Potential of probiotics from fermented cereal-based beverages in improving health of poor people in Africa.

Milk and milk products; particularly yoghurts have almost exclusively been used as media for probiotic delivery to human being for a very long time. Despite health benefits such products have to humans; that include supply of nutrients, prevention and cure of certain communicable and non-communicable diseases; the presence of allergens, increased lactose intolerance, hypercholesterolemia effects, the need for vegetarian probiotic products, cultural food taboos against milk, and religious beliefs have led to limitations on the use of milk and its products as probiotic vehicles in many places including Africa. Such limitations have led to more researches worldwide on alternative delivery media for probiotics in order to meet the food preferences and demands of people affected by milk and milk products. An integrative approach has been used to find common ideas and concepts from different studies. Different food matrices have been tested for their ability to carry probiotics and cereals and cereal products have been found as among suitable substrates for the purpose. Some investigations have revealed that traditional African fermented cereal-based beverages are potential probiotic carriers because of the probiotic Lactobacillus spp. and yeasts which are involved in the fermentation of such products. This offers an opportunity for the African cereal beverages to be used to provide probiotic health benefits to the majority of African populations. Thus, this review provides information on probiotics including sources, types, health benefits, vehicles for their delivery and specifically also on challenges and future prospects for cereal-based probiotics development and consumption in Africa.

The potential of Bacilli rhizobacteria for sustainable crop production and environmental sustainability.

Conventional agricultural practices often rely on synthetic fertilizers and pesticides which have immense and adverse effects on humans, animals and environments. To minimize these effects, scientists world over are now deeply engaged in finding alternative approached for crop production which are less dependent on chemical inputs. One such approach is the use of rhizospheric bacteria as vital components of soil fertility and plant growth promotion (PGP) through their direct and indirect processes in plant rhizospheres. Among the most studied rhizobacteria are the Bacilli, particularly for production of antibiotics, enzymes and siderophores all of which are important aspects of PGP. Despite this, little information is available especially on their potentiality in crop production and their direct application only involves a few species, leaving a majority of these important rhizobacteria unexploited. This paper gives an overview of the unique properties of Bacilli rhizobacteria as well as their different PGP mechanisms that if mined can lead to their successful application and agricultural sustainability. It further points out the missing aspects with regards to these important rhizobacteria that should be considered for future research. This information will be useful in analyzing the PGP abilities of Bacilli rhizobacteria with an aim of fully mining their potential for crop production and environmental sustainability.

Five Species of Xanthomonads Associated with Bacterial Leaf Spot Symptoms in Tomato from Tanzania.

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 µl of sterile distilled water and 50 µl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5'GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5'CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.