 70.4-87.63 % and 60.26-73.78 % of the recurrent parent genome (RPG) of DS9712 and DS9814, respectively. Similarly, selected plants in the BC2F1 generation had 93.01-98.92 % and 83.3-91.67 % recovery of their respective RPGs. Recombinant selection was performed so as to identify plants with minimal linkage drag. Biochemical analysis of the seeds of the selected plants (ktikti) confirmed absence of KTI peptides in the seeds. Phenotypically, the selected plants were comparable to the respective recurrent parent in yield and other traits. CONCLUSIONS: MABB approach helped in speedy development of 6 KTI free breeding lines of soybean. Such lines will be suitable for the farmers and the soybean industries to use in production of soy-based foods and feeds without pre-heat treatment of the soy-flour. It would contribute towards wider acceptability of soy-based foods and feeds.

QTLomics in Soybean: A Way Forward for Translational Genomics and Breeding.

Food legumes play an important role in attaining both food and nutritional security along with sustainable agricultural production for the well-being of humans globally. The various traits of economic importance in legume crops are complex and quantitative in nature, which are governed by quantitative trait loci (QTLs). Mapping of quantitative traits is a tedious and costly process, however, a large number of QTLs has been mapped in soybean for various traits albeit their utilization in breeding programmes is poorly reported. For their effective use in breeding programme it is imperative to narrow down the confidence interval of QTLs, to identify the underlying genes, and most importantly allelic characterization of these genes for identifying superior variants. In the field of functional genomics, especially in the identification and characterization of gene responsible for quantitative traits, soybean is far ahead from other legume crops. The availability of genic information about quantitative traits is more significant because it is easy and effective to identify homologs than identifying shared syntenic regions in other crop species. In soybean, genes underlying QTLs have been identified and functionally characterized for phosphorous efficiency, flowering and maturity, pod dehiscence, hard-seededness, α-Tocopherol content, soybean cyst nematode, sudden death syndrome, and salt tolerance. Candidate genes have also been identified for many other quantitative traits for which functional validation is required. Using the sequence information of identified genes from soybean, comparative genomic analysis of homologs in other legume crops could discover novel structural variants and useful alleles for functional marker development. The functional markers may be very useful for molecular breeding in soybean and harnessing benefit of translational research from soybean to other leguminous crops. Thus, soybean crop can act as a model crop for translational genomics and breeding of quantitative traits in legume crops. In this review, we summarize current status of identification and characterization of genes underlying QTLs for various quantitative traits in soybean and their significance in translational genomics and breeding of other legume crops.