Childhood disadvantage and adolescent socioemotional wellbeing as predictors of future parenting behaviour.

INTRODUCTION: In extending work on early life antecedents of parenting, we investigate associations between childhood family history of disadvantage, adolescent socioemotional wellbeing, and age at first parenthood and subsequent parenting behaviour. METHODS: Parent-child interactions were recorded when participants in the longitudinal Dunedin Multidisciplinary Health and Development Study (New Zealand) had a three-year-old child. Data were available for 358 mothers and 321 fathers, aged between 17.7 and 41.5 at the time of their child's birth. Associations between parenting and antecedent data on socioeconomic disadvantage, adolescent wellbeing and mental health, as well as current adult mental health and age at parenting, were tested for using structural equation modelling. RESULTS: Family disadvantage in childhood and lower adolescent wellbeing was associated with less positive future parenting, but only adult (not adolescent) anxiety/depression symptoms were directly associated with parenting behaviour. Childhood family disadvantage was associated with further disadvantage across the life course that included less positive parenting of the next generation. In contrast, socioemotional wellbeing during adolescence and later age of onset of parenting were associated with more positive parenting. CONCLUSIONS: Reducing childhood disadvantage and improving socioemotional wellbeing during childhood and adolescence is likely to have intergenerational benefits through better parenting of the next generation.

Sun-tanning perceptions of a new zealand urban population (1994-2005/6).

Background. Sun-tanning perceptions are monitored to identify changes and help refine targeting of skin cancer prevention messages. Aim. To investigate associations between perceptions of sun-tanning and demographic factors among a New Zealand urban population, 1994-2006. Methods. A telephone survey series was conducted during summer in 1994, 1997, 1999/2000, 2002/2003, and 2005/2006. Demographic and personal information (sex, age group, skin sun-sensitivity, and self-defined ethnicity) obtained from 6,195 respondents, 50.2% female, 15-69 years, was investigated in relation to six sun-tanning related statements. A total "positive perceptions of tanning" (ProTan) score was also calculated. Regression analyses modelled each component and the ProTan score against survey year and respondent characteristics. Results. Statistically significantly higher ProTan scores were found for age group (strong reverse dose-response effect), male sex, residence (highest in Auckland), ethnicity (highest among Europeans), and sun sensitivity (an n-shaped association). There was no statistically significant change in total ProTan scores from baseline. Conclusions. The development, pretesting, and evaluation of messages for those groups most likely to endorse ProTan statements should be considered for the New Zealand skin cancer prevention program. To achieve and embed significant change, mass media campaigns may require greater intensity and reinforcement with sustained contextual support for settings-based behavioural change.

First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States.

Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5'TCCGTAGGTGAACCTGCGG) and ITS4 (5'TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be "mainly" associated with legumes is C. epithymum Murr., and C. pentagona is "especially" associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.

Comparison of seasonal phenol and p-cresol emissions from ground-level area sources in a dairy operation in central Texas.

Although there are more than 200 odor-causing volatile organic compounds (VOCs), phenol and p-cresol are two prominent odor-causing VOCs found downwind from concentrated animal feeding operations (CAFOs). The VOC emissions from cattle and dairy production are difficult to quantify accurately because of their low concentrations, spatial variability, and limitations of available instruments. To quantify VOCs, a protocol following US. Environmental Protection Agency (EPA) Method TO-14A has been established based on the isolation flux chamber method and a portable gas chromatograph (GC) coupled with a purge-and-trap system. The general objective of this research was to quantify phenol and p-cresol emission rates (ERs) from different ground-level area sources (GLASs) in a free-stall dairy during summer and winter seasons using this protocol. Two-week-long sampling campaigns were conducted in a dairy operation in central Texas. Twenty-nine air samples were collected during winter and 37 samples were collected during summer from six specifically delineated GLASs (barn, loafing pen, lagoon, settling basin, silage pile, and walkway) at the free-stall dairy. Thirteen VOCs were identified during the sampling period and the GC was calibrated for phenol and p-cresol, the primary odorous VOCs identified. The overall calculated ERs for phenol and p-cresol were 2656 +/- 728 and 763 +/- 212 mg hd(-1) day(-1), respectively, during winter. Overall phenol and p-cresol ERs were calculated to be 1183 +/- 361 and 551 +/- 214 mg hd(-1) day(-1), respectively, during summer. In general, overall phenol and p-cresol ERs during winter were about 2.3 and 1.4 times, respectively, higher than those during summer.

Disorders of sexual development in the domestic horse, Equus caballus.

Abnormalities of sexual development causing infertility in horses have been investigated since the early 1970's. Conventional cytogenetic analysis by karyotyping has been the primary tool used to investigate these horses. Abnormalities have a broad range, from a phenotypically normal mare with gonadal dysgenesis to a horse with ambiguous external genitalia and internal male and female organs. Cytogenetic analysis can determine genetic sex but cannot identify mutations or deletions of genes involved in the sex determination pathway. Molecular technologies have been developed to confirm cytogenetic results and to aid in identifying the genetic causes of abnormal sex determination in horses. In this paper, we review the historical development of methods used to understand abnormal sexual development in the horse as well as summarize cases reported over the last 40-50 years.

Equine disorders of sexual development in 17 mares including XX, SRY-negative, XY, SRY-negative and XY, SRY-positive genotypes.

We described the clinical, cytogenetic and molecular findings of 17 clinical equine cases presented for abnormal sexual development and infertility. Six horses with an enlarged clitoris had an XX, SRY-negative genotype, which displayed male-like behavior (adult individuals). Bilateral ovotestes were noted in 2 of those cases, while another case showed increased levels of circulating testosterone. Six horses with a female phenotype, including normal external genitalia, had an XY, SRY-negative genotype. These individuals had small gonads and an underdeveloped internal reproductive tract. Four horses with normal appearing external genitalia had an XY, SRY-positive genotype, 3 of them had hypoplastic testes and male-like behavior. In addition, one young filly with enlarged clitoris and hypoplastic testes had the same genotype but did not show male-like behavior due to her age. Three of these horses were related with 2 being siblings. These findings demonstrate the diversity of disorders of sexual development seen in the horse. Furthermore, they emphasize the need for further research to identify genes involved in abnormal sex determination and differentiation in the horse.

Soluble, semivolatile phenol and nitrogen compounds in milk-processing wastewaters.

Potable water is an essential and major input in processing our food supplies, and the continued growth in food manufacturing is placing increased pressure on this limited resource. Recycling and reuse of factory wastewater can lessen potable water use but requires a detailed understanding of wastewater properties. This study uses solid-phase extraction techniques with gas chromatography-mass spectrometry analysis to investigate trace-level semivolatile organic species in various waste and reference waters associated with the Burra Foods milk-processing plant located in Southeastern Australia. Our focus was on contaminants containing phenolic and heterocyclic nitrogen functional groups, which, because of their toxicity and persistence, may limit options for water recycling and reuse. Effluent from the wastewater treatment plant of the factory showed both the highest soluble carbon burden (47 mg/kg) and concentrations of target compounds. The target species found in these effluents included methyl phenol (13 mg/kg), hydroxy indole (9.8 mg/kg), synthetic tolyltriazoles (5.1 mg/kg) and alkyl phenol ethoxylates (0.2 mg/kg). Given the environmental stability of the tolyltriazoles, they may act as chemical markers where these effluents are used for purposes such as irrigation. Milk evaporator condensate waters, in contrast to the effluent, contained very few target species, with only low levels of pyrrolidine and piperidine derivatives such as ethylglutarimide (450 mug/L) detected. Although there were fewer target microcontaminants overall in the potable and creek reference waters, these samples had characteristic profiles. The potable water analysis revealed hydroxy cineole (2.1 microg/L) and the creek analysis revealed dichlorohydroxyacetophenone (0.3 microg/L), which were not detected in other waters. The compounds found in the wastewaters are likely to have been derived from milk or synthetic chemicals used in factory operations. The presence of nitrogen compounds in all the different milk-processing waters suggest their likely source was milk, probably milk phosphoproteins subjected to thermal, chemical, or microbial degradation. Our benign results for the condensates suggest it may be possible to substitute condensate for potable water with minimal pretreatment, both within the plant and in other applications, such as irrigation of recreation turf.

Consistent Quantitative Trait Loci in Pea for Partial Resistance to Aphanomyces euteiches Isolates from the United States and France.

ABSTRACT Development of pea cultivars resistant to Aphanomyces root rot, the most destructive root disease of pea worldwide, is a major disease management objective. In a previous study of a mapping population of 127 recombinant inbred lines (RILs) derived from the cross 'Puget' (susceptible) x '90-2079' (partially resistant), we identified seven genomic regions, including a major quantitative trait locus (QTL), Aph1, associated with partial resistance to Aphanomyces root rot in U.S. fields (21). The objective of the present study was to evaluate, in the same mapping population, the specificity versus consistency of Aphanomyces resistance QTL under two screening conditions (greenhouse and field, by comparison with the previous study) and with two isolates of Aphanomyces euteiches originating from the United States and France. The 127 RILs were evaluated in the greenhouse for resistance to pure culture isolates SP7 (United States) and Ae106 (France). Using the genetic map previously described, a total of 10 QTL were identified for resistance in greenhouse conditions to the two isolates. Among these were Aph1, Aph2, and Aph3, previously detected for partial field resistance in the United States. Aph1 and Aph3 were detected with both isolates and Aph2 with only the French isolate. Seven additional QTL were specifically detected with one of the two isolates and were not identified for partial field resistance in the United States. The consistency of the detected resistance QTL over two screening environments and isolates is discussed with regard to pathogen variability, and disease assessment and QTL detection methods. This study suggests the usefulness of three consistent QTL, Aph1, Aph2, and Aph3, for marker-assisted selection.

Time perception: does it distinguish ADHD and RD children in a clinical sample?

This study used a double-dissociation design to evaluate whether children with ADHD demonstrated specific deficits relative to children with Reading Disorders. Recent theory suggests that ADHD children have deficits in time perception and working memory, whereas RD children have deficits in phonological decoding. The performance of 113 clinic-referred children aged 6-11 was examined using measures of working memory, phonological processing, and time perception. Respondents completed two time production tasks in which they were to judge when 30-s had elapsed, and another in which they were asked to estimate the duration of the Conners' CPT (CCPT). Time Perception and phonological processing variables were submitted to a 2 x 2 ANCOVA (ADHD vs. RD), covarying for age, SES, IQ, and working memory. Children with ADHD were more likely to overestimate the time taken for the CCPT than children without ADHD, but no group differences were found on the 30-s estimation tasks. Children with RD did not display deficits in time estimation, but showed deficits in auditory phonological processing. The lack of interaction effects supported an "etiological subtype" over the "phenocopy" model of ADHD and RD. No group differences were detected using the CCPT. Although our previous studies did not find an order effect for the Conners' CPT in a 1-hr battery, a fatigue effect was evident with a 1.5-hr battery. The implications for Barkley's behavioral inhibition theories (R. Barkley, 1997) are discussed.

Caries prevalence and severity in urban Fijian school children.

OBJECTIVES: To determine the prevalence and severity of dental caries in a sample of urban Fijian school children. DESIGN: Cross-sectional. SAMPLE AND METHODS: Children aged between 6 and 8 years who attended one of four primary schools in different localities of Suva completed self-report questionnaires and were examined for dental caries. RESULTS: A total of 704 children (response rate = 72.4%) returned questionnaires and were examined dentally. The prevalence of dental caries in the primary dentition was 87.6% and in the permanent dentition, 46.7%. The mean dfs and mean DFS were 8.43 (SD 7.82) and 2.38 (SD 1.37), respectively. High caries prevalence and severity were associated with infrequent brushing, snacking on sugar-containing foods, having seen a dentist before, and having last visited a dentist because of pain. CONCLUSIONS: The caries prevalence of the sample was comparable with findings from a national oral health survey conducted in 1985/86, but the caries severity was greater. As in other developing countries, this may be due to an increased availability of refined sugar products without a concurrent rise in oral health awareness. The study findings contribute to the overall picture of Fijian school children's dental health.

Quantitative trait loci for partial resistance to Aphanomyces root rot in pea.

Aphanomyces root rot, caused by Aphanomyces euteiches Drechs, is the most-important disease of pea ( Pisum sativum L.) worldwide. No efficient chemicals are available to control the pathogen. To facilitate breeding for Aphanomyces root rot resistance and to better understand the inheritance of partial resistance, our goal was to identify QTLs associated with field partial resistance. A population of 127 RILs from the cross Puget (susceptible) x 90-2079 (partially resistant) was used. The lines were assessed for resistance to A. euteiches under field conditions at two locations in the United States (Pullman, Wash. and LeSueur, Minn.) in 1996 and 1998 for three criteria based on symptom intensity and disease effects on the whole plant. The RILs were genotyped using automated AFLPs, RAPDs, SSRs, ISSRs, STSs, isozymes and morphological markers. The resulting genetic map consisted of 324 linked markers distributed over 13 linkage groups covering 1,094 cM (Kosambi). Twenty seven markers were anchored to other published pea genetic maps. A total of seven genomic regions were associated with Aphanomyces root rot resistance. The first one, located on LG IVb and named Aph1, was considered as "major" since it was highly consistent over the years, locations and resistance criteria studied, and it explained up to 47% of the variation in the 1998 Minnesota trial. Two other year-specific QTLs, namely Aph2 and Aph3, were revealed from different scoring criteria on LG V and Ia, respectively. Aph2 and Aph3 mapped near the r (wrinkled/round seeds) and af (normal/afila leaves) genes, and accounted for up to 32% and 11% of the variation, respectively. Four other "minor" QTLs, identified on LG Ib, VII and B, were specific to one environment and one resistance criterion. The resistance alleles of Aph3 and the two "minor" QTLs on LG Ib were derived from the susceptible parent. Flanking markers for the major Aphanomyces resistance QTL, Aph1, have been identified for use in marker-assisted selection to improve breeding efficiency.

Nicotine dependence and attempts to quit or cut down among young adult smokers.

AIMS: To describe tobacco smoking behaviours, attempts to cut down or quit, and estimate the prevalence of DSM-IV nicotine dependence among young adult smokers. To relate these findings to population demand for national Quitline services. METHODS: Confidential interviews were conducted during the assessment of the Dunedin Multidisciplinary Health and Development Study birth cohort at age 26 years. Current smokers who had smoked daily for at least one month during the twelve months before interview were asked questions to identify nicotine dependence, based on DSM-IV criteria. RESULTS: Overall, 40% (n = 386) of the cohort followed up were current smokers who met the twelve month daily smoking criterion, one third of whom fulfilled DSM-IV criteria for nicotine dependence. The mean number of attempts to quit or cut down in the past year was 1.2. Assuming that each attempt represents a potential call to the Quitline, more than 5500 calls per month might be anticipated from the 25-29 year age group and in excess of 40 000 from the total New Zealand population, eighteen years and older. CONCLUSIONS: Results indicate that many young adult smokers are potential users of smoking cessation services and many are nicotine dependent. In order to satisfy this reservoir of need and reduce the population burden of ill-health and premature death due to tobacco smoking, resources should continue to be provided to support and enhance tobacco control programmes with proven effectiveness in helping smokers to quit.

Sunburn and sun protection among New Zealand adolescents over a summer weekend.

OBJECTIVE: To examine predictors of sunburn and sun protection practices during summer weekends within a sample of NZ adolescents. METHOD: Phone interviews were conducted with 203 participants aged 12-17 years. Questions were asked about behaviour from 11am to 4pm during the previous weekend. RESULTS: Less than half of the sample outside during peak radiation hours wore sunscreen and only a quarter wore hats. Sunburn was experienced by 31% of adolescents and was associated with spending longer times outside and use of sunscreen without reapplication. Wearing a sunhat was predicted by being younger and male, while sunscreen use was predicted by being female. CONCLUSIONS: There is a lack of appropriate sun protection among many NZ adolescents, and correspondingly high rates of sunburn. Possible opportunities to address this are through increasing the efficacy of sunscreen and sun hat use, and creating outdoor environments that support sun avoidance.

Low self-esteem and hopelessness in childhood and suicidal ideation in early adulthood.

This study examined the longitudinal relationship between family characteristics in early childhood. self-esteem, hopelessness and thoughts of self-harm in the midchildhood years, and suicidal ideation at ages 18 and 21. Path analysis was used to establish separate models for boys and girls. The results suggested different pathways to later suicidal ideation for boys and girls. For boys, suicidal ideation seemed to have stronger roots in childhood, with significant paths from low self-esteem and hopelessness to early thoughts of self-harm and thence to later ideation. For girls, self-esteem had a small but significant direct effect on later suicidal ideation. The findings provide support for the idea that individual characteristics such as feelings of hopelessness and low self-esteem act as "generative mechanisms," linking early childhood family characteristics to suicidal ideation in early adulthood.

Sun protection practices, knowledge and attitudes to tans among New Zealand adolescents, 1991-1997.

AIMS: To examine change in the self-reported sun protection, knowledge and attitudes to tans amongst fourth form students from 1991 to 1997. METHODS: Questionnaires were mailed to 20 New Zealand secondary schools, where 20 students were randomly selected to participate in each school. RESULTS: The proportions of adolescents who reported getting sunburnt over summer, and sunbathing for the purpose of tanning increased significantly from 1991 to 1997, while there were decreases in the proportions who reported getting a suntan, wearing clothing for sun protection and having heard of melanoma. There was also some evidence of a decrease in the attribution of positive qualities to a tan. CONCLUSIONS: Some positive changes in attitudes to tanning among New Zealand adolescents were present over the 1991-1997 period. Although these changes are promising there was little change in utilisation of sun protection measures, in fact, there was evidence that this had worsened.

Effectiveness and economic evaluation of a nurse delivered home exercise programme to prevent falls. 2: Controlled trial in multiple centres.

OBJECTIVES: To assess the effectiveness of trained nurses based in general practices individually prescribing a home exercise programme to reduce falls and injuries in elderly people and to estimate the cost effectiveness of the programme. DESIGN: Controlled trial with one year's follow up. SETTING: 32 general practices in seven southern New Zealand centres. PARTICIPANTS: 450 women and men aged 80 years and older. INTERVENTION: 330 participants received the exercise programme (exercise centres) and 120 received usual care (control centres); 87% (371 of 426) completed the trial. MAIN OUTCOME MEASURES: Number of falls, number of injuries resulting from falls, costs of implementing the programme, and hospital costs as a result of falls. RESULTS: Falls were reduced by 30% in the exercise centres (incidence rate ratio 0.70, 95% confidence interval 0.59 to 0.84). The programme was equally effective in men and women. The programme cost $NZ418 (121 pound sterling) (at 1998 prices) per person to deliver for one year or $NZ1519 (441 pound sterling) per fall prevented. Fewer participants had falls resulting in injuries, but there was no difference in the number who had serious injuries and no difference in hospital costs resulting from falls in exercise centres compared with control centres. CONCLUSIONS: An individually tailored exercise programme, delivered by trained nurses from within general practices, was effective in reducing falls in three different centres. This strategy should be combined with other successful interventions to form part of home programmes to prevent falls in elderly people.

Multiple maltreatment, attribution of blame, and adjustment among adolescents.

The study examined the predictive utility of blame attributions for maltreatment. Integrating theory and research on blame attribution, it was predicted that self-blame would mediate or moderate internalizing problems, whereas other-blame would mediate or moderate externalizing problems. Mediator and moderator models were tested separately. Adolescents (N = 160, ages 11-17 years) were randomly selected from the open caseload of a child protection agency. Participants made global maltreatment severity ratings for each of physical abuse, psychological abuse, neglect. sexual abuse, and exposure to family violence. Participants also completed the Attribution for Maltreatment Interview (AFMI), a structured clinical interview that assessed self- and perpetrator blame for each type of maltreatment they experienced. The AFMI yielded five subscales: self-blaming cognition, self-blaming affect, self-excusing. perpetrator blame, and perpetrator excusing. Caretaker-reported (Child Behavior Checklist) and self-reported (Youth Self Report) internalizing and externalizing were the adjustment criteria. Controlling for maltreatment severity, the AFMI subscales explained significant variance in self-reported adjustment. Self-blaming affect was the most potent attribution, particularly among females. Attributions mediated maltreatment severity for self-reported adjustment but moderated it for caretaker-reported adjustment. The sophistication and relevance of blame attributions to adjustment are discussed, and implications for research and clinical practice are identified.

A longitudinal study of health related quality of life and utility measures in patients with advanced breast cancer.

Health related quality of life (HRQOL) measures are now accepted as indicators of efficacy in the palliative treatment of cancer. Utility measures may also provide valuable information yet they have been applied less frequently. To assess the application of a time trade-off (TTO) utility measure and its concordance with the Spitzer uniscale and quality of life index (QLI) 38 women with advanced, symptomatic breast cancer were studied over a 12 month period. The correlation coefficient for QLI and TTO values was 0.54 and for uniscale and TTO 0.62. Using generalized estimating equations the regression of TTO scores on QLI and uniscale scores was significant at baseline. In longitudinal analyses results were significant only for QLI. Although all participants completed the HRQOL measures only 24 (63%) were prepared to trade time. The remaining 14 (32%) stated they felt too well to trade. Those prepared to trade time recorded significantly worse mean HRQOL scores throughout the study compared to those who felt too well to trade and had tumors which showed a poorer response to therapy. In this preliminary study utility and HRQOL scores were generally favorable throughout the 12 month study period and showed fair to moderate concordance. Further research in larger patient groups is required to better define the relationships between utility and HRQOL measures.