ABSTRACT
Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.
ABSTRACT
Garlic (Allium sativum L.) can be infected by several viruses of the genera Allexivirus, Carlavirus, and Potyvirus (3). Garlic common latent virus (GarCLV) and Shallot latent virus (SLV) are the most important Carlavirus species infecting garlic, but only GarCLV has been described on garlic in Brazil. Seven hundred thirty-one samples of garlic showing mosaic symptoms and chlorotic streaking were collected from the states of São Paulo (São Manuel), Minas Gerais (Santa Juliana and São Gotardo), Goiás (Campo Alegre and Ipameri), and Paraná (Guarapuava and Piraquara) from April 2008 to July 2009 and analyzed by double-antibody sandwich (DAS)-ELISA for the presence of GarCLV and SLV using specific antiserum for SLV and GarCLV according to the manufacturer's protocol (Agdia Inc., Elkhart, IN). Cultivars sampled were Caçador, Chonan, Ito, Jonas, Quitéria, and Tropical. Fifty-five samples (7.5% of 731) tested positive for GarCLV, and none of the samples tested positive for SLV. Total RNA was extracted (2) from 15 samples that represented different states of production and used with primers SLV 7044 (5'-CTTTTGGTTCACTTTAGG-3') and SLV 8004 (5'-GCACGCAATAGTCTACGG-3'), designed in this study, to detect SLV in a one-step reverse transcription (RT)-PCR assay. Only 3 of the 15 samples, two from São Paulo and one from Paraná State, produced a 960-bp fragment covering the putative coat protein gene (ORF 5) (1) of SLV. The amplicons of the three isolates were sequenced. A nucleotide sequence identity of 91 to 92% was detected in comparison with two strains of SLV (GenBank Accession Nos. AB004567 and DQ520093), indicating the presence of two isolates of SLV in São Manuel (São Paulo State) and one in Piraquara, Paraná State (submitted to GenBank as Accession Nos. GU120176, HQ128602, and GU120175, respectively). To confirm identity of the virus, another pair of primers was constructed and tested (SLV 6737: 5'-YCCSGCCARGAAYTTCCC-3', and SLV 7060: 5'-TTAGAGCGCTGTWAACC-3'), from which a 340-bp fragment covering a portion of TGB2 (ORF 3) and TGB3 (ORF 4) (1) was amplified using the two isolates from São Paulo (GenBank Accession Nos. HQ123181 and HQ123182, respectively). The amplicon sequences shared 87% identity with that of an SLV isolate (Accession No. AJ292226), which confirmed the presence of SLV. The low titer of SLV in garlic might account for the false negative results by DAS-ELISA. The source of cultivated garlic bulbs in these regions of Brazil is unknown. Garlic cloves have been cultivated in São Manuel for approximately 15 years, indicating that SLV may have been present in Brazil for many years. To our knowledge, this is the first report of SLV in Brazil. References: (1) M. J. Adams et al. Virus Taxonomy: 8th Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, 2005. (2) Y. D. Bertheau et al. Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolff, eds. Scottish Crop Research Institute, Dundee, U.K., 1998. (3) T. V. M. Fajardo et al. Fitopatol. Bras. 26:619, 2001.
ABSTRACT
A virus was isolated from joyweed (Alternanthera tenella Colla-Amaranthaceae), a common weed in tropical and sub-tropical regions. Examination by electron microscopy showed long flexuous particles with an average length of 756 nm in crude sap. Serological results showed positive reaction with antisera to PVY-O. A fragment of 1772 nucleotides was sequenced. The CP sequence shares 76% of identity with the CP of Potato virus Y strain NTN. These results confirm that the virus is a new potyvirus infecting A. tenella, and the name Alternanthera mild mosaic virus (AltMMV) is proposed.
