Directing in Vitro Selection towards G-quadruplex-forming Aptamers to Inhibit HMGB1 Pathological Activity.

In the search for novel, effective inhibitors of High-Mobility Group Box1 (HMGB1)-a protein involved in various inflammatory and autoimmune diseases as well as in cancer-we herein discovered a set of anti-HMGB1 G-quadruplex(G4)-forming aptamers by using an in vitro selection procedure applied to a doped library of guanine-rich oligonucleotides. The selected DNA sequences were then studied in a pseudo-physiological buffer mimicking the extracellular medium, where HMGB1 exerts its pathological activity, using spectroscopic, electrophoretic, and chromatographic techniques. All the oligonucleotides proved to fold into monomeric G4s and in some cases also dimeric species, stable at physiological temperature. Remarkably, the protein preferentially recognized the sequences forming dimeric parallel G4 structures, as evidenced by a properly designed chemiluminescent binding assay which also highlighted a good selectivity of these aptamers for HMGB1. Moreover, all aptamers showed anti-HMGB1 activity, inhibiting protein-induced cell migration. The acquired data allowed identifying L12 as the best anti-HMGB1 aptamer, featured by high thermal and enzymatic stability, no toxicity at least up to 5 µM concentration on healthy cells, along with potent anti-HMGB1 activity (IC50 ca. 28 nM) and good binding affinity for the protein, thus indicating it as a very promising lead candidate for in vivo studies.

Design, Synthesis, and Characterization of an Amphiphilic Lipoic Acid-Based Ru(III) Complex as a Versatile Tool for the Functionalization of Different Nanosystems.

Ru-based chemotherapy is emerging as an effective alternative to the well-established Pt-based one, typically associated with high toxicity. In this context, our recent efforts were devoted to the preparation of nucleolipid-based Ru(III) complexes able to form, under physiological conditions, supramolecular aggregates which can efficiently prevent metal deactivation and convey Ru(III) inside the cells where it exerts its activity. Within an interdisciplinary program for the development of multifunctional nanoparticles for theranostic applications, we here report the design, synthesis, and characterization of a novel functionalized Ru(III) salt, carrying a lipoic acid moiety in the nucleolipid-based scaffold to allow its incorporation onto metal-based nanoparticles.

Exploring the Binding of Natural Compounds to Cancer-Related G-Quadruplex Structures: From 9,10-Dihydrophenanthrenes to Their Dimeric and Glucoside Derivatives.

In-depth studies on the interaction of natural compounds with cancer-related G-quadruplex structures have been undertaken only recently, despite their high potential as anticancer agents, especially due to their well-known and various bioactivities. In this frame, aiming at expanding the repertoire of natural compounds able to selectively recognize G-quadruplexes, and particularly focusing on phenanthrenoids, a mini-library including dimeric (1-3) and glucoside (4-5) analogues of 9,10-dihydrophenanthrenes, a related tetrahydropyrene glucoside (6) along with 9,10-dihydrophenanthrene 7 were investigated here by several biophysical techniques and molecular docking. Compounds 3 and 6 emerged as the most selective G-quadruplex ligands within the investigated series. These compounds proved to mainly target the grooves/flanking residues of the hybrid telomeric and parallel oncogenic G-quadruplex models exploiting hydrophobic, hydrogen bond and π-π interactions, without perturbing the main folds of the G-quadruplex structures. Notably, a binding preference was found for both ligands towards the hybrid telomeric G-quadruplex. Moreover, compounds 3 and 6 proved to be active on different human cancer cells in the low micromolar range. Overall, these compounds emerged as useful ligands able to target G-quadruplex structures, which are of interest as promising starting scaffolds for the design of analogues endowed with high and selective anticancer activity.

Selective Targeting of Cancer-Related G-Quadruplex Structures by the Natural Compound Dicentrine.

Aiming to identify highly effective and selective G-quadruplex ligands as anticancer candidates, five natural compounds were investigated here, i.e., the alkaloids Canadine, D-Glaucine and Dicentrine, as well as the flavonoids Deguelin and Millettone, selected as analogs of compounds previously identified as promising G-quadruplex-targeting ligands. A preliminary screening with the G-quadruplex on the Controlled Pore Glass assay proved that, among the investigated compounds, Dicentrine is the most effective ligand of telomeric and oncogenic G-quadruplexes, also showing good G-quadruplex vs. duplex selectivity. In-depth studies in solution demonstrated the ability of Dicentrine to thermally stabilize telomeric and oncogenic G-quadruplexes without affecting the control duplex. Interestingly, it showed higher affinity for the investigated G-quadruplex structures over the control duplex (Kb~106 vs. 105 M-1), with some preference for the telomeric over the oncogenic G-quadruplex model. Molecular dynamics simulations indicated that Dicentrine preferentially binds the G-quadruplex groove or the outer G-tetrad for the telomeric and oncogenic G-quadruplexes, respectively. Finally, biological assays proved that Dicentrine is highly effective in promoting potent and selective anticancer activity by inducing cell cycle arrest through apoptosis, preferentially targeting G-quadruplex structures localized at telomeres. Taken together, these data validate Dicentrine as a putative anticancer candidate drug selectively targeting cancer-related G-quadruplex structures.

Selective light-up of dimeric G-quadruplex forming aptamers for efficient VEGF165 detection.

To develop efficient anticancer theranostic systems, we studied the interaction between a cyanine dye, analogue of thiazole orange (named CyOH), and two G-quadruplex-forming aptamers, V7t1 and 3R02, recognizing the Vascular Endothelial Growth Factor 165 (VEGF165) - an angiogenic protein overexpressed in cancer cells, responsible for the rapid growth and metastases of solid tumours. We demonstrated, by exploiting different biophysical techniques - i.e. gel electrophoresis, circular dichroism (CD), UV-vis and fluorescence spectroscopy - that this cyanine interacted with both aptamers giving a marked fluorescence light-up only when bound to their dimeric forms. Interestingly, both oligonucleotides recognized VEGF165 with higher affinity when adopting dimeric G-quadruplexes, largely prevalent over their monomeric forms in pseudo-physiological conditions. Notably, the fluorescence light-up produced by the probe was maintained when the dimeric aptamer-CyOH complexes bound to the target protein. These complexes, tested on MCF-7 cancer cells using non-tumorigenic MCF-10A cells as control, were effectively internalized in cells and colocalized with a fluorescently-labelled anti-VEGF-A antibody, allowing both recognition and detection of the target. Our experiments showed that the studied systems are promising tools for anticancer theranostic strategies, combining the therapeutic potential of the G4-forming anti-VEGF aptamers with the diagnostic efficacy of the cyanine selective fluorescence light-up.

Insights into the Small Molecule Targeting of Biologically Relevant G-Quadruplexes: An Overview of NMR and Crystal Structures.

G-quadruplexes turned out to be important targets for the development of novel targeted anticancer/antiviral therapies. More than 3000 G-quadruplex small-molecule ligands have been described, with most of them exerting anticancer/antiviral activity by inducing telomeric damage and/or altering oncogene or viral gene expression in cancer cells and viruses, respectively. For some ligands, in-depth NMR and/or crystallographic studies were performed, providing detailed knowledge on their interactions with diverse G-quadruplex targets. Here, the PDB-deposited NMR and crystal structures of the complexes between telomeric, oncogenic or viral G-quadruplexes and small-molecule ligands, of both organic and metal-organic nature, have been summarized and described based on the G-quadruplex target, from telomeric DNA and RNA G-quadruplexes to DNA oncogenic G-quadruplexes, and finally to RNA viral G-quadruplexes. An overview of the structural details of these complexes is here provided to guide the design of novel ligands targeting more efficiently and selectively cancer- and virus-related G-quadruplex structures.

Selection of RNA aptamers targeting hypoxia in cancer.

Hypoxia plays a crucial role in tumorigenesis and drug resistance, and it is recognised as a major factor affecting patient clinical outcome. Therefore, the detection of hypoxic areas within the tumour micro-environment represents a useful way to monitor tumour growth and patients' responses to treatments, properly guiding the choice of the most suitable therapy. To date, non-invasive hypoxia imaging probes have been identified, but their applicability in vivo is strongly limited due to an inadequate resistance to the low oxygen concentration and the acidic pH of the tumour micro-environment. In this regard, nucleic acid aptamers represent very powerful tools thanks to their peculiar features, including high stability to harsh conditions and a small size, resulting in easy and efficient tumour penetration. Here, we describe a modified cell-SELEX (Systematic Evolution of Ligands by EXponential enrichment) approach that allows the isolation of specific RNA aptamers for the detection of the hypoxic phenotype in breast cancer (BC) cells. We demonstrated the effectiveness of the proposed method in isolating highly stable aptamers with an improved and specific binding to hypoxic cells. To our knowledge, this is the first example of a cell-SELEX approach properly designed and modified to select RNA aptamers against hypoxia-related epitopes expressed on tumour cell surfaces. The selected aptamers may provide new effective tools for targeting hypoxic areas within the tumour with great clinical potential.

Bioengineered lipophilic Ru(III) complexes as potential anticancer agents.

Lipid-conjugated Ru(III) complexes - designed to obtain lipophilic analogues of the low molecular weight derivative AziRu, which is a NAMI-A-like anticancer agent - have been synthesized and fully characterized. A detailed biophysical investigation, including multiple, integrated techniques, allowed determining their molecular and self-assembling properties in aqueous solutions mimicking the extracellular environment, showing that our design produced a protective effect from hydrolysis of the Ru(III) complexes. In vitro biological experiments, carried out in comparison with AziRu, demonstrated that, among the novel lipophilic Ru(III) complexes synthesized, the compounds derivatized with palmitic and stearic acid, that we named PalmiPyRu and StePyRu respectively, showed attractive features and a promising antiproliferative activity, selective on specific breast cancer phenotypes. To get a deeper insight into their interactions with potential biomacromolecular targets, their ability to bind both bovine serum albumin (BSA), an abundant serum carrier protein, and some DNA model systems, including duplex and G-quadruplex structures, has been investigated by spectroscopic techniques. Inductively coupled plasma-mass spectrometry (ICP-MS) analysis of the ruthenium amount incorporated in human MCF-7 and MDA-MB-231 breast cancer cells, after incubation in parallel experiments with PalmiPyRu and AziRu, showed a markedly higher cell uptake of the lipophilic Ru(III) complex with respect to AziRu. These data confirmed that the proper lipidic tail decorating the metal complex not only favoured the formation of aggregates in the extracellular media but also improved their cell membrane penetration, thus leading to higher antiproliferative activity selective on breast cancer cells.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Affinity Chromatography-Based Assays for the Screening of Potential Ligands Selective for G-Quadruplex Structures.

DNA G-quadruplexes (G4s) are key structures for the development of targeted anticancer therapies. In this context, ligands selectively interacting with G4s can represent valuable anticancer drugs. Aiming at speeding up the identification of G4-targeting synthetic or natural compounds, we developed an affinity chromatography-based assay, named G-quadruplex on Oligo Affinity Support (G4-OAS), by synthesizing G4-forming sequences on commercially available polystyrene OAS. Then, due to unspecific binding of several hydrophobic ligands on nude OAS, we moved to Controlled Pore Glass (CPG). We thus conceived an ad hoc functionalized, universal support on which both the on-support elongation and deprotection of the G4-forming oligonucleotides can be performed, along with the successive affinity chromatography-based assay, renamed as G-quadruplex on Controlled Pore Glass (G4-CPG) assay. Here we describe these assays and their applications to the screening of several libraries of chemically different putative G4 ligands. Finally, ongoing studies and outlook of our G4-CPG assay are reported.

Natural compounds from Juncus plants interacting with telomeric and oncogene G-quadruplex structures as potential anticancer agents.

Aiming at discovering novel, putative anticancer drugs featuring low-to-null side effects, natural compounds isolated from Juncaceae were studied here for their ability to target G-quadruplex structures originating from cancer-related telomeric and oncogene DNA sequences. Particularly, various dihydrophenanthrene, benzocoumarin and dihydrodibenzoxepin derivatives were firstly screened by the affinity chromatography-based G4-CPG assay, and the compound with the highest affinity and selectivity for G-quadruplexes (named J10) was selected for further studies. Fluorescence spectroscopy and circular dichroism experiments corroborated its capability to selectively recognize and stabilize G-quadruplexes over duplex DNA, also showing a preference for parallel G-quadruplexes. Molecular docking proved that the selective G-quadruplex interactions over duplex interactions could be due to the ability of J10 to bind to the grooves of the telomeric and oncogene G-quadruplex structures. Finally, biological assays demonstrated that J10 induces significant antiproliferative effects on human leukemia cells, with no relevant effects on healthy human fibroblasts. Interestingly, J10 exerts its antiproliferative action on tumor cells by activating the apoptotic pathway.

DNA Binding Mode Analysis of a Core-Extended Naphthalene Diimide as a Conformation-Sensitive Fluorescent Probe of G-Quadruplex Structures.

G-quadruplex existence was proved in cells by using both antibodies and small molecule fluorescent probes. However, the G-quadruplex probes designed thus far are structure- but not conformation-specific. Recently, a core-extended naphthalene diimide (cex-NDI) was designed and found to provide fluorescent signals of markedly different intensities when bound to G-quadruplexes of different conformations or duplexes. Aiming at evaluating how the fluorescence behaviour of this compound is associated with specific binding modes to the different DNA targets, cex-NDI was here studied in its interaction with hybrid G-quadruplex, parallel G-quadruplex, and B-DNA duplex models by biophysical techniques, molecular docking, and biological assays. cex-NDI showed different binding modes associated with different amounts of stacking interactions with the three DNA targets. The preferential binding sites were the groove, outer quartet, or intercalative site of the hybrid G-quadruplex, parallel G-quadruplex, and B-DNA duplex, respectively. Interestingly, our data show that the fluorescence intensity of DNA-bound cex-NDI correlates with the amount of stacking interactions formed by the ligand with each DNA target, thus providing the rationale behind the conformation-sensitive properties of cex-NDI and supporting its use as a fluorescent probe of G-quadruplex structures. Notably, biological assays proved that cex-NDI mainly localizes in the G-quadruplex-rich nuclei of cancer cells.

Interference of Polydatin/Resveratrol in the ACE2:Spike Recognition during COVID-19 Infection. A Focus on Their Potential Mechanism of Action through Computational and Biochemical Assays.

In the search for new therapeutic strategies to contrast SARS-CoV-2, we here studied the interaction of polydatin (PD) and resveratrol (RESV)-two natural stilbene polyphenols with manifold, well known biological activities-with Spike, the viral protein essential for virus entry into host cells, and ACE2, the angiotensin-converting enzyme present on the surface of multiple cell types (including respiratory epithelial cells) which is the main host receptor for Spike binding. Molecular Docking simulations evidenced that both compounds can bind Spike, ACE2 and the ACE2:Spike complex with good affinity, although the interaction of PD appears stronger than that of RESV on all the investigated targets. Preliminary biochemical assays revealed a significant inhibitory activity of the ACE2:Spike recognition with a dose-response effect only in the case of PD.

From Prebiotic Chemistry to Supramolecular Biomedical Materials: Exploring the Properties of Self-Assembling Nucleobase-Containing Peptides.

Peptides and their synthetic analogs are a class of molecules with enormous relevance as therapeutics for their ability to interact with biomacromolecules like nucleic acids and proteins, potentially interfering with biological pathways often involved in the onset and progression of pathologies of high social impact. Nucleobase-bearing peptides (nucleopeptides) and pseudopeptides (PNAs) offer further interesting possibilities related to their nucleobase-decorated nature for diagnostic and therapeutic applications, thanks to their reported ability to target complementary DNA and RNA strands. In addition, these chimeric compounds are endowed with intriguing self-assembling properties, which are at the heart of their investigation as self-replicating materials in prebiotic chemistry, as well as their application as constituents of innovative drug delivery systems and, more generally, as novel nanomaterials to be employed in biomedicine. Herein we describe the properties of nucleopeptides, PNAs and related supramolecular systems, and summarize some of the most relevant applications of these systems.

Disentangling the Structure-Activity Relationships of Naphthalene Diimides as Anticancer G-Quadruplex-Targeting Drugs.

In the context of developing efficient anticancer therapies aimed at eradicating any sort of tumors, G-quadruplexes represent excellent targets. Small molecules able to interact with G-quadruplexes can interfere with cell pathways specific of tumors and common to all cancers. Naphthalene diimides (NDIs) are among the most promising, putative anticancer G-quadruplex-targeting drugs, due to their ability to simultaneously target multiple G-quadruplexes and their strong, selective in vitro and in vivo anticancer activity. Here, all the available biophysical, biological, and structural data concerning NDIs targeting G-quadruplexes were systematically analyzed. Structure-activity correlations were obtained by analyzing biophysical data of their interactions with G-quadruplex targets and control duplex structures, in parallel to biological data concerning the antiproliferative activity of NDIs on cancer and normal cells. In addition, NDI binding modes to G-quadruplexes were discussed in consideration of the structures and properties of NDIs by in-depth analysis of the available structural models of G-quadruplex/NDI complexes.

Evidence of Protein Binding by a Nucleopeptide Based on a Thyminedecorated L-Diaminopropanoic Acid through CD and In Silico Studies.

BACKGROUND: Nucleopeptides are chimeric compounds of biomedical importance carrying DNA nucleobases anchored to peptide backbones with the ascertained capacity to bind nucleic acids. However, their ability to interact with proteins involved in pathologies of social relevance is a feature that still requires investigation. The worrying situation currently observed worldwide for the COVID-19 pandemic urgently requires the research on novel anti-SARSCoV- 2 molecular weapons, whose discovery can be aided by in silico predictive studies. OBJECTIVE: The aim of this work is to explore by spectroscopic methods novel features of a thymine-bearing nucleopeptide based on L-diaminopropanoic acid, including conformational aspects as well as its ability to bind proteins, starting from bovine serum albumin (BSA) as a model protein. Moreover, in consideration of the importance of targeting viral proteins in the current fight against COVID-19, we evaluated in silico the interaction of the nucleopeptide with some of the most relevant coronavirus protein targets. METHODS: First, we investigated via circular dichroism (CD) the conformational behaviour of this thymine-bearing nucleopeptide with temperature: we observed CD spectral changes, particularly passing from 15 to 35 °C. Scanning Electron Microscopy (SEM) analysis of the nucleopeptide was also conducted on nucleopeptide solid samples. Additionally, CD binding and preliminary in silico investigations were performed with BSA as a model protein. Moreover, molecular dockings were run using as targets some of the main SARS-CoV-2 proteins. RESULTS: The temperature-dependent CD behaviour reflected the three-dimensional rearrangement of the nucleopeptide at different temperatures, with higher exposure to the solvent of its chromophores at higher temperatures compared to a more stacked structure at a low temperature. SEM analysis of nucleopeptide samples in the solid-state showed a granular morphology, with a low roughness and some thread structures. Moreover, we found through spectroscopic studies that the modified peptide bound the albumin target by inducing significant changes to the protein secondary structure. CONCLUSION: CD and preliminary in silico studies suggested that the nucleopeptide bound the BSA protein with high affinity according to different binding modes, as testified by binding energy scores lower than -11 kcal/mol. Interestingly, a predictive study performed on 3CLpro and other SARS-CoV-2 protein targets suggested the potential ability of the nucleopeptide to bind with good affinity the main protease of the virus and other relevant targets, including the RNAdependent RNA polymerase, especially when complexed with RNA, the papain-like protease, and the coronavirus helicase at the nucleic acid binding site.

On the binding of naphthalene diimides to a human telomeric G-quadruplex multimer model.

To selectively target telomeric G-quadruplex (G4) DNA, monomeric and dimeric naphthalene diimides (NDIs) were investigated as binders of multimeric G4 structures able to discriminate duplex DNA. These NDIs were analysed by the affinity chromatography-based screening G4-CPG (G-quadruplex on Controlled Pore Glass), using the sequence d[AGGG(TTAGGG)7] (tel46), folding into two consecutive G4s, as model of the human telomeric G4 multimer. In parallel, a telomeric G4 monomer (tel26) and a duplex structure (ds27) were used as controls. According to G4-CPG screening, NDI-5 proved to be the best ligand in terms of dimeric G4 vs. duplex DNA selectivity and was analysed by circular dichroism (CD), gel electrophoresis, isothermal titration calorimetry (ITC) and fluorescence spectroscopy in its interactions with tel46. NDI-5 strongly binds and stabilizes tel46 G4, favouring a hybrid folding in K+-containing buffer. Under these conditions, the binding process comprises a first event involving three molecules of NDI-5 and a second one in which other six molecules bind to the DNA. In a metal cation-free system, NDI-5 induces tel46 G4 folding, as indicated by CD and PAGE, favouring an antiparallel structuring. Docking simulations showed that NDI-5 can effectively bind to the pocket between two G4 units, representing a promising ligand for multimeric G4s.

Anti-VEGF DNA-based aptamers in cancer therapeutics and diagnostics.

The vascular endothelial growth factor (VEGF) family and its receptors play fundamental roles not only in physiological but also in pathological angiogenesis, characteristic of cancer progression. Aiming at finding putative treatments for several malignancies, various small molecules, antibodies, or protein-based drugs have been evaluated in vitro and in vivo as VEGF inhibitors, providing efficient agents approved for clinical use. Due to the high clinical importance of VEGF, also a great number of anti-VEGF nucleic acid-based aptamers-that is, oligonucleotides able to bind with high affinity and specificity a selected biological target-have been developed as promising agents in anticancer strategies. Notable research efforts have been made in optimization processes of the identified aptamers, searching for increased target affinity and/or bioactivity by exploring structural analogues of the lead compounds. This review is focused on recent studies devoted to the development of DNA-based aptamers designed to target VEGF. Their therapeutic potential as well as their significance in the construction of highly selective biosensors is here discussed.

G-quadruplex-based aptamers targeting human thrombin: Discovery, chemical modifications and antithrombotic effects.

First studies on thrombin-inhibiting DNA aptamers were reported in 1992, and since then a large number of anticoagulant aptamers has been discovered. TBA - also named HD1, a 15-mer G-quadruplex (G4)-forming oligonucleotide - is the best characterized thrombin binding aptamer, able to specifically recognize the protein exosite I, thus inhibiting the conversion of soluble fibrinogen into insoluble fibrin strands. Unmodified nucleic acid-based aptamers, in general, and TBA in particular, exhibit limited pharmacokinetic properties and are rapidly degraded in vivo by nucleases. In order to improve the biological performance of aptamers, a widely investigated strategy is the introduction of chemical modifications in their backbone at the level of the nucleobases, sugar moieties or phosphodiester linkages. Besides TBA, also other thrombin binding aptamers, able to adopt a well-defined G4 structure, e.g. mixed duplex/quadruplex sequences, as well as homo- and hetero-bivalent constructs, have been identified and optimized. Considering the growing need of new efficient anticoagulant agents associated with the strong therapeutic potential of these thrombin inhibitors, the research on thrombin binding aptamers is still a very hot and intriguing field. Herein, we comprehensively described the state-of-the-art knowledge on the DNA-based aptamers targeting thrombin, especially focusing on the optimized analogues obtained by chemically modifying the oligonucleotide backbone, and their biological performances in therapeutic applications.

Dimeric and Multimeric DNA Aptamers for Highly Effective Protein Recognition.

Multivalent interactions frequently occur in biological systems and typically provide higher binding affinity and selectivity in target recognition than when only monovalent interactions are operative. Thus, taking inspiration by nature, bivalent or multivalent nucleic acid aptamers recognizing a specific biological target have been extensively studied in the last decades. Indeed, oligonucleotide-based aptamers are suitable building blocks for the development of highly efficient multivalent systems since they can be easily modified and assembled exploiting proper connecting linkers of different nature. Thus, substantial research efforts have been put in the construction of dimeric/multimeric versions of effective aptamers with various degrees of success in target binding affinity or therapeutic activity enhancement. The present review summarizes recent advances in the design and development of dimeric and multimeric DNA-based aptamers, including those forming G-quadruplex (G4) structures, recognizing different key proteins in relevant pathological processes. Most of the designed constructs have shown improved performance in terms of binding affinity or therapeutic activity as anti-inflammatory, antiviral, anticoagulant, and anticancer agents and their number is certainly bound to grow in the next future.