Epidemiology and laboratory diagnosis of fungal corneal ulcer in the Sundarban Region of West Bengal, eastern India.

INTRODUCTION: Corneal ulcers are the second most-common cause of preventable blindness after cataract in tropical developing countries. Fungal corneal ulcers constitute 30 to 62 % of the total microbial culture-positive corneal ulcers. OBJECTIVE: To study the epidemiological characteristics, risk factors and laboratory diagnosis of fungal corneal ulcer in the Sundarban Region, West Bengal, eastern India. MATERIALS AND METHODS: A retrospective review of 399 culture-positive, fungal corneal ulcers out of a total 928 corneal ulcer patients attending a tertiary care hospital in Kolkata,eastern India, over a period of four years from February 2007 to January 2011. RESULTS: Males (246; 61.65 %) were more commonly affected than females (P less than .0001).The affected people were mostly (342; 85.71 %) residing in the rural areas (P less than .0001). 196 patients (49.12 %) were involved in agricultural activities (P less than .0001). The younger people of, 21 - 50 years of age, were particularly prone to this disease (269; 67.41 %). Corneal trauma (354; 88.72 %) was the commonest risk factor (P less than .0001) and 261 patients (61.41 %) had a history of trauma with vegetative matter (P less than .0001). The use of topical corticosteroids was implicated in 65 (16.29 %) cases. The incidence of the disease was highest in the monsoon season, between June to September (192; 48.12 %). The aspergillus spp was the most common fungal growth (151; 37.84 %), followed by an Fusarium spp (81; 20.3 %). CONCLUSION: The fungal corneal ulcers are an important cause of ocular morbidity in people residing in the Sundarban Region. The identification of the etiology and the predisposing factors of corneal ulcers in this region are important for the prevention and early treatment of the disease.

Fruit Rot of Tinda Caused by Pseudomonas aeruginosa-A New Report from India.

Fruit rot disease (FRD), an emerging problem of tinda (Praecitrullus fistulosus) in India. FRD epidemics begin during rainy and warm weather and often spoil marketable produce. Symptoms appear as numerous, pale brown-to-dark brown, deeply penetrating circular soft rot lesions on fleshy fruit tissues. Noneffervescent bacterial exudates occasionally form on lesions. Repeated isolations from FRD-affected tinda fruits consistently yielded the same bacterial species. Inoculation of the isolated bacterium into asymptomatic tinda fruits produced identical soft rot symptoms. Fruits were inoculated with the isolate ITCC B0030 (0.1 OD) by removing a 2.0-cm deep tissue plug with a sterile cork borer (5 mm in diameter) and injecting the inoculum with a syringe in the cylindrical cavity. After inoculation, the plug (upper 5 mm) was reinserted, sealed with sterile paraffin, and covered with a small piece of wet absorbent cotton to prevent dehydration. High humidity (>90%) and 30 to 33°C temperature was maintained after inoculation in a glasshouse. After 4 to 10 days, fruits showed FRD symptoms. The reisolated bacterium from artificially inoculated symptomatic fruits was identical with the original inoculated bacterium. Identity of the bacterial pathogen for FRD was confirmed by phenotypic and genotypic methods. The causal bacterium was a gram-negative, non-sporing motile rod with a single polar flagellum. The bacterium produced yellowish green and blue-green diffusible pigments on King's B (KB) medium. On yeast dextrose calcium carbonate agar at 30°C, the colonies produced abundant, blue, diffusible pigment within 48 h. The bacterium grew at temperatures up to 42°C but not at 4°C. Excellent growth occurred on Salmonella-Shigella agar and MaConkey's medium, as reported also for Pseudomonas aeruginosa strain P8. The bacterium produced ammonia, hydrogen sulfide, arginine dihydrolase, urease, lipase, catalase, gelatinase, and casinase but not amylase, indole, or acetyl methyl carbinol. The bacterium was identified as P. aeruginosa using Biolog based Bacterial Identification System version 4.2 (Biolog Inc., Hayward, CA). The bacterium did not utilize cellobiose, dulcitol, maltose, sorbitol, sucrose, arabinose, and starch. Upon infiltration on tobacco leaves (Nicotiana tabacum cv. Xanthi) at 107 or more cells ml-1, the bacterium gave a strong hypersensitive reaction within 24 h. Transmission electron micrographs (TEM, KYKY 1000B, Japan) of the causal bacterium revealed a single, polar flagellum. Identity was further confirmed as P. aeruginosa based on 16S rRNA sequence (1,491 nt) analysis with universal primers F1 (5'-GAGTTTGATCCTGGCTCAG-3') and R13 (5'-AGAAAGGAGGTGATCCAGCC-3'). A blastN search of GenBank revealed a >99% nt identity with P. aeruginosa strain TAUC 7 (HQ914782). The 16S rRNA gene sequence (1,491 nt) was deposited in Bankit GenBank (JF797204). To our knowledge, this is the first report of fruit rot of tinda caused by P. aeruginosa in India (ITCC B0030) and a new record of bacterial rot of Praecitrullus fistulosus induced by a fluorescent and blue-green pigment producing P. aeruginosa. To date, P. syringae pv. lachrymans and a nonfluorescent P. pseudoalcaligenes subsp. citrulli were reported to infect Citrullus lanata (1) and Praecitrullus fistulosus (2), respectively. References: (1) D. L. Hopkins and N. C. Schenck. Phytopathology 62:542, 1972. (2) N. W. Schaad et al. Int. J. Syst. Bacteriol. 28:117, 1978.

A New Leaf Blight of Rice Caused by Pantoea ananatis in India.

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 µm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml-1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml-1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

Multidrug therapy in leprosy can prevent relapse- a retrospective study

A retrospective study was done at the Leprosy Control Unit (LCU) in Durgapur of Burdwan district, West Bengal, to determine the relapse rate following multidrug therapy (MDT). A total of 1581 patients (1276 PB and 305 MB) completed MDT regimens during a period of 5 years as per WHO recommendations and National Leprosy Eradication Programme (NLEP) guidelines. The treated patients were kept under surveillance as per NLEP guidelines and searched for relapses. The results of MDT were compared with those of pre-MDT (monotherapy) era at the same centre (total: 405 patients; PB-373, MB-32) andalso with those of the Leprosy Clinic in Gopalpur (only dapsone was given to a total of 189 patients, PB-167, MB-22) Following monotherapy, the relapse rate was 10.06% at the Gopalpur Leprosy Clinic and 12.4% at the Dargapur LCU during the 2 years (PB) and 5 years (MB) of surveillance, whereas following MDT no relapse case was encountered both in PB and MB cases during the surveillance periods recommended by WHO. The results of this study are comparable with those of ohter studies. Though a few studies showed relapses during long-term surveillance beyond the periods recommended by WHO, it is once again established that MDT can prevent relapse in leprosy

Multidrug therapy in leprosy can prevent relapse--a retrospective study.

A retrospective study was done at the Leprosy Control Unit (LCU) in Durgapur of Burdwan district, West Bengal, to determine the relapse rate following multidrug therapy (MDT). A total of 1581 patients (1276 PB and 305 MB) completed MDT regimens during a period of 5 years as per WHO recommendations and National Leprosy Eradication Programme (NLEP) guidelines. The treated patients were kept under surveillance as per NLEP guidelines and searched for relapses. The results of MDT were compared with those of pre-MDT (monotherapy) era at the same centre (total: 405 patients; PB-373, MB-32) and also with those of the Leprosy Clinic in Gopalpur (only dapsone was given to a total of 189 patients, PB-167, MB-22). Following monotherapy, the relapse rate was 10.06% at the Gopalpur Leprosy Clinic and 12.4% at the Durgapur LCU during the 2 years (PB) and 5 years (MB) of surveillance, whereas following MDT no relapse case was encountered both in PB and MB cases during the surveillance periods recommended by WHO. The results of this study are comparable with those of other studies. Though a few studies showed relapses during long-term surveillance beyond the periods recommended by WHO, it is once again established that MDT can prevent relapse in leprosy.

Sclerotinia Root Rot: A New Threat to Buckwheat Seedlings in India.

In the temperate regions of India, buckwheat (Fagopyrum esculentum Moench and F. tataricum Gaertn.) is produced extensively. During the first week of June in 2001 and 2002, a severe incidence of root rot (35% seedling mortality) was observed in the Sangla Valley of Himachal Pradesh when the crop was at the seedling stage. The disease was more severe on F. tataricum, resulting in a poor crop stand. The disease appeared as water-soaked areas on the upper portion of the root, which turned brown. The brown patches gradually proceeded downward covering the whole root system. The above ground foliage wilted and died. The disease spread rapidly with cloudy, humid weather and day temperatures ranging from 15 to 20°C. Mycelium of the causal fungus was inter- and intracellular type with hyaline, branched, and septate hyphae. Sclerotia were pink but later turned black, measuring 3.0 to 3.5 mm in diameter. The pathogenicity of the causal fungus was proved following Koch's postulates. The pathogen was identified as Sclerotinia sclerotiorum (Lib.) de Bary (2). In Japan, the association of S. libertiana on buckwheat has been reported (1). To our knowledge, this is the first report of Sclerotinia root rot on buckwheat from India. References: (1) H. Singh and T. A. Thomas. Indian Counc. Agric. Res. New Delhi, India, 1978. (2) H. J. Willets and J. A. L. Wong, Bot. Rev. 46:101,1980.

Management of Xanthomonas camprestris pv. malvacearum-induced blight of cotton through phenolics of cotton rhizobacterium.

Four major phenolics were demonstrated to be produced by Pseudomonas fluorescens strain CRb-26, a cotton rhizobacterium antagonistic to Xanthomonas camprestris pv. malvacearum (Xcm), the inducer of bacterial blight of cotton. Of these, compounds II (nonfluorescent) and IV(fluorescent) completely inhibited the growth of Xcm in vitro. Among these, compound IV was produced maximally (39% of the four phenolics), and it protected cotton leaves from blight infection better than compound II under glass-house conditions. Compound IV, identified as 2,4-diacetylphloroglucinol, was, therefore, concluded to be a key metabolite involved in disease suppression by strain CRb-26 of P. fluorescens, which could be used as an ecofriendly potential input in the integrated management of bacterial blight of cotton.