Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 2 de 2
Filter
Add more filters










Database
Language
Publication year range
1.
Plant Dis ; 88(10): 1164, 2004 Oct.
Article in English | MEDLINE | ID: mdl-30795272

ABSTRACT

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

2.
Plant Dis ; 87(11): 1344-1348, 2003 Nov.
Article in English | MEDLINE | ID: mdl-30812551

ABSTRACT

A real-time fluorescent reverse-transcriptase polymerase chain reaction (RT-PCR) assay using a short fluorogenic 3' minor groove binder (MGB) DNA hydrolysis probe was developed for the detection of Prunus necrotic ringspot virus (PNRSV) in stone fruit trees. The covalent attachment of the minor groove binder moiety at the 3' end of the probe increased the probe target duplex stability and raised the melting temperature to a range suitable for real-time analysis. The real-time RT-PCR assay correlated well with conventional RT-PCR results for the detection of PNRSV. This assay reliably detects PNRSV in bark tissues of dormant cherry and plum trees. Furthermore, it is well adapted for the routine detection of PNRSV because it eliminates one risk of contamination by performing the whole test in a single closed tube. This system may replace the commonly used diagnostic techniques (e.g., woody indicators and immunological tests) to detect this virus.

SELECTION OF CITATIONS
SEARCH DETAIL
...