Efficacy and safety of methylphenidate on attention deficit hyperactivity disorder in children with Down syndrome.

BACKGROUND: Attention deficit hyperactivity disorder (ADHD) is a common co-morbidity that affects up to 44% of children with Down syndrome (DS). There is a need for reliable, good quality research on the use of methylphenidate within this population. The objective of this study is to report our experience regarding the management of ADHD in these children using methylphenidate. METHODS: This study is a retrospective observation of 21 children with DS, followed at Jérôme Lejeune Institute between 2000 and 2018. The diagnosis of ADHD was made using the Diagnostic and Statistical Manual of Mental Disorders criteria. Efficacy was measured as response or non-response on two main symptoms: attention/concentration and hyperactivity/impulsivity. Safety was evaluated by the presence or absence of side effects. RESULTS: Sixteen out of the 21 children (76%) showed improvement with methylphenidate. The average age of treatment onset in responding children was 8 years and 10 months versus 6 years and 3 months in non-responders (P = 0.05). Average dose/weight was significantly different in responders and non-responders (0.82 vs. 0.54 mg/kg/day, respectively; P = 0.03). Twelve children out of 21 (57%) experienced side effects; only three experienced side effects severe enough to require treatment interruption. Most common side effects were loss of appetite and difficulties in falling asleep. CONCLUSION: Methylphenidate was effective and safe in treating ADHD in 76% of cases in children with DS, with few serious side effects to report. Early diagnosis of ADHD is important to improve the quality of life, learning, inclusion and socialisation of children with DS.

Feeding problems and gastrointestinal diseases in Down syndrome.

BACKGROUND AND METHOD: Feeding problems and gastrointestinal disorders are the most common anomalies in people with Down syndrome (DS) and have a significant impact on their daily life. This study lists the various anomalies on the basis of 504 references selected from a PubMed search in October 2018. RESULTS: The anomalies are grouped into three categories: anatomical anomalies: duodenal atresia and stenosis (3.9%), duodenal web and annular pancreas; aberrant right subclavian artery (12% of children with DS with cardiac anomaly); Hirschsprung's disease (2.76%); anorectal malformation (1.16%); congenital vascular malformations of the liver; orofacial cleft, bifid uvula (4.63%), and submucous orofacial cleft; esophageal atresia (0.5-0.9%); pyloric stenosis (0.3%); diaphragmatic hernia; malrotation of small intestine or duodenum inversum; omphalocele, gastroschisis or anomalies of the median line, anomalies of the umbilical vein; biological, immunological, and infectious anomalies: neonatal cholestasis (3.9%); neonatal hepatic fibrosis; Helicobacter pylori infection (75.8% in institutionalized children with DS, between 29.2 and 19.5% in non-institutionalized); non-alcoholic fatty liver disease (NAFLD; 82% in obese and 45% in non-obese); biliary lithiasis (6.9% under 3 years); celiac disease (6.,6%); geographical tongue (4%); hepatitis B virus sensitivity; autoimmune hepatitis and cholangitis; Crohn's disease, inflammatory bowel disease (IBD); pancreatitis; vitamin D deficiency (45.2% in Italy); functional disorders: suction, swallowing and chewing disorders (13 of 19 children with DS under 4 years); gastroesophageal reflux (47% in children with sleep apnea); achalasia (0,5% in adults); obesity (51.6% of males and 40.0% of females in Ireland) and overweight (32.0% and 14.8%); constipation (19.0%). Based on their practice, the authors insist on the following points: malformations are sometimes detected late (chronic vomiting after the introduction of food pieces, resistant constipation despite appropriate measures); prescription of preventive doses of vitamin D is advised; jaundice in a baby with DS may be retentional; in the event of transient leukemoid reaction it is vital to monitor liver function; the patient with geographic tongue must be reassured; for celiac serology there is no consensus on the staring age and the frequency, we propose every year from the age of 2; we advise to test people with DS for H. pylori infection if they are attending specialized institutions; abdominal ultrasounds must be systematic during the first months of life; detection of NAFLD is recommended; people with DS must be vaccinated against hepatitis B; breastfeeding is possible with maternal support; it is important to start speech therapy very early; feeding difficulties are often overlooked by the family and educators; gastroesophageal reflux is often pathological; preventing obesity must start from birth using body mass index for the general population; it is necessary to do everything for their meals to be joyful.

Homozygous mutation in ELMO2 may cause Ramon syndrome.

We report on a girl, born to first cousin Lebanese parents, with intellectual disability, seizures, repeated gingivorrhagia, enlarged lower and upper jaws, overgrowth of the gums, high arched and narrow palate, crowded teeth, hirsutism of the back, large abdomen and a small umbilical hernia. Cysts of the mandible, fibrous dysplasia of bones, and enlarged adenoids causing around 60% narrowing of the nasopharyngeal airways were noted at radiographic examination. Her brother presented with the same features in addition to a short stature, an ostium secundum, and more pronounced intellectual disability. He died at the age of 8 years from a severe pulmonary infection and repeated bleeding episodes. A clinical diagnosis of Ramon syndrome was made. Whole exome sequencing studies performed on the family revealed the presence of a novel homozygous missense mutation in ELMO2 gene, p.I606S in the affected individuals. Loss of function mutations in ELMO2 have been recently described in another clinically distinct condition: primary intraosseous vascular malformation or intraosseous hemangioma, called VMOS. Review of the literature and differential diagnoses are discussed.

Cost-benefit analysis: newborn screening for inborn errors of metabolism in Lebanon.

OBJECTIVES: Few countries in the Middle East-North Africa region have adopted national newborn screening for inborn errors of metabolism by tandem mass spectrometry (MS/MS). We aimed to evaluate the cost-benefit of newborn screening for such disorders in Lebanon, as a model for other developing countries in the region. METHODS: Average costs of expected care for inborn errors of metabolism cases as a group, between ages 0 and 18, early and late diagnosed, were calculated from 2007 to 2013. The monetary value of early detection using MS/MS was compared with that of clinical "late detection", including cost of diagnosis and hospitalizations. RESULTS: During this period, 126000 newborns were screened. Incidence of detected cases was 1/1482, which can be explained by high consanguinity rates in Lebanon. A reduction by half of direct cost of care, reaching on average 31,631 USD per detected case was shown. This difference more than covers the expense of starting a newborn screening programme. CONCLUSION: Although this model does not take into consideration the indirect benefits of the better quality of life of those screened early, it can be argued that direct and indirect costs saved through early detection of these disorders are important enough to justify universal publicly-funded screening, especially in developing countries with high consanguinity rates, as shown through this data from Lebanon.

Search for ReCQL4 mutations in 39 patients genotyped for suspected Rothmund-Thomson/Baller-Gerold syndromes.

Three overlapping conditions, namely Rothmund-Thomson (RTS), Baller-Gerold (BGS) and RAPADILINO syndromes, have been attributed to RECQL4 mutations. Differential diagnoses depend on the clinical presentation, but the numbers of known genes remain low, leading to the widespread prescription of RECQL4 sequencing. The aim of our study was therefore to determine the best clinical indicators for the presence of RECQL4 mutations in a series of 39 patients referred for RECQL4 molecular analysis and belonging to the RTS (27 cases) and BGS (12 cases) spectrum. One or two deleterious RECQL4 mutations were found in 10/27 patients referred for RTS diagnosis. Clinical and molecular reevaluation led to a different diagnosis in 7/17 negative cases, including Clericuzio-type poikiloderma with neutropenia, hereditary sclerosing poikiloderma, and craniosynostosis/anal anomalies/porokeratosis. No RECQL4 mutations were found in the BGS group without poikiloderma, confirming that RECQL4 sequencing was not indicated in this phenotype. One chromosomal abnormality and one TWIST mutation was found in this cohort. This study highlights the search for differential diagnoses before the prescription of RECQL4 sequencing in this clinically heterogeneous group. The combination of clinically defined subgroups and next-generation sequencing will hopefully bring to light new molecular bases of syndromes with poikiloderma, as well as BGS without poikiloderma.

Report on a patient with a 12q24.31 microdeletion inherited from an insulin-dependent diabetes mellitus father.

We report a 2.3-year-old female patient with global developmental delay, infantile spasms, hypotonia, microcephaly, flat face, full cheeks, macroglossia, highly arched palate, retro-gnathia, narrow ear orifices, and café-au-lait spots. Molecular karyotyping revealed approximately a 1-Mb interstitial deletion of the long arm of one chromosome 12, del(12)(q24.31). The same deletion was identified in her father who presents insulin-dependent diabetes mellitus (IDDM) diagnosed at 14 years. Only one other patient with a similar de novo deletion has been reported previously [Mol Syndromol 2010;1:42-45]. A phenotype-genotype correlation is discussed, and the description of a novel rare microdeletion entity is raised.

Systematic molecular and cytogenetic screening of 100 patients with marfanoid syndromes and intellectual disability.

The association of marfanoid habitus (MH) and intellectual disability (ID) has been reported in the literature, with overlapping presentations and genetic heterogeneity. A hundred patients (71 males and 29 females) with a MH and ID were recruited. Custom-designed 244K array-CGH (Agilent®; Agilent Technologies Inc., Santa Clara, CA) and MED12, ZDHHC9, UPF3B, FBN1, TGFBR1 and TGFBR2 sequencing analyses were performed. Eighty patients could be classified as isolated MH and ID: 12 chromosomal imbalances, 1 FBN1 mutation and 1 possibly pathogenic MED12 mutation were found (17%). Twenty patients could be classified as ID with other extra-skeletal features of the Marfan syndrome (MFS) spectrum: 4 pathogenic FBN1 mutations and 4 chromosomal imbalances were found (2 patients with both FBN1 mutation and chromosomal rearrangement) (29%). These results suggest either that there are more loci with genes yet to be discovered or that MH can also be a relatively non-specific feature of patients with ID. The search for aortic complications is mandatory even if MH is associated with ID since FBN1 mutations or rearrangements were found in some patients. The excess of males is in favour of the involvement of other X-linked genes. Although it was impossible to make a diagnosis in 80% of patients, these results will improve genetic counselling in families.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

A novel deletion in ZBTB24 in a Lebanese family with immunodeficiency, centromeric instability, and facial anomalies syndrome type 2.

The immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disease characterized by targeted chromosome breakage, directly related to a genomic methylation defect. It manifests with phenotypic and clinical variability, with the most consistent features being developmental delay, facial anomalies, cytogenetic defects and immunodeficiency with a reduction in serum immunoglobulin levels. From the molecular point of view, ICF syndrome was always divided into ICF type I (ICF1) and ICF type 2 (ICF2). Mutations in DNMT3B gene are responsible for ICF1, while mutations in ZBTB24 have been reported to be responsible for ICF2. In this study, we describe a Lebanese family with three ICF2 affected brothers. Sanger sequencing of the coding sequence of ZBTB24 gene was conducted and revealed a novel deletion: c.396_397delTA (p.His132Glnfs*19), resulting in a loss-of-function of the corresponding protein. ZBTB24 belongs to a large family of transcriptional factors and may be involved in DNA methylation of juxtacentromeric DNA. Detailed molecular and functional studies of the ZBTB24 and DNMT3B genes are needed to understand the pathophysiology of ICF syndrome.

Mild Campomelic Dysplasia: Report on a Case and Review.

We report on a 10.5-year-old girl with a mild form of campomelic dysplasia. She presented with short stature of prenatal onset, dysmorphic facial features, limitation of supination and pronation of the forearms, dysplastic nails, and bone abnormalities consisting especially of cone-shaped epiphyses of the middle phalanx of the 2nd fingers, brachydactyly and clinodactyly of the middle phalanx of both 5th fingers, short 4th metacarpals, radial and femoral head subluxation, hypoplastic scapulae, humeral and ulnar epiphyseal abnormalities, unossified symphysis pubis, and a significant delay in bone age. Molecular analysis of the SOX9 gene revealed the presence of a de novo missense mutation: p.P170L (c.509C>T). Mild and surviving cases of campomelic dysplasia are reviewed.

Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes.

Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region.

Microalbuminuria versus brain natriuretic peptide in cardiac hypertrophy of hypertensive rats.

The objective of this study was to assess a possible link between microalbuminuria (MA), a major risk factor of the cardiorenal syndrome and the brain natriuretic peptide (BNP), a marker of cardiac hypertrophy. Two kidney-one clip (2K-1C) renovascular hypertension was induced in 24 male Wistar rats (weighing 220-250 g). Rats were randomized into four groups for 8 weeks: Sham, not treated; Bos, treated with bosentan; Cap, treated with captopril; Bos/Cap, treated with both drugs. Blood pressure, plasma BNP and transforming growth factor beta1 (TGF-ß1) concentrations, microalbuminuria and creatininemia as well as cardiac mass, BNP, alpha- and beta-myosin heavy chain (MHC) gene expression and kidney histology were determined. Following stenosis, Sham rats developed hypertension (p < 0.001), an increase in BNP (p < 0.05) and TGF-ß1 (p < 0.005) concentrations, creatinine levels (p < 0.001), and urinary albumin (p < 0.001). Under drug treatment, decreases in blood pressure (p < 0.001), creatinine levels (p < 0.05), plasma TGF-ß1 (p < 0.005) and BNP (p < 0.05) concentrations, were concomitant with the absence of MA which was significantly correlated with reductions in cardiac mass (p < 0.05) and hypertrophy markers (BNP and ß-MHC gene expression) (p < 0.005) as well as in renal fibrosis. These findings suggest a potential link between microalbuminuria evolution and BNP as well as a possible effect of microalbuminuria-lowering therapy on halting the progression, or even inducing the regression of cardiac hypertrophy.

Stüve-Wiedemann syndrome: long-term follow-up and genetic heterogeneity.

Stüve-Wiedemann syndrome (SWS, OMIM 601559) is a severe autosomal recessive condition caused by mutations in the leukemia inhibitory receptor (LIFR) gene. The main characteristic features are bowing of the long bones, neonatal respiratory distress, swallowing/sucking difficulties and dysautonomia symptoms including temperature instability often leading to death in the first years of life. We report here four patients with SWS who have survived beyond 36 months of age with no LIFR mutation. These patients have been compared with six unreported SWS survivors carrying null LIFR mutations. We provide evidence of clinical homogeneity of the syndrome in spite of the genetic heterogeneity.

Identification of 28 novel mutations in the Bardet-Biedl syndrome genes: the burden of private mutations in an extensively heterogeneous disease.

Bardet-Biedl syndrome (BBS), an emblematic disease in the rapidly evolving field of ciliopathies, is characterized by pleiotropic clinical features and extensive genetic heterogeneity. To date, 14 BBS genes have been identified, 3 of which have been found mutated only in a single BBS family each (BBS11/TRIM32, BBS13/MKS1 and BBS14/MKS4/NPHP6). Previous reports of systematic mutation detection in large cohorts of BBS families (n > 90) have dealt only with a single gene, or at most small subsets of the known BBS genes. Here we report extensive analysis of a cohort of 174 BBS families for 12/14 genes, leading to the identification of 28 novel mutations. Two pathogenic mutations in a single gene have been found in 117 families, and a single heterozygous mutation in 17 families (of which 8 involve the BBS1 recurrent mutation, M390R). We confirm that BBS1 and BBS10 are the most frequently mutated genes, followed by BBS12. No mutations have been found in BBS11/TRIM32, the identification of which as a BBS gene only relies on a single missense mutation in a single consanguineous family. While a third variant allele has been observed in a few families, they are in most cases missenses of uncertain pathogenicity, contrasting with the type of mutations observed as two alleles in a single gene. We discuss the various strategies for diagnostic mutation detection, including homozygosity mapping and targeted arrays for the detection of previously reported mutations.

Expanding the clinical and neuroradiologic phenotype of primary microcephaly due to ASPM mutations.

OBJECTIVE: To determine the spectrum of clinical, neuropsychological, and neuroradiologic features in patients with autosomal recessive primary microcephaly (MCPH) due to ASPM gene mutations. METHODS: ASPM was sequenced in 52 unrelated MCPH probands. In patients with ASPM mutations, we evaluated the clinical phenotype, cognition, behavior, brain MRI, and family. RESULTS: We found homozygous or compound heterozygous ASPM loss-of-function mutations in 11 (22%) probands and 5 siblings. The probands harbored 18 different mutations, of which 16 were new. Microcephaly was severe after 1 year of age in all 16 patients, although in 4 patients the occipital-frontal circumference (OFC) at birth was decreased by only 2 SD. The OFC Z score consistently decreased after birth. Late-onset seizures occurred in 3 patients and significant pyramidal tract involvement in 1 patient. Intellectual quotients ranged from borderline-normal to severe mental retardation. Mild motor delay was noted in 7/16 patients. Language development was delayed in all patients older than 3 years. Brain MRI (n = 12) showed a simplified gyral pattern in 9 patients and several malformations including ventricle enlargement (n = 7), partial corpus callosum agenesis (n = 3), mild cerebellar hypoplasia (n = 1), focal cortical dysplasia (n = 1), and unilateral polymicrogyria (n = 1). Non-neurologic abnormalities consisted of short stature (n = 1), idiopathic premature puberty (n = 1), and renal dysplasia (n = 1). CONCLUSIONS: We provide a detailed description of features associated with ASPM mutations. Borderline microcephaly at birth, borderline-normal intellectual efficiency, and brain malformations can occur in ASPM-related primary hereditary microcephaly.

Recessive osteogenesis imperfecta caused by LEPRE1 mutations: clinical documentation and identification of the splice form responsible for prolyl 3-hydroxylation.

BACKGROUND: Recessive forms of osteogenesis imperfecta (OI) may be caused by mutations in LEPRE1, encoding prolyl 3-hydroxylase-1 (P3H1) or in CRTAP, encoding cartilage associated protein. These proteins constitute together with cyclophilin B (CyPB) the prolyl 3-hydroxylation complex that hydroxylates the Pro986 residue in both the type I and type II collagen alpha1-chains. METHODS: We screened LEPRE1, CRTAP and PPIB (encoding CyPB) in a European/Middle Eastern cohort of 20 lethal/severe OI patients without a type I collagen mutation. RESULTS: Four novel homozygous and compound heterozygous mutations were identified in LEPRE1 in four probands. Two probands survived the neonatal period, including one patient who is the eldest reported patient (17 7/12 years) so far with P3H1 deficiency. At birth, clinical and radiologic features were hardly distinguishable from those in patients with autosomal dominant (AD) severe/lethal OI. Follow-up data reveal that the longer lived patients develop a severe osteochondrodysplasia that overlaps with, but has some distinctive features from, AD OI. A new splice site mutation was identified in two of the four probands, affecting only one of three LEPRE1 mRNA splice forms, detected in this study. The affected splice form encodes a 736 amino acid (AA) protein with a "KDEL" endoplasmic reticulum retention signal. While western blotting and immunocytochemical analysis of fibroblast cultures revealed absence of this P3H1 protein, mass spectrometry and SDS-urea-PAGE data showed severe reduction of alpha1(I)Pro986 3-hydroxylation and overmodification of type I (pro)collagen chains in skin fibroblasts of the patients. CONCLUSION: These findings suggest that the 3-hydroxylation function of P3H1 is restricted to the 736AA splice form.

International cooperation in the expansion of a newborn screening programme in Lebanon: a possible model for other programmes.

Tandem mass spectrometry (MS/MS) is rapidly gaining support, even in less-developed nations, as the method of choice for the newborn screening of metabolic disorders, although difficulties in acquiring this technology may at times be major obstacles in several Middle East and North Africa (MENA) countries. In Lebanon, international cooperation allowed this acquisition at the Newborn Screening Laboratory (NSL) of the Saint Joseph University (USJ) in the capital city of Beirut. NSL is currently screening up to 20% of all newborns in Lebanon. The expansion was made possible through initial collaboration with the Metabolic Laboratory at the Hamburg University Medical Center (HUMC) and subsequently with other centres. During phase I of the expansion (2006-2007), blood spots were shipped to HUMC with rapid couriers twice a week and electronic reports were sent back generally within 4 days after shipment. Positive cases were recalled to NSL and new specimens were sent back for confirmation at HUMC. During that first phase, the Beirut staff received training at the HUMC and in other centres. Phase II was a transitory period of 4 months during which machines were installed in Beirut and working procedures were adopted and documented. The activity has now entered a consolidation phase (Phase III) in which all measurements are exclusively performed in Beirut while HUMC acts as a backup centre. International cooperation remains crucial for periodic quality assurance procedures, and for supporting the transformation of the USJ-NSL into a training centre able to transfer MS/MS technology to the MENA region.

A novel locus for autosomal recessive primary torsion dystonia (DYT17) maps to 20p11.22-q13.12.

Primary torsion dystonia is a clinically and genetically heterogeneous group of movement disorders. Fifteen different types of dystonia have been described to date, of whom 14 loci have been mapped, but only seven genes identified. Several different modes of inheritance have been described, including autosomal dominant transmission with reduced penetrance (12 loci), recessive X-linked (one locus), and autosomal recessive transmission (three loci). In this study, we describe the localization of a novel form of autosomal recessive, primary focal torsion dystonia using a genomewide search in a large consanguineous Lebanese family with three affected individuals. Homozygosity mapping with 382 microsatellite markers was conducted. Linkage analysis and haplotype construction allowed us to identify a novel locus designated as DYT17, within a 20.5-Mb interval on chromosome 20. Of the 270 known genes spread on this interval, 27 candidate genes were tested and excluded as responsible for the disease. Fine mapping by identification of other dystonia families linked to chromosome 20 and sequencing of candidate genes in the refined interval is required in order to identify the causative gene in DYT17.

Molecular analysis of F8 in Lebanese haemophilia A patients: novel mutations and phenotype-genotype correlation.

Haemophilia A (HA) is an X-linked recessive hereditary bleeding disorder affecting one in 5000 men, resulting from mutations in the F8 gene. Our objective was to identify the spectrum of mutations of the F8 gene in Lebanese patients, and to perform genotype/phenotype correlations. A group of 79 HA patients from 55 unrelated families was studied. Patients were screened for intron 22 and intron 1 inversion using PCR. In the absence of mutations in both introns, a dHPLC screening followed by a DNA sequencing of all coding regions was performed. When patients presented novel mutations, 150 control chromosomes were tested to exclude common polymorphisms. Large deletions were confirmed by MLPA technique. The mRNA was specifically studied whenever a splice site mutation was detected. In addition, studies of the putative biochemical function and FVIII 3D structures were conducted. Thirty-four mutations were identified in this study of which 21 were novel: 11 missense, two nonsense, two splice sites, five small deletions and one large deletion. Inhibitor found in three over 75 patients correlated with large deletion, intron 22 inversion, and nonsense mutations. We were able to identify all causative mutations in those HA patients. This knowledge represents a huge step for genetic counselling.

[Mirror hand deformity: a new phenotype with literature review]. / Main en miroir: une nouvelle forme avec revue de la littérature.

We report the case of a child who presented polydactyly with eight triphalangeal fingers, no thumb or radius and ulnar dimelia. Hand, wrist, forearm and elbow function was compromised, particularly due to wrist stiffness in flexion, the absence of forearm pronation supination and severe limitation of elbow motion. In addition, the child underwent surgery for pyloric hypertrophy and also presented a multicystic kidney. We present the clinical, anatomic, electromyographic, genetic and therapeutic aspects of this rare deformity and discuss data presented in the literature.