Analysis of hamster protamines: primary sequence and species distribution.

Basic nuclear proteins were isolated from the sperm of the Syrian hamster Mesocricetus auratus and characterized by gel electrophoresis, amino acid analysis, and sequencing. Analyses of the proteins by gel electrophoresis show that sperm of this species contain both protamines 1 and 2. The two proteins were purified by HPLC and the complete primary sequence of hamster protamine 1 was determined by automated amino acid sequence analysis. The protein sequence was subsequently confirmed by sequencing the PCR-amplified protamine 1 gene. The first forty-two residues of the hamster protamine 2 sequence were obtained by amino acid sequence analysis of the isolated protein, and this sequence was also confirmed and extended by sequencing the gene. Total basic nuclear protein was also isolated from sperm of six other species of hamsters, the protamines were identified by HPLC and amino acid analysis, and the proportion of protamines 1 and 2 in each species was determined. Marked differences in the protamine 2 content of sperm were observed among the different species of hamster. This variation and the high level of sequence similarity between mouse and hamster protamines provide insight into how the two protamines may be organized in sperm chromatin. Mol. Reprod. Dev. 54:273-282, 1999. Published 1999 Wiley-Liss, Inc.

Random coil conformation for extended polyglutamine stretches in aqueous soluble monomeric peptides.

Several neurodegenerative diseases have been found to be strongly associated with proteins containing a polyglutamine stretch which is greatly expanded from approximately 20 glutamines in normal individuals to more than 40 in affected individuals. A conformational change in the expanded polyglutamine stretch has been suggested to form the molecular basis for disease onset. Model peptides containing polyglutamine tend to aggregate and become insoluble. We have synthesized readily water-soluble monomeric peptides by flanking polyglutamine stretches with sequences rich in alanine and lysine. Circular dichroism measurements show that polyglutamine stretches of length 9 or 17 adopt a random coil configuration in aqueous solution. We think that in the disease-associated peptides for normal individuals the stretches of approximately 20 glutamines are in a random coil conformation, whereas in affected individuals the polyglutamine stretch may be in some other conformation. Our method to design soluble monomeric peptides containing extended polyglutamine stretches may be generally useful in studying other highly aggregating peptides.

Mapping and measuring DNA to protein ratios in mammalian sperm head by XANES imaging.

We have used XANES imaging, which combines X-ray absorption near edge spectral features (XANES) with 50-nm-resolution X-ray microscopy, to examine the content and distribution of DNA and protein in mature sperm cells. Sperm nuclei from five different species of mammals were examined; these species were chosen for analysis because their sperm contain marked differences in their protamine 1 and protamine 2 contents. The data we've obtained for bull, stallion, hamster, and mouse sperm suggest that the total nuclear protein to DNA ratio is similar in the sperm of many eutherian mammals. Since protamine constitutes the majority of the sperm nuclear protein, these results indicate that the total protamine content of sperm chromatin must be constant among mammalian species, independent of the extent of expression of the protamine 2 gene.

Analysis of synthetic DNAs and DNA-protamine complexes with the scanning tunneling microscope.

Three duplex DNAs 22, 47, and 100 base-pairs in length have been imaged with the scanning tunneling microscope (STM) after deposition on highly oriented pyrolytic graphite (HOPG). Images of the 47 base-pair (bp) molecules are resolved sufficiently to identify the two phosphodiester strands, the direction of helical coiling (this molecule contains three turns of left-handed helix), and single-stranded ends. Length measurements indicate that all three DNA sequences have adopted an "A-like" conformation. DNA-protamine complexes were also prepared and imaged under similar conditions. Length measurements of the complexes demonstrate that the binding of bull protamine 1 to the 47-mer stabilizes the DNA in a B conformation and prevents the B to A transition that has been shown to occur as the DNA molecules dehydrate on the surface. Measurements of the diameter of the complex (3 nm) were also obtained and were found to be only slightly larger than the DNA molecule. This observation is consistent with the binding of the protamine molecule inside one of the grooves.

Immunological evidence for a P2 protamine precursor in mature rat sperm.

High molecular weight proteins in Rattus norvegicus that are immunoreactive with an anti-protamine 2 specific antibody but not with an anti-protamine 1 specific antibody are described. These proteins were detected by coupling high-performance liquid chromatography (HPLC) with an enzyme-linked immunosorbent assay (ELISA). Briefly, following HPLC separation of rat sperm nuclear proteins, the HPLC fractions were probed with the antibodies. We estimate that the antibody probes are 100-1000 times more sensitive than UV absorbance measurements. Immunoblot analysis following acid-urea electrophoretic separation of rat sperm nuclear proteins, and of the HPLC fractions, also detected putative protamine 2 precursor proteins. The proteins reactive with the anti-protamine 2 antibody are most likely not mature protamine 2, since they were detected in a region of the chromatogram where we would not expect protamine 2 to migrate based on the chromatographic locations of human and mouse protamine 2. Likewise, the immunoblotting experiments demonstrated that the anti-protamine 2 antibody recognized proteins with slower electrophoretic mobilities than would be expected for a mature protamine 2. An anti-protamine 1 monoclonal antibody, Hup1N, that binds rat protamine 1 is also described. Hup1N allowed for identification of the HPLC fractions that contained rat protamine 1. Finally, we demonstrated that Hup1N binds protamine 1 from a large number of species, suggesting a conserved epitope for Hup1N.

Formation of intraprotamine disulfides in vitro.

When mammalian protamine is dissolved in aqueous buffers at neutral or alkaline pH, both ends of the protein fold inward toward the center of the molecule and form disulfide crosslinks that stabilize several different structures. In the absence of reducing agents, these folded forms of protamine may be visualized and quantitated by gel electrophoresis. Using this technique, we have examined the formation of bull protamine disulfides in solution and describe a variety of factors that affect this process. At pH 8, disulfide-stabilized folded forms of protamine appear within minutes after solubilization of the fully reduced protein. Five different monomers are detected by electrophoresis. Each of these monomers is stabilized by at least one disulfide crosslink and migrates with a distinct mobility, ahead of the fully reduced and extended protein. Under certain conditions, dimers of these folded structures crosslinked by interprotamine disulfides are also formed. The appearance of these disulfide-crosslinked forms of protamine is effected by air oxidation, accelerated at alkaline pH, inhibited upon lowering the pH below pH 7 and eliminated by modifying the protein's cysteine residues. Similar intramolecular disulfides are also produced after the protamine molecule binds to DNA. These results suggest that only those cysteines located within the amino- and carboxyterminal ends of the protein appear to participate in forming intramolecular disulfides in vitro.

Analysis of protamines isolated from alcohol preserved epididymides.

Protamines 1 and 2 have been isolated from the sperm of frozen and isopropanol preserved Syrian hamster (Mesocricetus auratus) epididymides and analyzed by gel electrophoresis, high-performance liquid chromatography (HPLC), and amino acid analysis and sequencing. The results show that alcohol preservation does not alter the primary structure of the two sperm nuclear proteins and that the preservation of mammalian reproductive organs in alcohol is a viable alternative to freezing tissues collected in the field. Sperm were isolated from tissues fixed in isopropanol for as long as 7 months without detectable adverse effects on either the isolation of sperm or the primary structure of the protamines.

Identification of bull protamine disulfides.

We have identified the disulfide cross-links in bull protamine by titrating intact bull sperm with dithiothreitol (DTT) and following the modification of each cysteine residue with tritiated iodoacetate. The derivatization of each cysteine was monitored by a combination of HPLC, peptide mapping, and protein sequencing. Analyses of total free sulfhydryls show that all seven of the bull protamine cysteines are cross-linked as disulfides in mature sperm. The first disulfide is reduced at a DTT:protamine cysteine (DTT:Cys) ratio of 0.3 and the last at a ratio of 2.0. Intra- and intermolecular disulfides were identified by correlating the reduction of specific disulfides with the dissociation of protamine from DNA in partially reduced sperm and sperm treated with N,N'-ethylenedimaleimide, a bifunctional disulfide cross-linking agent. Three intermolecular and two intramolecular disulfides were identified. The results of these experiments demonstrate that the amino- and carboxy-terminal ends of the bull protamine molecule are folded inward toward the center of the molecule and are locked in place, each by a single intramolecular disulfide bridge. Three intermolecular disulfides cross-link neighboring protamine molecules around the DNA helix in such a manner that the protamines cannot be dissociated from DNA without first reducing the interprotamine disulfides.

Reactivity and adduct formation of a polyaromatic hydrocarbon, 7-bromomethylbenz[a]anthracene, with chromatin histone proteins.

The alkylation of histones by the direct-acting carcinogen 7-bromomethylbenz[a]anthracene was demonstrated both in vivo and in vitro. The relative molar reactivity for mouse liver histones in vivo was H3 greater than H1 greater than H2b greater than H4 greater than H2a. The in vitro modification of histone H3 was examined in detail. Amino acid adducts stable to acid hydrolysis were separated after acetylation by reversed-phase high-performance liquid chromatography and characterized using ultraviolet absorbance spectra and synthetic amino acid adduct standards. Three major adducts were observed and tentatively identified as cysteinyl, lysyl and histidinyl adducts of histone H3.

Metabolism of 2-amino-1-methyl-6-phenylimidazo[4,5-b] pyridine (PhIP) by liver microsomes and isolated rabbit cytochrome P450 isozymes.

The cytochrome P450-dependent metabolism of the heterocyclic amine mutagen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) has been determined. We investigated the in vitro metabolism of PhIP by polycyclic hydrocarbon-induced mouse and rabbit liver microsomes, and by purified rabbit liver P450 isozymes. Following a 60 min incubation, 3-methylcholanthrene-induced mouse microsomes converted 36% of the PhIP to two major metabolites, N-hydroxy-PhIP and 4'-hydroxy-PhIP, with 43% total metabolism. Rabbit P450 form 6 and form 4 produced the same two major metabolites (20 and 5% total metabolism respectively). Additional metabolites were produced in low yields and amounts varied depending on the isozyme used (1-5%). Metabolites were not detected in incubations of PhIP with P450 forms 2 and 3C. N-Hydroxy-PhIP was found to be directly mutagenic to Salmonella TA98, while the 4'-hydroxy-PhIP was not mutagenic either with or without additional metabolic activation. These data suggest that the cytochrome P450IA isozymes are involved in the metabolism of PhIP by rabbit liver and that formation of N-hydroxy-PhIP is involved in the mutagenicity of PhIP.

Mouse protamine 2 is synthesized as a precursor whereas mouse protamine 1 is not.

The nuclei of mouse spermatozoa contain two protamine variants, mouse protamine 1 (mP1) and mouse protamine 2 (mP2). The amino acid sequence predicted from mP1 cDNAs demonstrates that mP1 is a 50-amino-acid protein with strong homology to other mammalian P1 protamines. Nucleotide sequence analysis of independently isolated, overlapping cDNA clones indicated that mP2 is initially synthesized as a precursor protein which is subsequently processed into the spermatozoan form of mP2. The existence of the mP2 precursor was confirmed by amino acid composition and sequence analysis of the largest of a set of four basic proteins isolated from late-step spermatids whose synthesis is coincident with that of mP1. The sequence of the first 10 amino acids of this protein, mP2 precursor 1, exactly matches that predicted from the nucleotide sequence of cDNA and genomic mP2 clones. The amino acid composition of isolated mP2 precursor 1 very closely matches that predicted from the mP2 cDNA nucleotide sequence. Sequence analysis of the amino terminus of isolated mature mP2 identified the final processing point within the mP2 precursor. These studies demonstrated that mP2 is synthesized as a precursor containing 106 amino acids which is processed into the mature, 63-amino-acid form found in spermatozoa.

High-performance liquid chromatographic separation and partial characterization of human protamines 1, 2, and 3.

A method for separating the three human protamines by HPLC of underivatized, total protamine extracts on a Nucleosil RP-C18 column is described. The identities of the three proteins have been confirmed by a combination of disc gel electrophoresis, amino acid composition, and primary sequence analysis. The results show that human protamine 3 elutes first, closely followed by protamine 2. Protamine 1 elutes later. The amino acid compositions and partial amino terminal sequences of human protamines 2 and 3 indicate that these two proteins are very closely related and suggest that they differ only by three amino-terminal amino acids.

A corrected primary sequence for bull protamine.

We have redetermined the primary sequence for bull protamine using HPLC peptide mapping and automated amino-acid sequencing techniques and report, on the basis of these findings, that the previously published amino-acid sequence for this protein is incorrect. The correct protamine sequence is 50 amino acids in length and differs from the original published sequence by the tripeptide -Cys-39-Arg-40-Arg-41-. Analyses of protamine tryptic peptides derived from nine diverse breeds of Bos tarus and Bos indicus indicate that this sequence is present in the protamine of each breed and that it does not represent a variant or mutation.

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac.

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X + 3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.

Application of HPLC to the isolation of molecular targets in dosimetry studies.

High-performance liquid chromatography (HPLC) methods are described which permit the rapid isolation of multiple target macromolecules from the tissues of animals exposed to chemical mutagens. DNA and selected chromosomal proteins are isolated in a simple two step separation scheme. Isolated nuclei are dissolved in 3 M guanidine hydrochloride and the DNA and chromosomal proteins separated on a TSK 3000 SW column. The DNA peak is retained for analysis and the chromatin proteins are dialyzed, lyophylized, and rechromatographed on a PRP-1 column to separate individual histones. Hemoglobin and albumin, two proteins that may prove useful for monitoring mutagen exposure, are isolated from 100 microL of blood by HPLC on a Poly Cat A cation exchange column. Using this approach, we have monitored the kinetics and dose response of adduct formation (and repair) to DNA, histone, hemoglobin and albumin in mice exposed to 7-bromomethylbenzanthracene and benzo[a]pyrene. The results of these studies are described and briefly discussed. Experiments with other mutagens demonstrate the limits to which DNA adduct quantification may be pushed using radioisotopes. Exposures to very high specific activity (200 Ci/mmole) benzo(a)pyrene have allowed DNA adduct quantification down to a few adducts per cell.

A CHO-cell strain having hypersensitivity to mutagens, a defect in DNA strand-break repair, and an extraordinary baseline frequency of sister-chromatid exchange.

A mutant of CHO cells (strain EM9) previously isolated on the basis of hypersensitivity to killing by ethyl methanesulfonate (EMS) is approx. 10-fold more sensitive than the parental line, AA8, to killing by both EMS and MMS. It is also hypersensitive to killing by other alkylating agents (ethyl nitrosourea and N-methyl-N'-nitro-N-nitrosoguanidine), X-rays, and ultraviolet radiation. The production and repair of DNA single-strand breaks (SSB) were studied using the technique of alkaline elution of DNA from filters. After exposure to 4 Gy of X-rays at 0 degrees C and subsequent incubation at 25 degrees C, SSB were repaired within 12 min in AA8, but little repair occurred in EM9. Similarly, with doses of EMS or MMS that produced comparable numbers of SSB in AA8 and EM9 at the end of a 10-min exposure, repair of SSB occurred more rapidly in AA8 than in EM9, suggesting that individual SSB are longer lived in EM9. EM9 was found to be hypersensitive also to the induction of mutations and sister-chromatid exchanges (SCE) by EMS; per unit dose the mutant had twice as many mutations to thioguanine resistance, 3 times as many mutations to azaadenine resistance, and a 7-fold enhancement in SCE, compared to AA8. Moreover, the baseline frequency of SCE in the mutant was extraordinarily high, i.e., 8.6 +/- 0.6 vs. 107 +/- 5 SCE/cell for AA8 and EM9, respectively, with 10 microM BrdUrd in the medium. The high SCE frequency in EM9 did not vary significantly with BrdUrd concentration over the range examined from 2.5 to 20 microM, and the percentage of 5-bromouracil substitution in the DNA was the same in EM9 and AA8 under these conditions. These data, however, do not rule out the possibility that the high SCE frequency in EM9 is a consequence of an altered sensitivity to incorporated BrdUrd. Thus, EM9 may carry a pleiotropic mutation affecting some function in DNA replication and/or DNA repair and causing the variety of phenotypic properties described in this study.

High-performance liquid chromatographic analysis of cytosine arabinoside and metabolites in biological samples.

A rapid, non-radioactive method to quantitate therapeutically realistic levels of 1-beta-D-arabinofuranosylcytosine (Ara-C) and its metabolites would be useful both in the clinic, for monitoring drug levels, and in the laboratory for correlating drug levels with cellular and molecular perturbations. Liquid chromatographic analysis of arabinose-nucleoside analogs in biological samples is complicated by the presence of interfering nucleosides and nucleotides. We report the development of two analytic procedures to measure Ara-C and metabolite levels in biological samples. One method uses a quaternary ammonium type anion-exchange resin to achieve isocratic separation in less than one hour. The second method utilizes a boronate-derivatized polyacrylamide column which binds cis-diols to selectively retain cytosine and uridine, while arabinose compounds are eluted with recovery approaching 100%. The eluted compounds are then easily quantitated on a reversed-phase C18 column. The sensitivity of both procedures was sufficient to obtain pharmacokinetic data on Ara-C and uracil-arabinose levels in serum and urine and on Ara-C triphosphate levels in tumor cells.

DNA crosslinking, sister-chromatid exchange and specific-locus mutations.

Chinese hamster ovary cells were treated with the DNA-crosslinking chemicals, mitomycin C (MMC) and porfiromycin (POR), and their monofunctional derivative decarbamoyl mitomycin C (DCMMC). After exposure, the cells were studied for the induction of sister-chromatid exchanges (SCEs) and mutations at the hypoxanthine phosphoribosyltransferase and adenine phosphoribosyltransferase loci. The frequency of SCEs varied significantly in successive sampling intervals, requiring the weighting of each interval by the percentage of second-division mitosis in that interval to obtain the mean SCE frequency for each dose. All 3 compounds were potent inducers of SCEs but weakly mutagenic. All 3 chemicals by concentration were approximately equally effective in inducing SCEs or mutations. When the induced SCEs and mutations were compared at equal levels of survival, DCMMC was slightly more effective than MMC or POR in inducing SCEs and somewhat less mutagenic. These results indicate that the DNA interstrand crosslink is not the major lesion responsible for the induction of SCE or mutation by these compounds.

Separation of satellite DNA chromatin and main band DNA chromatin from mouse brain.

Using restriction endonucleases which preferentially digest mouse main band DNA and leave satellite DNA intact, we have isolated highly purified chromatin fractions containing only mouse satellite or main band DNA. Following the digestion of mouse brain nuclei with EndoR Alu I, main band DNA chromatin is selectively extracted with 10mM Tris, 10mM EDTA. Satellite DNA chromatin is subsequently extracted from the nuclear pellet with Tris-3M urea and further purified on sucrose gradients. Chromatin extracted from digested nuclei with Tris-EDTA contains only main band DNA and has a molecular weight lower than 2 x 10(6). Chromatin fractions obtained from the lower regions of sucrose gradients of the Tris-Urea extracts contain 40--95% satellite DNA and have a molecular weight of 6 to 8 x 10(6). Both the satellite DNA and main band DNA chromatins contain all five histones and have a protein to DNA ratio of 1.3 to 1.