New Insights into Genotype-phenotype Correlations in Chinese Facioscapulohumeral Muscular Dystrophy: A Retrospective Analysis of 178 Patients.

BACKGROUND: Facioscapulohumeral muscular dystrophy (FSHD), a common autosomal dominant muscular disorder, is caused by contraction of the D4Z4 repeats on 4q35. The complicated genotype-phenotype correlation among different ethnic population remains a controversial subject. We aimed to refine this correlation in order to provide new information for genetic counseling. METHODS: Here, a cohort of 136 Chinese families including 178 affected individuals and 137 unaffected members were investigated. Genetic analyses were performed using the p13E-11, 4qA and 4qB probes after pulsed field gel electrophoresis separation and southern blotting. A 10-grade FSHD clinical severity scale was adopted for clinical assessment. The genotype-phenotype correlation was established by linear regression analyses. RESULTS: We observed a roughly inversed correlation between the short EcoRI fragment size and age-corrected clinical severity score in 154 symptomatic patients (P < 0.05). Compared to male patients, a significant higher proportion of females in both asymptomatic carriers and severe patients showed larger variation in the size of short EcoRI fragment. A high incidence (19/42, 45.2%) of asymptomatic (or minimally affected) carriers was found in familial members. CONCLUSIONS: Although the number of D4Z4 repeats is known as one of the critical influences on genotype-phenotype correlation, a majority of phenotypic spectrum was still incompatible with their heterozygous contraction of the D4Z4 repeat, especial in female cases. Our results suggest that there are multi-factors synergistically modulating the phenotypic expression.

Changes of c-fos, malondialdehyde and lactate in brain tissue after global cerebral ischemia under different brain temperatures.

Under global cerebral ischemia, the effect of different brain temperature on cerebral ischemic injury was studied. Male Sprague-Dawley rats were divided into normothermic (37-38°C) ischemia, mild hypothermic (31-32°C) ischemia, hyperthermic (41-42°C) ischemia and sham-operated groups. Global cerebral ischemia was established using the Pulsinelli four-vessel occlusion model and brain temperature was maintained at defined level for 60 min after 20-min ischemia. The expression of c-fos protein and the levels of malondialdehyde (MDA) and lactate in brain regions were detected by immunochemistry and spectrophotometrical methods, respectively. C-fos positive neurons were found in the hippocampus and cerebral cortex after cerebral ischemia reperfusion. Mild hypothermia increased the expression of c-fos protein in both areas, whereas hyperthermia decreased the expression of c-fos protein in the hippocampus at 24 h reperfusion, and the cerebral cortex at 48 h reperfusion when compared to normothermic conditions. In normothermic, mild hypothermic and hyperthermic ischemia groups, the levels of MDA and lactate in brain tissue were increased at 24, 48 and 72 h reperfusion following 20-min ischemia as compared with the sham-operated group (P<0.01). The levels of MDA and lactate in mild hypothermic group were significantly lower than those in normothermic group (P<0.01). It is suggested that brain temperature influences the translation of the immunoreactive protein product of c-fos after global cerebral ischemia, and MDA and lactate are also affected by hypothermia and hyperthermia.

Clinical manifestations and spinal cord magnetic resonance imaging findings in Chinese neuromyelitis optica patients.

Neuromyelitis optica (NMO) is a disease distinct from multiple sclerosis in terms of clinical and magnetic resonance imaging (MRI) manifestations. Antibody to aquaporin-4 (AQP4) has been identified as a specific biomarker and part of the diagnostic criteria for NMO. Although it is relatively common in Asia, a comprehensive clinical and imaging evaluation of NMO has not been reported in Chinese patients. Here, we reviewed data from 57 Chinese cases. The patients had an obvious female preponderance (female/male = 8.5:1), and transverse myelitis (82.5%) and optic neuritis (56.1%) were the most common manifestations. In MRI, longitudinally extensive transverse myelitis (6.9 ± 2.3 segments) dominated the spinal cord lesions, which were mainly (69.7%) distributed in cervical and thoracic cord. However, the length of the lesions was not correlated with onset age, paralysis severity, relapse rate, or duration. Among 29 patients who underwent AQP4 antibody assay, 17 (58.6%) were positive. There was no difference between seropositive and seronegative patients in terms of female preponderance, onset age, relapse rate, and Expanded Disability Status Scale score. However, seropositive patients had significantly more damaged segments (8.3 ± 3.5) than did seronegative patients (4.5 ± 1.6) (p < 0.001). The data revealed the clinical and MRI characteristics and AQP4 antibody status of NMO in Chinese patients and the correlations between them, which may have important implications for the diagnosis of the disease.

Variations of IGHMBP2 gene was not the major cause of Han Chinese patients with non-5q-spinal muscular atrophies.

Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 (IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711+1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.

Novel SLC20A2 mutations identified in southern Chinese patients with idiopathic basal ganglia calcification.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations (c.82G>A p.D28N, c.185T>C p.L62P, c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G>A) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2, which facilitates the understanding of the genotype-phenotype correlation of IBGC.

Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing.

BACKGROUND: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

Noninvasive urine-derived cell lines derived from neurological genetic patients.

Many major inherited neurological disorders are characterized by early childhood onset, high lethality rate, and the absence of effective treatments. A poor understanding of the underlying mechanisms of such disorders is partly because of the scarcity of patient-specific samples. In this study, we cultured the urine sediments of such patients, aiming to explore the capacity of urine cell cultures to obtain specimens from patients suffering from rare inherited neurological diseases. We collected fresh urine from a variety of neurogenetic patients; cultured the specimens; generated different urine cell lines; and classified these cell lines through morphology, reverse transcription-PCR, and immunofluorescence. We then used these cell lines to detect the affected genes in spinal muscular atrophy and Duchenne muscular dystrophy. We successfully established cell lines from patients with spinal muscular atrophy, Duchenne muscular dystrophy, paroxysmal kinesigenic dyskinesia, and Wilson's disease. All established cell lines consisted of urinary tract epithelial cells and podocytes, and had the same gene defects as the blood specimens. Urine cell culture is thus a new, simple, and noninvasive avenue for getting patient-specific samples not only for genetic diagnosis, but also for storing the samples from patients with rare neurological inherited diseases.

Molecular analysis of SMN1, SMN2, NAIP, GTF2H2, and H4F5 genes in 157 Chinese patients with spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Modification of phenotype by SMN2 copy numbers in two Chinese families with SMN1 deletion in two continuous generations.

BACKGROUND: As a lethal autosomal recessive hereditary disorder, childhood spinal muscular atrophy (SMA) is caused by mutations of the survival motor neuron 1 (SMN1) gene. Most of the patients died at early stage or were seriously disabled, which accounts partly for the scarcity of two continuous generations with SMA. Increasing evidence indicated that SMN2 copy number was a modifier of SMA, but in majority of sporadic patients, the bias of phenotype judgments may largely reduce the accuracy of genotype-phenotype analysis. METHODS: We presented two families with SMN1-deleted individuals in two continuous generations, the father and daughter of family 1 and the mother and daughter of family 2 were determined to be homozygous for the deletion of the SMN1 gene. Quantitative analysis of SMN1 and SMN2 was carried out by real-time fluorescence quantitative PCR and multiplex ligation-dependent probe amplification. RESULTS: Quantitative analysis showed that the father of family 1 possessed three copies of SMN2, and his daughter had only two SMN2 copies; the slightly affected mother of family 2 had three copies of SMN2, but her sick daughter had only two copies of SMN2; we also performed prenatal prediction for family 1 and a healthy boy was born under our suggestion. CONCLUSION: For the phenotypes of patients from different generations within the same family are obviously different, the results of a genotype-phenotype analysis may be more convincing, which strongly support the hypothesis that SMN2 is an important modifier for SMA, and SMN2 copy number should be considered in the prenatal diagnosis situation.

Exome sequencing identifies truncating mutations in PRRT2 that cause paroxysmal kinesigenic dyskinesia.

Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal movement disorder and is often misdiagnosed clinically as epilepsy. Using whole-exome sequencing followed by Sanger sequencing, we identified three truncating mutations within PRRT2 (NM_145239.2) in eight Han Chinese families with histories of paroxysmal kinesigenic dyskinesia: c.514_517delTCTG (p.Ser172Argfs*3) in one family, c.649dupC (p.Arg217Profs*8) in six families and c.972delA (p.Val325Serfs*12) in one family. These truncating mutations co-segregated exactly with the disease in these families and were not observed in 1,000 control subjects of matched ancestry. PRRT2 is a newly discovered gene consisting of four exons encoding the proline-rich transmembrane protein 2, which encompasses 340 amino acids and contains two predicted transmembrane domains. PRRT2 is highly expressed in the developing nervous system, and a truncating mutation alters the subcellular localization of the PRRT2 protein. The function of PRRT2 and its role in paroxysmal kinesigenic dyskinesia should be further investigated.

Molecular analysis of 51 unrelated pedigrees with late-onset multiple acyl-CoA dehydrogenation deficiency (MADD) in southern China confirmed the most common ETFDH mutation and high carrier frequency of c.250G>A.

Multiple acyl-CoA dehydrogenation deficiency (MADD) is an autosomal recessive disease affecting amino acid, fatty acid, and choline metabolisms and is a common genetic defect responsible for lipid storage myopathy. Most forms of MADD are caused by a deficiency of electron transfer flavoprotein (ETF) or ETF dehydrogenase (ETFDH). However, its molecular feature has not been found uniformly in previous reports of Chinese patients. A large cohort of 56 late-onset MADD patients from 51 unrelated pedigrees in southern China was recruited to investigate a clear correlation between clinical phenotype and molecular genetic basis. All exons of ETFA, ETFB, and ETFDH, including the intron-exon boundaries, and 5' and 3' untranslated regions were directly sequenced. ETFDH deficiencies affected 94.1% (48/51) of the pedigrees. ETFDH-c.250G>A is the most common mutation, representing a high allelic frequency of 83.3% (80/96). Carrier frequency of c.250G>A is estimated to be 1.35% (7/520) in the normal population. A significant reduced expression of ETFDH was identified in the muscle of ETFDH-deficient patients. ETFDH deficiency is a major cause of riboflavin-responsive MADD in southern China, and c.250G>A is an important mutation that could be employed as a fast and reliable screening method.

Distinguishing the 4qA and 4qB variants is essential for the diagnosis of facioscapulohumeral muscular dystrophy in the Chinese population.

Facioscapulohumeral muscular dystrophy (FSHD) is the third most common inherited muscular dystrophy with markedly clinical variability and complex genetic cause. Several reports pertaining to the Caucasian population have confirmed that there are 4qA and 4qB variants of the 4qter subtelomere, and FSHD is uniquely associated with the 4qA variant. However, few data relevant to the Chinese population have been published. In present paper, detailed clinical and genetic re-evaluations were performed in members of four special families who had been initially diagnosed as atypical or asymptomatic FSHD based only on the D4Z4 repeat length analysis. The FSHD-sized D4Z4 repeats in the probands from families 1, 2 and 3 were identified as 4qB variants. These patients were further confirmed as limb-girdle muscular dystrophy (LGMD2) or myotonic dystrophy (DM1) by molecular analyses. Specifically, we identified a 4qB variant on chromosome 10 in the healthy members of the fourth FSHD family with complex D4Z4 rearrangements of two exchanged repeat arrays. For the first time, we demonstrated in the Chinese population that D4Z4 contractions on the 4qB variant do not cause FSHD and 4qB variant on chromosome 10 might also represent intermediate structures in the transition from 4q to 10q. Furthermore, our results emphasize that D4Z4 repeat length analysis alone is not sufficient for the diagnosis of FSHD, especially when used as an exclusion criterion. This analysis should be accompanied by 4qA/4qB variant determination and integrated chromosome assignments, especially in patients with obscure and unclassified myopathies similar to atypical forms of FSHD.

Mild hypothermia reduces ischemic neuron death via altering the expression of p53 and bcl-2.

OBJECTIVE: Studies exploring roles of p53 and bcl-2 in neuroprotection by hypothermia in focal cerebral ischemia have not provided consistent results. In the present study, we determined whether p53 and bcl-2 are involved in the hypothermia-induced neuroprotection. METHODS: Male Sprague-Dawley rats were divided into four groups: normothermic (37-38 degrees C) ischemia, hypothermic (31-32 degrees C) ischemia, hyperthermic (41-42 degrees C) ischemia and sham-operated group. Global cerebral ischemia was established for 20 minutes using the Pulsinelli four-vessel occlusion model and the brain temperature was maintained at defined levels for 60 minutes following the 20 min ischemia. The mortality in rats was evaluated at 72 hour and 168 hour reperfusion. The expression of p53 and bcl-2 proteins was detected at 24, 48 and 72 hours after reperfusion. At the same intervals, neuron necrosis and apoptosis in brain regions was also detected using hematoxylin and eosin (HE) staining and terminal deoxynucleotldyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL). RESULTS: The mortalities of rats in normothemia, hypothermia and hyperthermia groups was 33.3, 16.7 and 50% at 72 hour reperfusion. At 168 hours of reperfusion, the mortality in the three groups was 58.3, 25 and 100%, respectively. In light microscopy studies, necrotic neurons and apoptotic neurons were found in the hippocampus after global cerebral ischemia. Surviving neurons in hippocampus was increased in mild hypothermic ischemia group (p<0.05) and decreased in hyperthermia ischemia group (p<0.01) at 24, 48 and 72 hour reperfusion. TUNEL-positive neurons in hippocampus decreased in hypothermic ischemia group (p<0.05 or p<0.01) and increased in hyperthermic ischemia group (p<0.01) at 24, 48 and 72 hour reperfusion. The expression of p53 and bcl-2 proteins was found in the neurons of cerebral cortex after global cerebral ischemia. P53 decreased and bcl-2 increased in hypothermia group. CONCLUSION: Hypothermia reduces ischemic neuronal necrosis and apoptosis by reducing p53 and increasing bcl-2 expression. Hyperthermia accelerated ischemic neuronal injury by increasing p53 and reducing bcl-2 expression.

High frequency of Machado-Joseph disease identified in southeastern Chinese kindreds with spinocerebellar ataxia.

BACKGROUND: Machado-Joseph disease (MJD), caused by a CAG repeat expansion located in exon10 of the ATXN3 gene, is now regarded as one of the most common spinocerebellar ataxia (SCA) in the world. The relative frequency of MJD among SCA has previously been estimated at about 50% in the Chinese population and has been reported to be related to the frequency of large normal alleles in some populations. Taq polymerase has been used for PCR in nearly all studies reported previously. METHODS: Normal and expanded alleles of ATXN3 were detected via PCR using LA Taq DNA polymerase (better for GC-rich sequences) and denaturing polyacrylamide gel electrophoresis in 150 normal individuals and 138 unrelated probands from autosomal dominant SCA families. To compare reaction efficiency, 12 MJD patients' expanded alleles were amplified with La Taq and Taq polymerase respectively in the same amplifying systems and reaction conditions. RESULTS: Normal alleles ranged from 12 to 42 CAG repeats. The most common allele contained 14 repeats with a frequency of 23.3%, which corroborates previous reports. The frequency of large normal alleles (>27 repeats) was 0.28, which was very high relative to previous reports. The frequency of MJD in SCA patients was 72.5%, which was significantly higher than those in previous reports about the Chinese and other Asian populations. This frequency was one of the highest reported worldwide, with only Portuguese and Brazilian populations exhibiting higher proportions. All 12 expanded alleles were amplified in PCR with La Taq polymerase, whereas only 2 expanded alleles were amplified with Taq polymerase. CONCLUSION: We have first reported the highest relative frequency of MJD in Asia, and we attribute this high frequency to a more efficient PCR using LA Taq polymerase and hypothesized that large ANs may act as a reservoir for expanded alleles in the Southeastern Chinese population.

The R219K polymorphism in the ATP-binding cassette transporter 1 gene has a protective effect on atherothrombotic cerebral infarction in Chinese Han ethnic population.

The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Here we wish to address this issue. A total of 476 subjects from Chinese Han ethnic population were investigated, including 152 control individuals and 324 patients with cerebral infarction. Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Data were analyzed using a statistical package. The R219K genotype frequency distributions were significantly different between patients with atherothrombotic cerebral infarction (ACI) and control individuals, with fewer KK genotypes and more RR genotypes in ACI patients (chi(2)=9.89, P<0.01). The K allele is less frequent among ACI patients than in controls (chi(2)=9.16, P<0.005). A significant association of KK with decreased ACI risk was exhibited, especially in male patients, aged patients and individuals with hypertension. These results indicate that the K allele of R219K polymorphism is an independent protective factor against ACI. In addition, though there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI.

[Characteristics of gene structure in facioscapulohumeral muscular dystrophy-related 4q35 subtelomere and genotype-phenotype correlation in Chinese Han population].

OBJECTIVE: To investigate the characteristics of gene structure in facioscapulohumeral muscular dystrophy (FSHD)-related 4q35 subtelomere, to analyze the distribution of 2 alleles (4qA and 4qB) distal to D4Z4 of this locus, and to further elucidate the genotype-phenotype correlation in Chinese Han FSHD patients. METHODS: Peripheral blood samples were collected from 52 unrelated families including 62 FSHD-affected and 57 unaffected members. Genomic DNA was extracted from the lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoRI or HindIII, or double digested with EcoRI and BlnI. The cleaved DNA was separated by pulsed field electrophoresis (PFGE) and Southern blotting with the probes p13E-11, 4qA, and 4qB. The size of FSHD-causing 4qA allele and its distribution was analyzed by "curve fitting". Then the characteristics of translocation and mosaicism, the frequencies of two allelic variants of chromosome 4q and their genotypes were calculated to analyze the genotype-phenotype correlation. RESULTS: It was found that 69 patients carried a short chromosome 4-type allele of 4qA origin with the length 10-38 kb. The mean length of these pathogenic EcoRI/4qA arrays was 20 kb+/-7 kb, without significant difference between the sporadic cases and familial cases (t=1.413, P>0.05). Three different translocation types were observed with a translocation rate of 14.49%. The rate of 4q-->10q translocation was 13.04%, significantly higher than that of 10q-->4q translocation (1.45%, chi2=6.900, P<0.05). Somatic mosaicism was detected in a male sporadic case and a female asymptomatic familial case. In 57 cases with standard configuration distribution, the frequency of 4qA/4qB heterozygote was 61.40%, significantly higher than that of 4qA/4qA homozygote (38.60%, (chi2=5.930, P<0.05). There were not significant differences in the repeat size distributions and assessment of clinical severity between the sporadic and familial cases (t=-0.039, P>0.05; H=0.693, P>0.05). CONCLUSION: About 95% of Chinese FSHD patients carry a pathogenic 4-type allele of 4qA origin less than 30 kb long. The frequent translocations between chromosome 4q and 10q may play an essential role for FSHD mechanism. The frequency of 4qA/4qB heterozygote is significantly higher than that of 4qA/4qA homozygote, while the allelic variant genotypes do not contribute to modify FSHD manifestations.

A novel mutation in the senataxin gene identified in a Chinese patient with sporadic amyotrophic lateral sclerosis.

Our objective was to investigate the association between senataxin mutations and sporadic amyotrophic lateral sclerosis (ALS) in Chinese patients. DNA from 45 sporadic ALS patients was screened for mutations in senataxin using polymerase chain reaction (PCR) and direct sequencing. A novel variation, Thr1118Ile, was identified in a 42-year-old individual with sporadic ALS. This variation was not detected in 200 unrelated control individuals. In conclusion, the presence of this variation in a patient with sporadic ALS, and its absence in 200 controls, supports an association between senataxin and sporadic ALS. This study has broadened the mutation spectrum of senataxin and expanded the clinical phenotypes of senataxin mutations.

Association between Ngb polymorphisms and ischemic stroke in the Southern Chinese Han population.

BACKGROUND: Neuroglobin (Ngb), one of novel members of the globin superfamily, is expressed predominantly in brain neurons, and appears to modulate hypoxic-ischemic insults. The mechanisms underlying Ngb-mediated neuronal protection are still unclear. For it is one of the candidate protective factors for ischemic stroke, we conducted a case-control study to clarify the association of Ngb polymorphisms with ischemic stroke in the Southern Chinese Han population. METHODS: 355 cases and 158 controls were recruited. With brain imaging, cases were subdivided into large-artery atherosclerosis (LVD) and small-vessel occlusion (SVD) stroke. PCR amplified all the four exons of Ngb and flanking intron sequence for each exon. Genotyping for Ngb was achieved by direct sequencing and mismatched PCR-RFLP. Polymorphisms were studied both individually and as haplotypes in each group and subgroup which subdivided according to gender or age. RESULTS: Two intronic polymorphisms 89+104 c>t and 322-110 (6a)>5a were identified. The allele frequency of 89+104 t was decreased in stroke cases. The protective effect seems to be more pronounced in subgroups of female patients and age > 60 years. Also, we have confirmed decreased LDL-C level and reduced hypertension and hypercholesterolemia in 89+104 t allele carriers. In contrast, the 322-110 (6a)>5a genotype distribution was similar between cases and controls. However, the haplotype 89+104 c>t/322-110 (6a)>5a was related with LVD and SVD stroke. The haplotype c-5a was more frequent in both LVD and SVD groups while t-6a was more frequent in controls. CONCLUSION: Ngb polymorphism 89+104 t had protective effects on LVD and SVD in the Southern Chinese Han population. A "hitchhiking" effect was observed for the 89+104 t/322-110 (6a) genotype combination especially for LVD.

Novel mutation in the ABCA1 gene identified in a chinese patient with dementia and atherothrombotic cerebral infarction.

BACKGROUND: To date, 81 mutations of ATP-binding cassette transporter 1 (ABCA1) have been reported. However, no ABCA1 mutation has been reported in the Chinese population. METHODS: We used direct sequencing to screen for ABCA1 mutations in 72 patients with both atherosclerotic cerebral infarction (ACI) and plasma high-density lipoprotein cholesterol (HDL-C) < 0.8 mmol/l. The functionality of the mutation was verified using 200 unrelated controls and 76 patients with ACI and normal HDL-C by PCR-RFLP analysis. RESULTS: One patient with dementia prior to ACI was found to carry the heterozygous Y2206D mutation, which has not been reported previously. The patient had a medical history of atherosclerosis in the coronary and carotid arteries going back 40 years and splenohepatomegalia for 13 years, with a low plasma HDL-C level (0.66 mmol/l) and apolipoprotein A1 level (0.61 mmol/l). During the past decade, he had developed symptoms of dementia. Sixteen months prior to the study, he was admitted to hospital for an ACI. CONCLUSION: The results suggest that this patient is most likely a patient with familial hypoalphalipoproteinemia and that the Y2206D mutation may be associated with not only a lower level of HDL-C, but also with dementia.

[Deficient mRNA expression of specific protein 3 gene in peripheral blood mononuclear cells from patients with multiple sclerosis].

OBJECTIVE: To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes. METHODS: Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls. RESULTS: Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P< 0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P< 0.05). CONCLUSION: Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.