Jionoside A1 alleviates ischemic stroke ischemia/reperfusion injury by promoting Nix-mediated mitophagy.

In ischemia-reperfusion injury in ischemic stroke, mitophagy, which can remove damaged mitochondria, reduce cytotoxic damage, and enhance neurological recovery, is crucial. Jionoside A1 is a substance found in the traditional Chinese herb Rehmannia glutinosa, which may have neuroprotective effects. The fundamental objective of this work was to find out Jionoside A1's contribution to ischemia/reperfusion injury in ischemic stroke. The oxygen-glucose deprivation/reperfusion (OGD-Rep) model and the right transient middle cerebral artery occlusion (tMCAO) model were established. Jionoside A1 was used for treatment. We utilized a tiny interfering RNA (siRNA) to lower Nix expression. The results suggest that Jionoside A1 may reduce ischemic stroke. By lowering the consequences of ischemia/reperfusion injury, Rehmannia glutinosa can be utilized to treat ischemic stroke. These discoveries provide fresh experimental information for the investigation of ischemic stroke ischemia/reperfusion injury and provide some theoretical justification for their application.

[Evidence mapping of clinical research on 28 Chinese patent medicines for tension-type headache].

In this study, the evidence mapping methodology was used to systematically retrieve and sort out the clinical research evidence of Chinese patent medicines in the treatment of tension-type headache(TTH), and to understand the distribution of evidence in this field and the basis and quality of evidence. Chinese and English articles on the 28 Chinese patent medicines for TTH, which were recorded in National Essential Medicines List(2018), Medicine Catalogue for National Basic Medical Insurance, Work Injury Insurance, and Maternity Insurance(2020), and Chinese Pharmacopoeia(2020), were retrieved from China National Knowledge Infrastructure(CNKI), Wanfang, VIP, China Biology Medicine disc(CBMdisc), PubMed, EMbase, and Cochrane Library from the establishment to June 2021, followed by descriptive analysis. Then, tables and bubble charts were plotted to analyze the distribution characteristics of evidence. A total of 129 eligible articles were yielded: 126 randomized/non-randomized controlled trials, and 3 systematic reviews. The functions, indications, and composition of the 28 medicines, as well as the proportion of related articles, publication trends, intervention measures, and outcome indicators were compared and analyzed. The results showed that the 28 Chinese patent medicines, composed of 128 Chinese medicinals, can be classified into six categories in terms of function: reinforcing healthy Qi, tranquilizing mind, dispelling stasis, regulating Qi, treating wind, and resuscitating. There are ongoing efforts to study the treatment of TTH with Chinese patent medicine in China, despite of little evidence. The clinical positioning of Chinese patent medicine for TTH is not clear, and clinical research fails to highlight the advantages of Chinese medicine. In addition, the outcome indicators have not been standardized and unified, and there is a lack of evidence on the long-term efficacy of Chinese patent medicine for TTH. This study is the first exploratory application of evidence maps to compare the characteristics and clinical research progress of 28 Chinese patent medicines for TTH, which can provide a reference for research on the optimization of Chinese medicine strategies for TTH.

Increased expression of DOC2A in human and rat temporal lobe epilepsy.

Temporal lobe epilepsy (TLE) is the most common form of intractable epilepsy. Currently, the molecular mechanisms underlying epileptogenesis in TLE remain elusive; however, synaptic transmission may play an important role in the pathogenesis of epilepsy. Synaptic transmission is regulated by diverse mechanisms, including presynaptic modulators of synaptic vesicle formation and release, modulators of neurotransmission and distinct Ca2+ sensors. DOC2A, a novel Ca2+ sensor, can regulate spontaneous synaptic transmission and has been implicated in Ca2+-dependent neurotransmitter release. In this study, we demonstrate for the first time that DOC2A expression is significantly increased in human TLE and in two different rat models of TLE (pilocarpine- and kindling-induced) compared to the control groups. Localization of DOC2A in the human TLE patients and pilocarpine post-SE rat model was observed in neurons but not in astrocytes; DOC2A was also concentrated at the presynaptic terminals and colocalized with VMAT2. Our results suggest that the abnormal protein expression of DOC2A in epileptic brain tissue may play an important role in epilepsy.

Recurrent Headache Increases Blood-Brain Barrier Permeability and VEGF Expression in Rats.

BACKGROUND: The blood-brain barrier (BBB) is an important anatomical structure of the central nervous system (CNS) that limits the penetration of a variety of substances from the blood into the parenchyma. Dysfunction of the BBB is involved in various CNS disorders, including stroke, inflammation, and pain. However, the evidence concerning its role in migraine is insufficient. OBJECTIVE: This study will investigate whether recurrent headache increases BBB permeability and vascular endothelial growth factor (VEGF) expression in a rat model. STUDY DESIGN: This study used an experimental design. SETTING: The research took place in the Laboratory Research Center at The First Affiliated Hospital of Chongqing Medical University. METHODS: Eighty male Sprague-Dawley rats were randomly divided into 3 groups: inflammatory soup (IS), control (PBS), and treatment (IS+Sumatriptan) groups. Recurrent headache was induced by episodic IS stimulation: 20 µL of IS were pumped into the dura 3 times per week in rats. The control group was administered 20 µL of PBS. The rats in the treatment group were simultaneously treated with sumatriptan (300 ug/kg, intraperitoneal) at the same time that IS was applied to the dura. Mechanical nociceptive thresholds were examined by electronic von Frey filaments with rigid tips. BBB permeability changes were measured with Evans blue (EB). The expression of VEGF was measured by double labeling and Western blotting. RESULTS: After 4 IS applications, the mechanical nociceptive thresholds significantly decreased. In addition, the mechanical hypersensitivity persisted for 4 hours after 9 applications. Only after 9 applications did the BBB permeability increase, as demonstrated by the EB tracer. The BBB disruption was accompanied by an elevation in VEGF expression. Sumatriptan treatment significantly reduced the mechanical hypersensitivity induced by IS stimulations and decreased the BBB disruption and VEGF expression. LIMITATIONS: Potential mechanisms that underlie the relationship between BBB and VEGF were not examined in this study. CONCLUSIONS: The present study showed that repeated IS stimulations induced long-lasting allodynia, increased BBB permeability, and upregulated VEGF expression, all of which could be attenuated by early sumatriptan treatment. KEY WORDS: Migraine, inflammatory soup, blood-brain barrier, vascular endothelial growth factor, sumatriptan.

Myeloid differentiation factor 88 is up-regulated in epileptic brain and contributes to experimental seizures in rats.

Accumulating evidence supports that activation of inflammatory pathways is a crucial factor contributing to the pathogenesis of seizures. In particular, the activation of interleukin-1 beta (IL-1ß) system exerts proconvulsant effects in a large variety of seizure models. Myeloid differentiation factor 88 (MyD88) is a critical adaptor protein in the signaling cascade elicited by IL-1ß. The present study aimed to investigate the expression pattern of MyD88 in rat models of seizures and in patients with refractory temporal lobe epilepsy (TLE), and to study the role of MyD88 in epileptic seizures. Our results revealed that MyD88 was up-regulated in the hippocampus of rats in the lithium-pilocarpine model of acute seizures. Importantly, MyD88 overexpression was also significantly present in the brain from chronic epileptic rats and the temporal neocortex specimens from drug-resistant TLE patients. In the acute seizure model, both the behavioral and electrographic seizure activities were record and analyzed in rats for 90min, starting immediately after pilocarpine injection. ST2825, a synthetic MyD88 inhibitor, was administered intracerebroventricularly (2.5-5.0-10µg in 2µl) 20min before pilocarpine injection. We found that ST2825 at doses of 5µg and 10µg significantly inhibited the pilocarpine-induced behavioral and electrographic seizures. Moreover, 10µg ST2825 prevented the proconvulsant actions of IL-1ß. As previous evidence suggested that IL-1ß proconvulsant effects was mediated by enhancing the phosphorylation level of the NR2B subunit of N-methyl-d-aspartate (NMDA) receptor, we then probed whether this molecular was involved in the effect of the pharmacological inhibition. Our results revealed that 10µg ST2825 markedly reversed the increased Tyr1472-phosphorylation of the NR2B subunit of NMDA receptor observed in the proconvulsant conditions of IL-1ß and in seizures induced by pilocarpine alone. These findings indicate that altered expression of MyD88 might contribute to the pathogenesis of seizures and targeting of this adaptor protein might represent a novel therapeutic strategy to suppress seizure activities.

Lentiviral Vector-Induced Overexpression of RGMa in the Hippocampus Suppresses Seizures and Mossy Fiber Sprouting.

Repulsive guidance molecule a (RGMa) is a membrane-bound protein that inhibits axon outgrowth in the central nervous system. Temporal lobe epilepsy (TLE) is a common neurological disorder characterized by recurrent spontaneous seizures. To explore the role of RGMa in epilepsy, we investigated the expression of RGMa in patients with TLE, pilocarpine-induced rat model, and pentylenetetrazol kindling model of epilepsy, and then we performed behavioral, histological, and electrophysiological analysis by lentivirus-mediated overexpression of RGMa in the hippocampus of animal model. We found that RGMa was significantly decreased in TLE patients and in experimental rats from 6 h to 60 days after pilocarpine-induced seizures. In two types of epileptic animal models, pilocarpine-induced model and pentylenetetrazol kindling model, overexpression of RGMa in the hippocampus of rats exerted seizure-suppressant effects. The reduced spontaneous seizures were accompanied by attenuation of hippocampal mossy fiber sprouting. In addition, overexpression of RGMa inhibited hyperexcitability of hippocampal neurons via suppressing NMDAR-mediated currents in Mg2+-free-induced organotypic slice model. Collectively, these results demonstrate that overexpression of RGMa could be an alternative strategy for epilepsy therapy.

Dock3 Participate in Epileptogenesis Through rac1 Pathway in Animal Models.

Epilepsy is one of the most common and severe neurologic diseases. The mechanisms of epilepsy are still not fully understood. Dock3 (dedicator of cytokinesis 3) is one of the new kinds of guanine-nucleotide exchange factors (GEF) and plays an important role in neuronal synaptic plasticity and cytoskeleton rearrangement; the same mechanisms were also found in epilepsy. However, little is known regarding the expression of Dock3 in the epileptic brain and whether Dock3 interventions affect the epileptic process. In this study, we showed that the expression of Dock3 significantly increased in IE patients and a lithium-pilocarpine epilepsy model compared with the controls. Inhibition of Dock3 by Dock3 shRNA impaired the severity of status epilepticus in the acute stage and decreased the spontaneous recurrent seizures times in the chronic stage of lithium-pilocarpine model and decreased the expression of rac1-GTP. Consistent with decreased expression of Dock3, the latent period in a pentylenetetrazole kindling model also increased. Our results demonstrated that the increased expression of Dock3 in the brain is associated with epileptogenesis and specific inhibition of Dock3 may be a potential target in preventing the development of epilepsy in patients.

Downregulation of nitrogen permease regulator like-2 activates PDK1-AKT1 and contributes to the malignant growth of glioma cells.

Nitrogen permease regulator like-2(NPRL2) is a candidate tumor suppressor gene(TSG) located on chromosome 3p21.3 and deletions frequently occur in this region, leading to canceration. Recently, molecular pathologic researches have provided valuable insights into the downregulation of NPRL2 in carcinogenesis in some types of cancers. However, very little is known about genetic changes of NPRL2 involved in glioma. Here, for the first time, we aimed to understand the expression levels, functions and mechanisms of NPRL2 for progression of glioma. We clearly demonstrated that NPRL2 expression was decreased in glioma and was negatively correlated with the histologic grade. The upregulation of NPRL2 expression in glioma cells inhibited proliferation by inducing G0/G1 cell cycle arrest in vitro and suppressed the growth of xenotransplanted tumors. In contrast, siRNA-mediated knockdown of NPRL2 promoted glioma growth. The anti-cancer effects of NPRL2 were involved in dephosphorylation of PDK1Tyr9 and downstream AKT1Thr308 resulting in inactivation of the PDK1-AKT1 signaling pathway, this ultimately increased the expression of p21 and p27, and inactivated CDK2 and CDK4. Our data confirmed NPRL2 was downregulated in gliomas. More importantly, NPRL2 was able to inhibit cell proliferation in vitro and repress tumorigenicity in vivo, suggesting its role as a tumor suppressor. Our data provide a basis for the further development of a promising therapeutic target for glioma. © 2015 Wiley Periodicals, Inc.

The Brain Activity in Brodmann Area 17: A Potential Bio-Marker to Predict Patient Responses to Antiepileptic Drugs.

In this study, we aimed to predict newly diagnosed patient responses to antiepileptic drugs (AEDs) using resting-state functional magnetic resonance imaging tools to explore changes in spontaneous brain activity. We recruited 21 newly diagnosed epileptic patients, 8 drug-resistant (DR) patients, 11 well-healed (WH) patients, and 13 healthy controls. After a 12-month follow-up, 11 newly diagnosed epileptic patients who showed a poor response to AEDs were placed into the seizures uncontrolled (SUC) group, while 10 patients were enrolled in the seizure-controlled (SC) group. By calculating the amplitude of fractional low-frequency fluctuations (fALFF) of blood oxygen level-dependent signals to measure brain activity during rest, we found that the SUC patients showed increased activity in the bilateral occipital lobe, particularly in the cuneus and lingual gyrus compared with the SC group and healthy controls. Interestingly, DR patients also showed increased activity in the identical cuneus and lingual gyrus regions, which comprise Brodmann's area 17 (BA17), compared with the SUC patients; however, these abnormalities were not observed in SC and WH patients. The receiver operating characteristic (ROC) curves indicated that the fALFF value of BA17 could differentiate SUC patients from SC patients and healthy controls with sufficient sensitivity and specificity prior to the administration of medication. Functional connectivity analysis was subsequently performed to evaluate the difference in connectivity between BA17 and other brain regions in the SUC, SC and control groups. Regions nearby the cuneus and lingual gyrus were found positive connectivity increased changes or positive connectivity changes with BA17 in the SUC patients, while remarkably negative connectivity increased changes or positive connectivity decreased changes were found in the SC patients. Additionally, default mode network (DMN) regions showed negative connectivity increased changes or negative changes with BA17 in the SUC patients. The abnormal increased in BA17 activity may be a key point that plays a substantial role in facilitating seizure onset.

Insulin growth factor-1 (IGF-1) enhances hippocampal excitatory and seizure activity through IGF-1 receptor-mediated mechanisms in the epileptic brain.

Insulin-like growth factor-1 (IGF-1) is known to promote neurogenesis and survival. However, recent studies have suggested that IGF-1 regulates neuronal firing and excitatory neurotransmission. In the present study, focusing on temporal lobe epilepsy, we found that IGF-1 levels and IGF-1 receptor activation are increased in human epileptogenic tissues, and pilocarpine- and pentylenetetrazole-treated rat models. Using an acute model of seizures, we showed that lateral cerebroventricular infusion of IGF-1 elevates IGF-1 receptor (IGF-1R) signalling before pilocarpine application had proconvulsant effects. In vivo electroencephalogram recordings and power spectrogram analysis of local field potential revealed that IGF-1 promotes epileptiform activities. This effect is diminished by co-application of an IGF-1R inhibitor. In an in vitro electrophysiological study, we demonstrated that IGF-1 enhancement of excitatory neurotransmission and α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptor- and N-methyl-D-aspartate receptor-mediated currents is inhibited by IGF-1R inhibitor. Finally, activation of extracellular signal-related kinase (ERK)-1/2 and protein kinase B (Akt) in seizures in rats is increased by exogenous IGF-1 and diminished by picropodophyllin. A behavioural study reveals that the ERK1/2 or Akt inhibitor attenuates seizure activity. These results indicate that increased IGF-1 levels after recurrent hippocampal neuronal firings might, in turn, promote seizure activity via IGF-1R-dependent mechanisms. The present study presents a previously unappreciated role of IGF-1R in the development of seizure activity.

Elevated Expression of the Delta-Subunit of Epithelial Sodium Channel in Temporal Lobe Epilepsy Patients and Rat Model.

Epilepsy is one of the most common, chronic, neurological diseases. The pathology of epilepsy is based on abnormal synchronization of neuronal discharges. Epithelial sodium channels, which are constitutively active, non-voltage-gated, highly selective sodium channels belonging to the epithelial sodium channel/degenerin (ENaC/deg) family, contribute to resting membrane potential modulation and subsequent neuronal excitability by providing a sodium influx pathway. Different from the other three subunits, δ ENaC expression is prominent in the human brain cortex and restricted to neurons. The aim of this study was to investigate the expression pattern of δ ENaC in patients with temporal lobe epilepsy (TLE) and in a pilocarpine-induced rat model of epilepsy. Adopting immunohistochemistry, immunofluorescence, and western blot analysis, we found that δ ENaC was restricted to neurons in the temporal neocortices of TLE patients and the cortices and hippocampus of pilocarpine-induced epilepsy rats, which were similar to the corresponding controls. However, δ ENaC expression was significantly elevated in TLE patients and the pilocarpine-induced epileptic rats. The physiological role, the unchanged localization, and the elevated expression of δ ENaC suggested it could play an important role in epilepsy.

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.