Contaminating viral sequences in high-throughput sequencing viromics: a linkage study of 700 sequencing libraries.

OBJECTIVES: Sample preparation for high-throughput sequencing (HTS) includes treatment with various laboratory components, potentially carrying viral nucleic acids, the extent of which has not been thoroughly investigated. Our aim was to systematically examine a diverse repertoire of laboratory components used to prepare samples for HTS in order to identify contaminating viral sequences. METHODS: A total of 322 samples of mainly human origin were analysed using eight protocols, applying a wide variety of laboratory components. Several samples (60% of human specimens) were processed using different protocols. In total, 712 sequencing libraries were investigated for viral sequence contamination. RESULTS: Among sequences showing similarity to viruses, 493 were significantly associated with the use of laboratory components. Each of these viral sequences had sporadic appearance, only being identified in a subset of the samples treated with the linked laboratory component, and some were not identified in the non-template control samples. Remarkably, more than 65% of all viral sequences identified were within viral clusters linked to the use of laboratory components. CONCLUSIONS: We show that high prevalence of contaminating viral sequences can be expected in HTS-based virome data and provide an extensive list of novel contaminating viral sequences that can be used for evaluation of viral findings in future virome and metagenome studies. Moreover, we show that detection can be problematic due to stochastic appearance and limited non-template controls. Although the exact origin of these viral sequences requires further research, our results support laboratory-component-linked viral sequence contamination of both biological and synthetic origin.

Differential effects of nitro-PAHs and amino-PAHs on cytokine and chemokine responses in human bronchial epithelial BEAS-2B cells.

Nitro-polycyclic aromatic hydrocarbons (nitro-PAHs) are found in diesel exhaust and air pollution particles. Along with other PAHs, many nitro-PAHs possess mutagenic and carcinogenic properties, but their effects on pro-inflammatory processes and cell death are less known. In the present study we examined the effects of 1-nitropyrene (1-NP), 3-nitrofluoranthene (3-NF) and 3-nitrobenzanthrone (3-NBA) and their corresponding amino forms, 1-AP, 3-AF and 3-ABA, in human bronchial epithelial BEAS-2B cells. The effects of the different nitro- and amino-PAHs were compared to the well-characterized PAH benzo[a]pyrene (B[a]P). Expression of 17 cytokine and chemokine genes, measured by real-time PCR, showed that 1-NP and 3-NF induced a completely different cytokine/chemokine gene expression pattern to that of their amino analogues. 1-NP/3-NF-induced responses were dominated by maximum effects on CXCL8 (IL-8) and TNF-alpha expression, while 1-AP-/3-AF-induced responses were dominated by CCL5 (RANTES) and CXCL10 (IP-10) expression. 3-NBA and 3-ABA induced only marginal cytokine/chemokine responses. However, 3-NBA exposure induced considerable DNA damage resulting in accumulation of cells in S-phase and a marked increase in apoptosis. B[a]P was the only compound to induce expression of aryl hydrocarbon receptor (AhR)-regulated genes, such as CYP1A1 and CYP1B1, but did not induce cytokine/chemokine responses in BEAS-2B cells. Importantly, nitro-PAHs and amino-PAHs induced both qualitatively and quantitatively different effects on cytokine/chemokine expression, DNA damage, cell cycle alterations and cytotoxicity. The cytokine/chemokine responses appeared to be triggered, at least partly, through mechanisms separate from the other examined endpoints. These results confirm and extend previous studies indicating that certain nitro-PAHs have a considerable pro-inflammatory potential.

Analysis of resveratrol as a lung cancer chemopreventive agent in A/J mice exposed to benzo[a]pyrene.

Resveratrol inhibits PAH bioactivation through reduced expression of the CYP1A1 and CYP1B1 genes in human bronchial epithelial cells. Ad libitum access to a diet containing resveratrol showed no effect on benzo[a]pyrene-induced lung tumorigenesis in A/J mice. Also, resveratrol did not change CYP1A1 and CYP1B1 gene expression or benzo[a]pyrene protein adduct levels in the lung tissue. The lack of chemopreventive activity may have been caused by insufficient concentrations or nonreactive forms of resveratrol in the lungs.

Resveratrol inhibits benzo[a]pyrene-DNA adduct formation in human bronchial epithelial cells.

Resveratrol (trans-3,4',5-trihydroxystilbene), a phytoalexin present in various plants and foods, has in several in vitro and in vivo studies demonstrated cancer chemopreventive and chemotherapeutic potential. We investigated the in vitro effect of resveratrol on benzo[a]pyrene (B[a]P) -induced DNA adducts in human bronchial epithelial cells. This was compared to the effect of resveratrol on the expression of the cytochrome P450 (CYP) genes CYP1A1 and CYP1B1 and the formation of B[a]P metabolites. Exposure of BEAS-2B and BEP2D cells to B[a]P and increasing concentrations of resveratrol resulted in a dose- and time-dependent inhibition of DNA adduct formation quantified by (32)P-postlabelling. Supporting this result, resveratrol was shown to inhibit CYP1A1 and CYP1B1 gene expression, as measured by real-time reverse transcriptase-polymerase chain reaction. Also, a significant correlation was found between the number of DNA adducts and the mRNA levels of these genes. Using HPLC analysis, a concomitant decrease in the formation of B[a]P-derived metabolic products was detected. In conclusion, these data lend support to a chemopreventive role of resveratrol in polycyclic aromatic hydrocarbon-induced carcinogenesis.

Lung carcinogenesis: resveratrol modulates the expression of genes involved in the metabolism of PAH in human bronchial epithelial cells.

Studies suggest that resveratrol (trans-3,4',5-trihydroxystilbene), which is a diphenolic antioxidant found in plants and foods, has cancer chemopreventive and chemotherapeutic potential. A lower risk of lung cancer among consumers of wine compared with consumers of other beverages has been observed, which may be partly attributed to the high content of resveratrol particularly in red wine. We have studied the effect of resveratrol on the expression of genes involved in the metabolism of polycyclic aromatic hydrocarbons in the human bronchial epithelial cell line BEP2D. Expression of the cytochrome P450 1A1 (CYP1A1) and 1B1 (CYP1B1), microsomal epoxide hydrolase (mEH), and glutathione S-transferase P1 (GSTP1) genes was measured by quantitative reverse transcriptase-polymerase chain reaction. The cells were treated either with benzo[a]pyrene or 2,3,7,8-tetrachlorodibenzo-p-dioxin in the presence or absence of resveratrol. Resveratrol inhibited both the constitutive and the induced expression of CYP1A1 and CYP1B1 in a dose-dependent manner. In contrast, the expression of the mEH gene was increased in response to resveratrol and no change in the expression of GSTP1 was found. The altered gene expression in response to resveratrol was reflected in a reduced overall level of benzo[a]pyrene metabolism. These data indicate that resveratrol may exert lung cancer chemopreventive activity through altering the expression of genes involved in the metabolism of polycyclic aromatic hydrocarbons, resulting in altered formation of carcinogenic benzo[a]pyrene metabolites in human bronchial epithelial cells.

Gene-environment interactions in human lung cancer.

Gene-environment interactions are thought to be critical for several diseases such as cancer, diabetes, heart disease and asthma. Cancer is a result of multiple gene-environment interactions occurring over several decades. During tumor development the cell accumulates multiple genetic changes, which generate the transformed phenotype, i.e. a cell with increased genetic instability. Lung cancer is a useful model for the study of the interplay between genetic factors and environmental exposure since the primary etiology is well established. Several polymorphic enzymes that may be important determinants of susceptibility have been demonstrated. Data also provide evidence for sex differences in lung cancer susceptibility. Furthermore, certain chemical carcinogens may contribute to the carcinogenic process in the lung epithelial cells by inducing genomic instability either directly or indirectly through inflammatory processes.

Sex differences in lung CYP1A1 expression and DNA adduct levels among lung cancer patients.

Several epidemiological studies have indicated that female tobacco smokers may be at higher risk of lung cancer than males. In a study of lung cancer cases, we have found that female smokers had a significantly higher level of aromatic/hydrophobic DNA adducts in their nontumor lung tissue (15.39+/-9.47 adducts/10(8) nucleotides, n = 29) than male smokers (12.08+/-8.14, a = 93; P = 0.047). Females had significantly higher levels of adducts/pack-year (females 0.95+/-0.82 adducts/pack-year and males 0.46+/-0.46; P = 0.0004) and adducts/cigaret/day (females 1.48+/-1.29 and males 0.89+/-0.74, P = 0.015). By quantitative reverse transcription-PCR, it was found that female smokers exhibited a significantly higher expression level of lung CYP1A1 (494+/-334 CYP1A1 mRNA/10(6) glyceraldehyde-3-phophate dehydrogenase mRNA, n = 15) compared with males (210+/-208, n = 12; P = 0.016). Furthermore, for both sexes combined a significant correlation between CYP1A1 expression and DNA adduct level was found (r = 0.50, P = 0.009). In conclusion, the observed sex difference in aromatic/hydrophobic DNA adduct levels may at least in part be explained by different levels of CYP1A1 expression.

cGMP-dependent and -independent inhibition of a K+ conductance by natriuretic peptides: molecular and functional studies in human proximal tubule cells.

In immortalized human kidney epithelial (IHKE-1) cells derived from proximal tubules, two natriuretic peptide receptors (NPR) were identified. In addition to NPR-A, which is bound by atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and urodilatin (URO), a novel form of NPR-B that might be bound by C-type natriuretic peptide (CNP) was identified using PCR. This novel splice variant of NPR-B (NPR-Bi) was also found in human kidney. Whereas ANP, BNP, and URO increased intracellular cGMP levels in IHKE-1 cells in a concentration-dependent manner, CNP had no effect on cGMP levels. To determine the physiologic responses to these agonists in IHKE-1 cells, the membrane voltage (Vm) was monitored using the slow whole-cell patch-clamp technique. ANP (10 nM), BNP (10 nM), and URO (16 nM) depolarized these cells by 3 to 4 mV (n = 47, 7, and 16, respectively), an effect that could be mimicked by 0.1 mM 8-Br-cGMP (n = 15). The effects of ANP and 8-Br-cGMP were not additive (n = 4). CNP (10 nM) also depolarized these cells, by 3+/-1 mV (n = 28), despite the absence of an increase in cellular cGMP levels, indicating a cGMP-independent mechanism. In the presence of CNP, 8-Br-cGMP further depolarized Vm significantly, by 1.6+/-0.3 mV (n = 5). The depolarizations by ANP were completely abolished in the presence of Ba2+ (1 mM, n = 4) and thus can be related to inhibition of a K+ conductance in the luminal membrane of IHKE-1 cells. The depolarizations attributable to CNP were completely blocked when genistein (10 microM, n = 6), an inhibitor of tyrosine kinases, was present. These findings indicate that natriuretic peptides regulate electrogenic transport processes via cGMP-dependent and -independent pathways that influence the Vm of IHKE-1 cells.

Role of Cx43 phosphorylation and MAP kinase activation in EGF induced enhancement of cell communication in human kidney epithelial cells.

Epidermal growth factor (EGF) has been found to induce enhanced gap junctional intercellular communication (GJIC) in the human kidney epithelial cell line K7. This is in contrast to what is reported for other cell types, which all show decreased GJIC in response to EGF. In the present study it is shown that 12-O-tetradecanoylphorbol-13-acetate (TPA) and EGF induce similar phosphorylation pattern of the gap junction protein connexin43 (Cx43) in K7 cells, although their effects on GJIC are opposite. Tyrosine phosphorylation of a 42 kD protein was observed to be induced concomitantly with phosphorylation of Cx43. EGF was however found to induce only serine phosphorylation of Cx43, indicating that the tyrosine kinase activity of the EGF receptor was not directly affecting the gap junction protein. The 42 kD protein phosphorylated on tyrosine was identified to be a mitogen activated protein (MAP) kinase. Both EGF and TPA was found to activate MAP kinase in these cells. Phosphorylation of Cx43 and enhancement of GJIC in response to EGF occurred with difference in time course. Phosphorylation of Cx43 was completed within 15 min, while the enhanced GJIC appeared 2-3 h later. It is therefore possible that regulation of synthesis or transport of Cx43 is responsible for the increase in GJIC, rather than direct involvement of Cx43 phosphorylation. This is in support of our previous finding that protein synthesis is necessary for EGF induced upregulation of GJIC in K7 cells.

Modulation of gap junctional intercellular communication by EGF in human kidney epithelial cells.

Modulation of gap junctional intercellular communication (GJIC) was studied in a multistep model of human renal epithelial carcinogenesis. We report that the majority of primary human kidney epithelial cells (NHKE) grown from fetal kidney explants did not communicate through gap junctions. Communication could, however, be observed within a subpopulation of the cells. Ni(II)-immortalized cells (IHKE) showed GJIC at a level of 10-20 communicating cells, but with heterogeneous regions on the dish, with regard to both communication and distribution of connexin43. The heterogeneity was less pronounced in a ras-transfected tumourigenic cell line (THKE), which also showed communication of approximately 10-20 dye-coupled cells. Communication within the IHKE sub-clone K7 decreased from 55 dye-coupled cells communicating on day 1 after seeding to approximately 13 in cells grown for 4 days. Daily change of growth medium reduced the decrease in GJIC. EGF enhanced communication following a lag period which depended on days in culture. The largest increase in GJIC was observed in 2-day-old cultures, where the number of communicating cells in some experiments increased from approximately 45 to 130 dye-coupled cells 4 h following change to medium with EGF. The induction was concentration dependent and communication was enhanced gradually between 2 and 7 h after exposure to EGF. A 15 min pulse of EGF was sufficient to induce the GJIC increase if the total incubation period was unchanged. Cycloheximide completely blocked the EGF-induced enhancement of communication, while actinomycin D had no effect. EGF exposure resulted in an increase in the cellular level of connexin43 protein in parallel with the enhancement in communication. Together, these results indicate that the EGF-induced enhancement of GJIC in human kidney epithelial cells was mediated through translational control of connexin43 expression.

Differential effect of polyunsaturated fatty acids on cell proliferation during human epithelial in vitro carcinogenesis: involvement of epidermal growth factor receptor tyrosine kinase.

Polyunsaturated fatty acids (PUFAs) have been implicated in tumour development and have been shown to influence cell proliferation in vitro. We report here that n-3 and n-6 PUFAs at concentration > 10 microM inhibited the proliferation of a human kidney epithelial cell line (21HKE), which has retained phenotypic characteristics of normal kidney epithelial cells. In contrast, the proliferation was stimulated by n-3 and n-6 PUFAs at concentrations < 10 microM under defined growth conditions. The stimulatory effect of n-3 and n-6 PUFAs was even more profound in the presence of EGF. In human kidney epithelial cell lines reflecting different stages of transformation (11HKE and 1THKEras), the stimulatory effect was abrogated both in the presence and absence of EGF. Saturated fatty acids did not show any stimulatory effect on cell growth. The tyrosine kinase inhibitors genistein and tyrphostin-47 inhibited EGF-induced protein tyrosine phosphorylation dose-dependently in the 21HKE cells, and abolished the growth stimulatory effect of docosahexaenoic acid (DHA). This indicates the involvement of EGF receptor tyrosine kinase activity in the observed increase in cell proliferation.

Nickel(II) induces alterations in EGF- and TGF-beta 1-mediated growth control during malignant transformation of human kidney epithelial cells.

We have previously described immortalization of normal human kidney epithelial cells by nickel(II) and the subsequent tumorigenic conversion by v-Ha-ras transfection. We report here that nickel(II) induces alterations in growth regulatory control. Normal human kidney epithelial cells (NHKE) were growth inhibited by transforming growth factor beta 1 (TGF-beta 1). This effect was abrogated in both the immortalized (IHKE) and transformed (THKE) cells. NHKE expressed approximately 4700 high-affinity binding sites/cell for TGF-beta 1. IHKE and THKE showed reduced binding of 47% and 44% relative to NHKE respectively. On the other hand, expression of epidermal growth factor (EGF) receptors was elevated in IHKE (260%) and THKE (236%) relative to NHKE, which expressed 1.5 x 10(5) receptors/cell. Preincubation of IHKE and THKE with TGF-beta 1 resulted in reduced EGF binding, whereas this binding was unaltered in NHKE. Exposure of human kidney epithelial cells to EGF led to tyrosine phosphorylation of the EGF receptor and other cellular proteins in the mol. wt range from 42 to > 300 kDa. The level of receptor phosphorylation induced by EGF reflected receptor expression. Tyrosine phosphorylated proteins appear to be identical in all three cell lines, and reach phosphorylation maxima independently of EGF receptor expression. These studies indicate that nickel carcinogenesis may involve changes in sets of genes important in normal growth regulation.

Effects of n-3 fatty acids during neoplastic progression and comparison of in vitro and in vivo sensitivity of two human tumour cell lines.

Several studies have shown that dietary lipid exerts an effect on carcinogenesis. We report here that progression to malignancy in vitro is associated with changes in the response to fatty acids (FAs). Tumorigenic (THKE) cells were more sensitive to the n-3 FAs eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) than immortalised (IHKE) cells. The growth of THKE cells was inhibited 25% more than the growth of IHKE cells at 80 microM EPA (P < 0.01) and 35% more at 40 microM DHA (P < 0.001). Furthermore, the results indicate that there is a wide cell type variation in the response to FAs. We found that the in vitro inhibition by FAs correlated with the reduction in the growth rate of the tumour in nude mice fed K85 (55% EPA and 30% DHA). A significant difference in tumour latency was observed for the A427 cell tumour groups (10 days, P < 0.05). Tumours in the animals fed n-3 FA exhibited significantly higher levels of EPA and DHA; the level of arachidonic acid (ARA) was significantly lower in THKE tumours and the level of linoleic acid (LA) was significantly lower in A427 tumours than in controls fed corn oil. The higher sensitivity of the A427 cell line was not explained by higher uptake of EPA/DHA.

Nickel-induced alterations in human renal epithelial cells.

Cellular progression to malignancy appears to require a number of distinct steps in which genetic damage in key regulatory genes accumulates. Immortalization, or escape from senescence, is considered to be one of the first phenotypic changes. Ni2+ treatment of normal human kidney epithelial (NHKE) cells in vitro resulted in immortalization of the cells IHKE cells). The combined action of Ni2+ and v-Ha-ras oncogene fully transformed the cells to tumorigenicity in athymic nude mice. Sequence analysis of DNA from IHKE cells revealed point mutation in the p53 gene at codon 238 with T-->C transition. These findings suggest that Ni-induced mutation in the p53 gene can be involved in the immortalization of the NHKE cells. The results also show that changes in the responses to EGF and TGF beta and in the expression of their receptors occur during malignant progression in vitro.

Ca2+ and pH regulation of K+ channels in membrane vesicles of rabbit proximal tubule.

The effect of Ca2+ and pH on the renal epithelial K+ channel was investigated by measuring the Ba2(+)-sensitive 86Rb+ fluxes in membrane vesicles from pars convoluta of rabbit proximal tubule. It was found that the presence of nanomolar concentrations of Ca2+ in the internal compartment (cytoplasmic) of the vesicles ([Ca2+]i) substantially lowered the channel-mediated flux. Ba2(+)-sensitive 86Rb+ uptake was completely blocked by 10 microM [Ca2+]i. This inhibitory effect of Ca2+ was strongly dependent on pH. Thus 0.1 microM [Ca2+]i produced a maximal inhibition of 86Rb+ uptake at pH greater than 7.4 but had no effect at pH less than 7.0. The tracer fluxes measured in the absence of Ca2+ were pH independent over this range. The data are compatible with the model that Ca2+ blocks K+ channels by binding to a site composed of one or several deprotonated groups. The protonation of any one of these groups prevents Ca2+ from binding to this site but does not by itself block transport.

Proton gradient-dependent renal transport of glycine: evidence for vesicle studies.

The characteristics of renal transport of glycine by luminal membrane vesicles isolated from either proximal convoluted part (pars convoluta) or proximal straight part (pars recta) of rabbit proximal tubule were investigated. In vesicles from pars convoluta two transport systems have been characterized: a Na(+)-dependent system with intermediate affinity (half-saturation 3.64 mM) and a Na(+)-independent system that, in the presence of H+ gradient (extravesicular greater than intravesicular), can accelerate the transport of glycine into these vesicles. This is the first demonstration of H(+)-glycine cotransport across the luminal membrane of rabbit kidney proximal convoluted tubule. By contrast, in membrane vesicles from pars recta, transport of glycine was strictly dependent on Na+ and occurred via a dual transport system, namely a high-affinity (half-saturation 0.34 mM) and a low-affinity system (half-saturation 8.56 mM). The demonstration of competition between the H(+)-gradient dependent uptake of glycine, L-alanine, and L-proline, but insignificant inhibition with L-phenylalanine in vesicles from pars convoluta suggests that glycine, L-proline, and L-alanine probably share a common proton gradient-dependent transport system. In vesicles from pars recta, the Na(+)-dependent uptake of glycine was inhibited by low concentrations of L-alanine and L-phenylalanine, whereas addition of L-proline to the incubation medium did not significantly alter the uptake of glycine, suggesting that the Na(+)-dependent high-affinity system for glycine located in pars recta is shared with the high-affinity L-alanine and L-phenylalanine but not L-proline transport system.

[Diagnosis of penicillin allergy. Results of a clinical investigation program]. / Diagnostik af penicillinallergi. Resultater af et klinisk undersøgelsesprogram.

Investigations concerning penicillin allergy (PA) from abroad suggest that considerable overdiagnosing occurs. The absence of standardized commercially available preparations for skin testing and the time necessary for thorough testing are also contributory causes. Fifty patients with suspected PA were investigated with a programme consisting, in serial order, of RAST for IgE to penicillin V and G, a cutaneous test with a commercially available test preparation (Penkit), first with a prick followed by intracutaneous testing and finally with oral provocation. If a positive reaction occurred, the test was discontinued. Six patients (12%) had positive RAST or cutaneous reactions, (1 positive to RAST, 2 to prick and three not until the intracutaneous test), while no patients with negative RAST and cutaneous tests reacted to oral provocation. No generalized allergic reactions occurred during testing. It did not prove possible to predict which patients would react positively on the basis of the case histories. This investigation thus demonstrates that PA is also considerably overdiagnosed in Denmark and that a programme of investigation such as this is suitable for testing for PA and, finally, that the programme of investigation can scarcely be simplified.

Electrogenic uptake of D-imino acids by luminal membrane vesicles from rabbit kidney proximal tubule.

Some characteristics of electrogenic uptake of D-proline and hydroxy-D-proline by luminal membrane vesicles isolated either from pars convoluta or from pars recta of rabbit proximal tubule were indirectly studied by the spectrophotometric method. In vesicles from pars convoluta, the uptake of D-imino acids was mediated by both Na+-dependent and Na+-independent, but electrogenic processes. Indirect evidence for coupling between D-imino acids and H+ fluxes was obtained by the following observations: (1) Addition of the H+ ionophore (FCCP) to the vesicle-dye (3,3'-diethyloxadicarbocyanine iodide) suspension completely abolished the Na+-independent electrogenic uptake of D-proline and hydroxy-D-proline by membrane vesicles from pars convoluta. (2) Addition of a relatively low concentration of D-proline in the incubation system decreased the H+-gradient dependent renal uptake of radioactive L-proline to approx. 60% of the control value. By contrast, the uptake of D-proline in vesicles from pars recta was strictly Na+-dependent, since no transient depolarization of membrane vesicles was ever observed in the absence of Na+. A comparison between the transport characteristics of D-imino acids and their naturally occurring L-isomers indicated that these compounds probably share common transport systems located along the proximal tubule of rabbit kidney.

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage.

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.