Synthetic Approaches to Novel Human Carbonic Anhydrase Isoform Inhibitors Based on Pyrrol-2-one Moiety.

New dihydro-pyrrol-2-one compounds, featuring dual sulfonamide groups, were synthesized through a one-pot, three-component approach utilizing trifluoroacetic acid as a catalyst. Computational analysis using density functional theory (DFT) and condensed Fukui function explored the structure-reactivity relationship. Evaluation against human carbonic anhydrase isoforms (hCA I, II, IX, XII) revealed potent inhibition. The widely expressed cytosolic hCA I was inhibited across a range of concentrations (KI 3.9-870.9 nM). hCA II, also cytosolic, exhibited good inhibition as well. Notably, all compounds effectively inhibited tumor-associated hCA IX (KI 1.9-211.2 nM) and hCA XII (low nanomolar). Biological assessments on MCF7 cancer cells highlighted the compounds' ability, in conjunction with doxorubicin, to significantly impact tumor cell viability. These findings underscore the potential therapeutic relevance of the synthesized compounds in cancer treatment.

Exploring the Impact of Nitrogen Doping on the Optical Properties of Carbon Dots Synthesized from Citric Acid.

The differences between bare carbon dots (CDs) and nitrogen-doped CDs synthesized from citric acid as a precursor are investigated, aiming at understanding the mechanisms of emission and the role of the doping atoms in shaping the optical properties. Despite their appealing emissive features, the origin of the peculiar excitation-dependent luminescence in doped CDs is still debated and intensively being examined. This study focuses on the identification of intrinsic and extrinsic emissive centers by using a multi-technique experimental approach and computational chemistry simulations. As compared to bare CDs, nitrogen doping causes the decrease in the relative content of O-containing functional groups and the formation of both N-related molecular and surface centers that enhance the quantum yield of the material. The optical analysis suggests that the main emission in undoped nanoparticles comes from low-efficient blue centers bonded to the carbogenic core, eventually with surface-attached carbonyl groups, the contribution in the green range being possibly related to larger aromatic domains. On the other hand, the emission features of N-doped CDs are mainly due to the presence of N-related molecules, with the computed absorption transitions calling for imidic rings fused to the carbogenic core as the potential structures for the emission in the green range.

Sulphur vs NH Group: Effects on the CO2 Electroreduction Capability of Phenylenediamine-Cp Cobalt Complexes.

The cobalt complex (I) with cyclopentadienyl and 2-aminothiophenolate ligands was investigated as a homogeneous catalyst for electrochemical CO2 reduction. By comparing its behavior with an analogous complex with the phenylenediamine (II), the effect of sulfur atom as a substituent has been evaluated. As a result, a positive shift of the reduction potential and the reversibility of the corresponding redox process have been observed, also suggesting a higher stability of the compound with sulfur. Under anhydrous conditions, complex I showed a higher current enhancement in the presence of CO2 (9.41) in comparison with II (4.12). Moreover, the presence of only one -NH group in I explained the difference in the observed increases on the catalytic activity toward CO2 due to the presence of water, with current enhancements of 22.73 and 24.40 for I and II, respectively. DFT calculations confirmed the effect of sulfur on the lowering of the energy of the frontier orbitals of I, highlighted by electrochemical measurements. Furthermore, the condensed Fukui function f - values agreed very well with the current enhancement observed in the absence of water.

Selecting molecular or surface centers in carbon dots-silica hybrids to tune the optical emission: A photo-physics study down to the atomistic level.

In this work, we unveil the fluorescence features of citric acid and urea-based Carbon Dots (CDs) through a photo-physical characterization of nanoparticles synthesized, under solvent-free and open-air conditions, within silica-ordered mesoporous silica, as a potential host for solid-state emitting hybrids. Compared to CDs synthesized without silica matrices and dispersed in water, silica-CD hybrids display a broader emission in the green range whose contribution can be increased by UV and blue laser irradiation. The analysis of hybrids synthesized within different silica (MCM-48 and SBA-15) calls for an active role of the matrix in directing the synthesis toward the formation of CDs with a larger content of graphitic N and imidic groups at the expense of N-pyridinic molecules. As a result, CDs tuned in size and with a larger green emission are obtained in the hybrids and are retained once extracted from the silica matrix and dispersed in water. The kinetics of the photo-physics under UV and blue irradiation of hybrid samples show a photo-assisted formation process leading to a further increase of the relative contribution of the green emission, not observed in the water-dispersed reference samples, suggesting that the porous matrix is involved also in the photo-activated process. Finally, we carried out DFT and TD-DFT calculations on the interaction of silica with selected models of CD emitting centers, like surface functional groups (OH and COOH), dopants (graphitic N), and citric acid-based molecules. The combined experimental and theoretical results clearly indicate the presence of molecular species and surface centers both emitting in the blue and green spectral range, whose relative contribution is tuned by the interaction with the surrounding media.

Towards an optimal monoclonal antibody with higher binding affinity to the receptor-binding domain of SARS-CoV-2 spike proteins from different variants.

A highly efficient and robust multiple scales in silico protocol, consisting of atomistic Molecular Dynamics (MD), coarse-grain (CG) MD, and constant-pH CG Monte Carlo (MC), has been developed and used to study the binding affinities of selected antigen-binding fragments of the monoclonal antibody (mAbs) CR3022 and several of its here optimized versions against 11 SARS-CoV-2 variants including the wild type. Totally 235,000 mAbs structures were initially generated using the RosettaAntibodyDesign software, resulting in top 10 scored CR3022-like-RBD complexes with critical mutations and compared to the native one, all having the potential to block virus-host cell interaction. Of these 10 finalists, two candidates were further identified in the CG simulations to be the best against all SARS-CoV-2 variants. Surprisingly, all 10 candidates and the native CR3022 exhibited a higher affinity for the Omicron variant despite its highest number of mutations. The multiscale protocol gives us a powerful rational tool to design efficient mAbs. The electrostatic interactions play a crucial role and appear to be controlling the affinity and complex building. Studied mAbs carrying a more negative total net charge show a higher affinity. Structural determinants could be identified in atomistic simulations and their roles are discussed in detail to further hint at a strategy for designing the best RBD binder. Although the SARS-CoV-2 was specifically targeted in this work, our approach is generally suitable for many diseases and viral and bacterial pathogens, leukemia, cancer, multiple sclerosis, rheumatoid, arthritis, lupus, and more.

MD simulations explain the excess molar enthalpies in pseudo-binary mixtures of a choline chloride-based deep eutectic solvent with water or methanol.

The addition of molecular liquid cosolvents to choline chloride (ChCl)-based deep eutectic solvents (DESs) is increasingly investigated for reducing the inherently high bulk viscosities of the latter, which represent a major obstacle for potential industrial applications. The molar enthalpy of mixing, often referred to as excess molar enthalpy H E-a property reflecting changes in intermolecular interactions upon mixing-of the well-known ChCl/ethylene glycol (1:2 molar ratio) DES mixed with either water or methanol was recently found to be of opposite sign at 308.15 K: Mixing of the DES with water is strongly exothermic, while methanol mixtures are endothermic over the entire mixture composition range. Knowledge of molecular-level liquid structural changes in the DES following cosolvent addition is expected to be important when selecting such "pseudo-binary" mixtures for specific applications, e.g., solvents. With the aim of understanding the reason for the different behavior of selected DES/water or methanol mixtures, we performed classical MD computer simulations to study the changes in intermolecular interactions thought to be responsible for the observed H E sign difference. Excess molar enthalpies computed from our simulations reproduce, for the first time, the experimental sign difference and composition dependence of the property. We performed a structural analysis of simulation configurations, revealing an intriguing difference in the interaction modes of the two cosolvents with the DES chloride anion: water molecules insert between neighboring chloride anions, forming ionic hydrogen-bonded bridges that draw the anions closer, whereas dilution of the DES with methanol results in increased interionic separation. Moreover, the simulated DES/water mixtures were found to contain extended hydrogen-bonded structures containing water-bridged chloride pair arrangements, the presence of which may have important implications for solvent applications.

At the root of l-lysine emission in aqueous solutions.

l-lysine is an essential amino acid whose peculiar optical properties in aqueous solutions are still in search of a comprehensive explanation. In crystalline form l-lysine does not emit, but when in an aqueous solution, as the concentration increases, emits in the blue. The origin of such fluorescence is not yet clear. In the present article, we have combined quantum mechanics and classical simulations with experimental techniques to demonstrate that optical absorption and excitation-dependent fluorescence are directly correlated with the formation of aggregates, their dimensions and intermolecular interactions. The nature of the aggregates has been studied as a function of the pH and concentration of the amino acid. At low concentrations, fluorescence intensity increases linearly with molarity, while at high concentrations a new condition is established in which emitting and non-emitting molecular species coexist. The l-lysine aggregation and the formation of intermolecular H-bonding are at the ground of the emission in the blue range.

Carbon Nanodots from an In Silico Perspective.

Carbon nanodots (CNDs) are the latest and most shining rising stars among photoluminescent (PL) nanomaterials. These carbon-based surface-passivated nanostructures compete with other related PL materials, including traditional semiconductor quantum dots and organic dyes, with a long list of benefits and emerging applications. Advantages of CNDs include tunable inherent optical properties and high photostability, rich possibilities for surface functionalization and doping, dispersibility, low toxicity, and viable synthesis (top-down and bottom-up) from organic materials. CNDs can be applied to biomedicine including imaging and sensing, drug-delivery, photodynamic therapy, photocatalysis but also to energy harvesting in solar cells and as LEDs. More applications are reported continuously, making this already a research field of its own. Understanding of the properties of CNDs requires one to go to the levels of electrons, atoms, molecules, and nanostructures at different scales using modern molecular modeling and to correlate it tightly with experiments. This review highlights different in silico techniques and studies, from quantum chemistry to the mesoscale, with particular reference to carbon nanodots, carbonaceous nanoparticles whose structural and photophysical properties are not fully elucidated. The role of experimental investigation is also presented. Hereby, we hope to encourage the reader to investigate CNDs and to apply virtual chemistry to obtain further insights needed to customize these amazing systems for novel prospective applications.

Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of Spermidine3+ With DNA Double Helices.

Polyamines have important roles in the modulation of the cellular function and are ubiquitous in cells. The polyamines putrescine2+, spermidine3+, and spermine4+ represent the most abundant organic counterions of the negatively charged DNA in the cellular nucleus. These polyamines are known to stabilize the DNA structure and, depending on their concentration and additional salt composition, to induce DNA aggregation, which is often referred to as condensation. However, the modes of interactions of these elongated polycations with DNA and how they promote condensation are still not clear. In the present work, atomistic molecular dynamics (MD) computer simulations of two DNA fragments surrounded by spermidine3+ (Spd3+) cations were performed to study the structuring of Spd3+ "caged" between DNA molecules. Microsecond time scale simulations, in which the parallel DNA fragments were constrained at three different separations, but allowed to rotate axially and move naturally, provided information on the conformations and relative orientations of surrounding Spm3+ cations as a function of DNA-DNA separation. Novel geometric criteria allowed for the classification of DNA-Spd3+ interaction modes, with special attention given to Spd3+ conformational changes in the space between the two DNA molecules (caged Spd3+). This work shows how changes in the accessible space, or confinement, around DNA affect DNA-Spd3+ interactions, information fundamental to understanding the interactions between DNA and its counterions in environments where DNA is compacted, e.g. in the cellular nucleus.

Structural Features of the [C4mim][Cl] Ionic Liquid and Its Mixtures with Water: Insight from a 1H NMR Experimental and QM/MD Study.

The 1H NMR chemical shift of water exhibits non-monotonic dependence on the composition of an aqueous mixture of 1-butyl-3-methylimidazolium chloride, [C4mim][Cl], ionic liquid (IL). A clear minimum is observed for the 1H NMR chemical shift at a molar fraction of the IL of 0.34. To scrutinize the molecular mechanism behind this phenomenon, extensive classical molecular dynamics simulations of [C4mim][Cl] IL and its mixtures with water were carried out. A combined quantum mechanics/molecular mechanics approach based on the density functional theory was applied to predict the NMR chemical shifts. The proliferation of strongly hydrogen-bonded complexes between chloride anions and water molecules is found to be the reason behind the increasing 1H NMR chemical shift of water when its molar fraction in the mixture is low and decreasing. The model shows that the chemical shift of water molecules that are trapped in the IL matrix without direct hydrogen bonding to the anions is considerably smaller than the 1H NMR chemical shift predicted for the neat water. The structural features of neat IL and its mixtures with water have also been analyzed in relation to their NMR properties. The 1H NMR spectrum of neat [C4mim][Cl] was predicted and found to be in very reasonable agreement with the experimental data. Finally, the experimentally observed strong dependence of the chemical shift of the proton at position 2 in the imidazolium ring on the composition of the mixture was rationalized.

In silico study of PEI-PEG-squalene-dsDNA polyplex formation: the delicate role of the PEG length in the binding of PEI to DNA.

Biocompatible hydrophilic polyethylene glycol (PEG) is widely used in biomedical applications, such as drug or gene delivery, tissue engineering or as an antifouling component in biomedical devices. Experimental studies have shown that the size of PEG can weaken polycation-polyanion interactions, like those between branched polyethyleneimine (b-PEI) and DNA in gene carriers, but details of its cause and underlying interactions on the atomic scale are still not clear. To better understand the interaction mechanisms in the formation of polyplexes between b-PEI-PEG based carriers and DNA, we have used a combination of in silico tools and experiments on three multicomponent systems differing in PEG MW. Using the PEI-PEG-squalene-dsDNA systems of the same size, both in the all-atom MD simulations and in experimental in-gel electrophoresis measurements, we found that the binding between DNA and the vectors is highly influenced by the size of PEG, with the binding efficiency increasing with a shorter PEG length. The mechanism of how PEG interferes with the binding between PEI and DNA is explained using a two-step MD simulation protocol that showed that the DNA-vector interactions are influenced by the PEG length due to the hydrogen bond formation between PEI and PEG. Although computationally demanding we find it important to study molecular systems of the same size both in silico and in a laboratory and to simulate the behaviour of the carrier prior to the addition of bioactive molecules to understand the molecular mechanisms involved in the formation of the polyplex.

Spectroscopic and In Silico Studies on the Interaction of Substituted Pyrazolo[1,2-a]benzo[1,2,3,4]tetrazine-3-one Derivatives with c-Myc G4-DNA.

Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents. Molecular docking results allowed us to verify the modes of interaction of the ligands with the GQ and estimate the binding affinities. The highest binding affinity was observed for ligands with the experimental melting temperatures (Tms). However, both stabilizing and destabilizing ligands showed similar scores, whilst Molecular Dynamics (MD) simulations, performed across a wide range of temperatures on the GQ in water solution, either unliganded or complexed with two model PBT ligands with the opposite effect on the Tms, consistently confirmed their stabilizing or destabilizing ability ascertained by CD. Clues about a relation between the reported anticancer activity of some PBTs and their ability to stabilize the GQ structure of c-myc emerged from our study. Furthermore, Molecular Dynamics simulations at high temperatures are herein proposed for the first time as a means to verify the stabilizing or destabilizing effect of ligands on the GQ, also disclosing predictive potential in GQ-targeting drug discovery.

Formation of Citrazinic Acid Ions and Their Contribution to Optical and Magnetic Features of Carbon Nanodots: A Combined Experimental and Computational Approach.

The molecular model is one of the most appealing to explain the peculiar optical properties of Carbon nanodots (CNDs) and was proven to be successful for the bottom up synthesis, where a few molecules were recognized. Among the others, citrazinic acid is relevant for the synthesis of citric acid-based CNDs. Here we report a combined experimental and computational approach to discuss the formation of different protonated and deprotonated species of citrazinic acid and their contribution to vibrational and magnetic spectra. By computing the free energy formation in water solution, we selected the most favoured species and we retrieved their presence in the experimental surface enhanced Raman spectra. As well, the chemical shifts are discussed in terms of tautomers and rotamers of most favoured species. The expected formation of protonated and de-protonated citrazinic acid ions under extreme pH conditions was proven by evaluating specific interactions with H2SO4 and NaOH molecules. The reported results confirm that the presence of citrazinic acid and its ionic forms should be considered in the interpretation of the spectroscopic features of CNDs.

Theoretical and Experimental Study of the Excess Thermodynamic Properties of Highly Nonideal Liquid Mixtures of Butanol Isomers + DBE.

Binary alcohol + ether liquid mixtures are of significant importance as potential biofuels or additives for internal combustion engines and attract considerable fundamental interest as model systems containing one strongly H-bonded self-associating component (alcohol) and one that is unable to do so (ether), but that can interact strongly as a H-bond acceptor. In this context, the excess thermodynamic properties of these mixtures, specifically the excess molar enthalpies and volumes (HE and VE), have been extensively measured. Butanol isomer + di-n-butyl ether (DBE) mixtures received significant attention because of interesting differences in their VE, changing from negative (1- and isobutanol) to positive (2- and tert-butanol) with increasing alkyl group branching. With the aim of shedding light on the differences in alcohol self-association and cross-species H-bonding, considered responsible for the observed differences, we studied representative 1- and 2-butanol + DBE mixtures by molecular dynamics simulations and experimental excess property measurements. The simulations reveal marked differences in the self-association of the two isomers and, while supporting the existing interpretations of the HE and VE in a general sense, our results suggest, for the first time, that subtle changes in H-bonded topologies may contribute significantly to the anomalous volumetric properties of these mixtures.

Microstructural and Dynamical Heterogeneities in Ionic Liquids.

Ionic liquids (ILs) are a special category of molten salts solely composed of ions with varied molecular symmetry and charge delocalization. The versatility in combining varied cation-anion moieties and in functionalizing ions with different atoms and molecular groups contributes to their peculiar interactions ranging from weak isotropic associations to strong, specific, and anisotropic forces. A delicate interplay among intra- and intermolecular interactions facilitates the formation of heterogeneous microstructures and liquid morphologies, which further contributes to their striking dynamical properties. Microstructural and dynamical heterogeneities of ILs lead to their multifaceted properties described by an inherent designer feature, which makes ILs important candidates for novel solvents, electrolytes, and functional materials in academia and industrial applications. Due to a massive number of combinations of ion pairs with ion species having distinct molecular structures and IL mixtures containing varied molecular solvents, a comprehensive understanding of their hierarchical structural and dynamical quantities is of great significance for a rational selection of ILs with appropriate properties and thereafter advancing their macroscopic functionalities in applications. In this review, we comprehensively trace recent advances in understanding delicate interplay of strong and weak interactions that underpin their complex phase behaviors with a particular emphasis on understanding heterogeneous microstructures and dynamics of ILs in bulk liquids, in mixtures with cosolvents, and in interfacial regions.

Probing the supramolecular features via π-π interaction of a di-iminopyrene-di-benzo-18-crown-6-ether compound: experimental and theoretical study.

A novel DPyDB-C[double bond, length as m-dash]N-18C6 compound was synthesised by linking a pyrene moiety to each phenyl group of dibenzo-18-crown-6-ether, the crown ether, through -HC[double bond, length as m-dash]N- bonds and characterized by FTIR, 1H-NMR, 13C-NMR, TGA, and DSC techniques. The quantitative 13C-NMR analysis revealed the presence of two position isomers. The electronic structure of the DPyDB-C[double bond, length as m-dash]N-18C6 molecule was characterized by UV-vis and fluorescence spectroscopies in four solvents with different polarities to observe particular behavior of isomers, as well as to demonstrate a possible non-bonding chemical association (such as ground- and excited-state associations, namely, to probe if there were forming dimers/excimers). The interpretation of the electronic structure was realized through QM calculations. The TD-CAM-B3LYP functional, at the 6-311+G(d,p) basis set, indicated the presence of predominant π → π* and mixed π → π* + n → π* transitions, in line with the UV-vis experimental data. Even though DPyDB-C[double bond, length as m-dash]N-18C6 computational studies revealed a π-extended conjugation effect with predominantly π → π* transitions, thorough fluorescence analysis was observed a weak emission, as an effect of PET and ACQ. In particular, the WAXD analysis of powder and thin films obtained from n-hexane, 1,2-dichloroethane, and ethanol indicated an amorphous organization, whereas from toluene a smectic ordering was obtained. These results were correlated with MD simulation, and it was observed that the molecular geometry of DPyDB-C[double bond, length as m-dash]N-18C6 molecule played a defining role in the pyrene stacking arrangement.

On the Charge-Transfer Excitations in Azobenzene Maleimide Compounds: A Theoretical Study.

Photoswitchable systems with charge-transfer (CT) transitions have gained much attention during the recent years because of their many emerging applications. CT transitions themselves are of fundamental importance from physical, chemical, engineering, and molecular modeling points of view because they depend on the modified intramolecular electronic structure. CT transitions in azobenzene (AB) were observed when substituted with the maleimide (MI) functional group. This work represents a systematic theoretical study of excited states of the AB-MI structures of eight azo derivatives. In addition to the two main azo transitions (π → π* and n → π*), our calculations show a CT occurring between the azo moiety as a donor and the MI group as an acceptor. The CT mechanism can be characterized based on both the number and the position of the MI fragments. MI groups in the azo structure result in low-energy transitions, changing the order of the main transitions by introducing a CT character. Calculations using both density functional theory (DFT) and high-end molecular orbital theories confirm the CT character of these derivatives, although the order of excited states was found to differ depending on the chosen level of theory. We present here the first theoretical investigation of the electronic excited states (nπ*CT and ππ*CT) and corresponding transitions for this class of compounds. The computational results showed that the CT mechanism in AB-MI derivatives can occur via two pathways: planar and twisted. Our findings are expected to be of substantial interest, especially in the area of molecular optoelectronics and in the design of responsive materials.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

195Pt NMR and Molecular Dynamics Simulation Study of the Solvation of [PtCl6]2- in Water-Methanol and Water-Dimethoxyethane Binary Mixtures.

The experimental 195Pt NMR chemical shift, δ(195Pt), of the [PtCl6]2- anion dissolved in binary mixtures of water and a fully miscible organic solvent is extremely sensitive to the composition of the mixture at room temperature. Significantly nonlinear δ(195Pt) trends as a function of solvent composition are observed in mixtures of water-methanol, or ethylene glycol, 2-methoxyethanol, and 1,2-dimethoxyethane (DME). The extent of the deviation from linearity of the δ(195Pt) trend depends strongly on the nature of the organic component in these solutions, which broadly suggests preferential solvation of the [PtCl6]2- anion by the organic molecule. This simplistic interpretation is based on an accepted view pertaining to monovalent cations in similar binary solvent mixtures. To elucidate these phenomena in detail, classical molecular dynamics computer simulations were performed for [PtCl6]2- in water-methanol and water-DME mixtures using the anionic charge scaling approach to account for the effect of electronic dielectric screening. Our simulations suggest that the simplistic model of preferential solvation of [PtCl6]2- by the organic component as inferred from nonlinear δ(195Pt) trends is not entirely accurate, particularly for water-DME mixtures. The δ(195Pt) trend in these mixtures levels off for high DME mole fractions, which results from apparent preferential location of [PtCl6]2- anions at the borders of water-rich regions or clusters within these inherently micro-heterogeneous mixtures. By contrast in water-methanol mixtures, apparently less pronounced mixed solvent micro-heterogeneity is found, suggesting the experimental δ(195Pt) trend is consistent with a more moderate preferential solvation of [PtCl6]2- anions. This finding underlines the important role of solvent-solvent interactions and micro-heterogeneity in determining the solvation environment of [PtCl6]2- anions in binary solvent mixtures, probed by highly sensitive 195Pt NMR. The notion that preferential solvation of [PtCl6]2- results primarily from competing ion-solvent interactions as generally assumed for monatomic ions, may not be appropriate in general.

Inhomogeneity in Ethylammonium Nitrate-Acetonitrile Binary Mixtures: The Highest "Low q Excess" Reported to Date.

The binary mixtures of the ionic liquid ethylammonium nitrate with acetonitrile have been studied by means of wide- and small-angle X-ray scattering and via two different computational methods, namely, classical molecular dynamics and DFT. The recently debated odd feature in the extreme low q region of some ionic liquid-based binary mixtures is linked to density fluctuations within the system. We show how the "low q excess" is due to some nanoscopic objects which are formed at certain compositions. These structures have different density with respect to the surrounding, thus generating the feature observed. Our results also show how the local arrangement is directly linked to the long-range structure. Moreover, we found once again a similarity in the physicochemical behavior of ethylammonium nitrate and water.