ABSTRACT
UNASSIGNED: Background: Since to the prognosis of lung squamous cell carcinoma is generally poor, there is an urgent need to innovate new prognostic biomarkers and therapeutic targets to improve patient outcomes. Objectives: Our goal was to develop a novel multi-gene prognostic model linked to neutrophils for predicting lung squamous cell carcinoma prognosis. Methods: We utilized messenger RNA expression profiles and relevant clinical data of lung squamous cell carcinoma patients from the Cancer Genome Atlas database. Through K-means clustering, least absolute shrinkage and selection operator regression, and univariate/multivariate Cox regression analyses, we identified 12 neutrophil-related genes strongly related to patient survival and constructed a prognostic model. We verified the stability of the model in the Cancer Genome Atlas database and gene expression omnibus validation set, demonstrating the robust predictive performance of the model. Results: Immunoinfiltration analysis revealed remarkably elevated levels of infiltration for natural killer cells resting and monocytes in the high-risk group compared to the low-risk group, while macrophages had considerably lower infiltration in the high risk group. Most immune checkpoint genes, including programmed cell death protein 1 and cytotoxic T-lymphocyte-associated antigen 4, exhibited high expression levels in the high risk group. Tumor immune dysfunction and exclusion scores and immunophenoscore results suggested a potential inclination toward immunotherapy in the "RIC" version V2 revised high risk group. Moreover, prediction results from the CellMiner database revealed great correlations between drug sensitivity (e.g., Vinorelbine and PKI-587) and prognostic genes. Conclusion: Overall, our study established a reliable prognostic risk model that possessed significant value in predicting the overall survival of lung squamous cell carcinoma patients and may guide personalized treatment strategies. (Rev Invest Clin. 2024;76(2):116-31).
Subject(s)
Carcinoma, Squamous Cell , Lung Neoplasms , Neutrophils , Humans , Lung Neoplasms/genetics , Lung Neoplasms/pathology , Lung Neoplasms/immunology , Lung Neoplasms/drug therapy , Prognosis , Carcinoma, Squamous Cell/genetics , Carcinoma, Squamous Cell/pathology , Carcinoma, Squamous Cell/immunology , Carcinoma, Squamous Cell/drug therapy , Male , Female , Biomarkers, Tumor/genetics , Middle Aged , Aged , Gene Expression Regulation, Neoplastic , RNA, Messenger/geneticsABSTRACT
Currently, nanozymes have made important research progress in the fields of catalysis, biosensing and tumor therapy, but most of nanozymes sensing systems are single-mode detection, which are easily affected by environment and operation, so it is crucial to construct nanozymes sensing system with dual-signal detection to obtain a more stable and reliable performance. In this paper, Ag-carbon dots (Ag-CDs) bifunctional nanomaterials were synthesized using carbon dots as reducing agent and protective agent by a facile and green one-step method. A simple and sensitive colorimetric-SERS dual-mode sensing platform was constructed for the detection of glucose and glutathione(GSH) in body fluids by taking advantage of good peroxidase-like and SERS activities of Ag-CDs. Ag-CDs catalyzes H2O2 to hydroxyl radicals(â¢OH), which oxidized TMB to form ox-TMB blue solution with characteristic absorption peak at 652 nm and Raman characteristic peak at 1607 cm-1. Ag-CDs sensing method exhibited high performance for glucose and GSH with detection limits for colorimetric and SERS as low as 11.30 µM and 3.54 µM, 0.38 µM and 0.24 µM respectively (S/N = 3). In addition, Ag-CDs have good stability and uniformity, ensuring long-term applicability of catalytic system. This colorimetric-SERS dual-mode sensing platform can be used for the determination of glucose and GSH in saliva and urine, and has the advantages of simple, low cost, rapid, and high accuracy, which has a potential application prospect in biosensor and medical research.
Subject(s)
Carbon , Glucose , Colorimetry/methods , Hydrogen Peroxide , Glutathione , PeroxidasesABSTRACT
Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.
Subject(s)
Calcium , Acupuncture Therapy , Acupuncture , Acupuncture Analgesia/methods , Acupuncture Points , TechnologyABSTRACT
AIM: To compare the clinical efficacy of the Balanced energy system versus the conventional torsional ultrasound system in phacoemulsification surgeries for cataracts with varying nuclear hardness.METHODS: In this study, 120 patients(122 eyes)with age-related cataracts scheduled for surgery between November 2021 and November 2022 at our hospital were randomly divided into two groups: 58 patients(59 eyes)in the experimental group underwent surgery using the Balanced energy system, while 62 patients(63 eyes)in the control group were treated with the conventional torsional ultrasound system. Intraoperative cumulative dissipated energy(CDE), case time(CT), aspiration time(AST), and estimated fluid used(EFU)were recorded. Patients were followed-up for 3mo to examine and record the best-corrected visual acuity(BCVA)and corneal endothelial cell density(ECD), and to calculate the rate of endothelial cell loss.RESULTS: Comparing the intraoperative parameters between the two groups, there was no significant difference in CT(P>0.05), but the CDE, AST and EFU of the patients in the experimental group were lower than those of the control group(P<0.05), and the CDE of patients with grade III nuclear hardness in the experimental group was lower than the control group(P<0.05), CDE, AST and EFU in patients with grade IV nuclear hardness were lower than those in the control group(P<0.05). After 3mo of follow-up, BCVA in both groups improved significantly, and the experimental group recovered faster than the control group. At 3mo after surgery, the ECD of the two groups of patients was reduced compared with that before surgery(P<0.01), but there were no significant differences in ECD and endothelial cell loss rates between the experimental and control groups before and at 3mo after surgery(P>0.05). In grade IV nuclear hardness cataracts, the rate of endothelial cell loss in the experimental group was significantly lower than that in the control group(4.63%±4.10% vs. 6.63%±4.49%, P<0.01).CONCLUSION: The Balanced energy system and the conventional torsional ultrasound system both show high safety and efficiency in phacoemulsification of cataracts with different nuclear hardness. However, the former demonstrates substantial advantages in cases with dense nuclei, offering lower ultrasound energy, shorter aspiration and infusion times, and reduced volume of infusion fluid.
ABSTRACT
ObjectiveTo observe the clinical effect of hand controlled rhythm music therapy on unilateral spatial neglect for stroke patients. MethodsFrom September, 2020 to September, 2022, 52 patients with unilateral spatial neglect after stroke in Wuxi Central Rehabilitation Hospital were randomly divided into control group (n = 26) and observation group (n = 26). Both groups accepted routine rehabilitation, and the observation group accepted hand controlled rhythm music therapy in addition, for eight weeks. Before and after treatment, the patients were assessed with Chinese Behavioral Inattention Test-Hong Kong version (CBIT-HK) routine tests (line crossing, letter cancellation, star cancellation, line bisection, figure and shape copying, and representational drawing) and modified Barthel Index (MBI). ResultsAfter treatment, six scores of CBIT-HK routine tests and the scores of MBI increased in both groups (|t| > 3.077, P < 0.05), and they were higher in the observation group than in the control group (|t| > 2.639, P < 0.05). ConclusionHand controlled rhythm music therapy could effectively alleviate the symptoms of unilateral spatial neglect after stroke, and improve the activities of daily living.
ABSTRACT
Objective:To compare the gait characteristics of cognitive and motor dual task walking (DTW) in patients with cerebral small vessel disease (CSVD), and determine the best gait parameters to diagnose CSVD and judge the severity of the disease.Methods:A total of 106 patients with CSVD and 21 healthy individuals were included from September 1, 2020 to July 1, 2021 in the Seventh Medical Center of Chinese People′s Liberation Army General Hospital. According to the Fazekas scores, the subjects were divided into mild ( n=34, 1 point), moderate ( n=34, 2 points), severe ( n=38,3 points) groups and control group ( n=21). Participants were recorded parameters under single task walking (STW) and DTW conditions, and calculated dual task effect (DTC) through the difference between single task and dual task. The differences in gait variances and their DTC were shown by generalized estimation equations when performed in STW and DTW and 4 groups of the severity of disease. Post-hoc comparisons were corrected using Bonferroni′s method. Spearman analyses were applied to explore the correlations between gait parameters and their DTC during STW or DTW and severity of disease. Based on the Logistic model, combining predictors or probabilities were gained and applied to establish receiver operating characteristic curve in order to calculate sensitivity, specificity, and the area under the curve. Results:In the control group, there was no statistically significant difference in gait parameters between STW and DTW. In the CSVD group, the gait parameters of STW were significantly better than cognitive or motor DTW (all P<0.05). In the control group, there was no statistically significant difference in basic gait parameters under different tasks (all P>0.05). In cognitive DTW, temporal gait parameters (stride frequency and stride time) deteriorated significantly only in moderate and severe groups [stride frequency:moderate group 100.220±1.795/min,severe group 94.525±2.139/min;stride time:moderate group (1.227±0.024) s, severe group (1.299±0.031) s], but spatial parameters [stride length: control group (1.050±0.021) m, mild group (0.974±0.022) m, moderate group (0.903±0.025) m, severe group (0.793±0.026) m; stride speed: control group (0.944±0.028) m/s, mild group (0.866±0.030) m/s, moderate group (0.751±0.027) m/s, severe group (0.606±0.022) m/s] were significantly different among all groups (except the control group and mild group;all P<0.05). The DTC of all gait parameters during cognitive DTW was higher than that during motor DTW (all P<0.05) for CSVD patients. While no any difference was found between cognitive DTW and motor DTW in the control group (all P>0.05). Similarly, the temporal parameters′ DTC of cognitive DTW was abnormal only in the late stage of disease, while the spatial parameters′ DTC showed statistically significant difference among all the groups (including the control group and the mild group;all P<0.05). Correlation coefficients of the spatial parameters and their DTC in condition of cognitive DTW were significantly higher than temporal parameters and their DTC (0.50< r<0.64 vs 0.15< r<0.39). The area under curve of the combined predictor was significantly higher than that of any single index. Conclusions:Cognitive DTW can better reflect the abnormal gait of CSVD patients. The spatial parameters and DTC of cognitive DTW could effectively diagnose CSVD and distinguish the disease of severity. And DTC might be better indicators. For diagnosis of CSVD, there was no significant discrepancy between the spatial parameters and DTC, but the combined predictor could significantly improve the sensitivity and reduce the false negative rate.
ABSTRACT
A male child, aged 5 years and 3 months, was admitted to the Oncology Department with a history of pain in both hip joints, headache, and diplopia lasting for 40 days. Physical examination did not reveal definitive signs or obvious abnormalities in the nervous system. Imaging studies showed only abnormalities in the craniocerebrum and spinal cord. Routine cerebrospinal fluid (CSF) analysis revealed elevation in the total number of white blood cells, mainly mononuclear cells. Biochemical analysis of CSF showed normal glucose and chloride levels, and increased protein concentrations. The possibility of central nervous system (CNS) infection was initially considered. Subsequently, antibacterial and antiviral therapy was administered; however, this treatment was ineffective. Further examination of CSF through immunophenotyping revealed mature B-cell lymphoma with CNS involvement; there were no neoplastic lesions detected elsewhere in the body. Thus, the patient was diagnosed with primary central nervous system lymphoma (PCNSL). Complete remission was achieved after chemotherapy with the CNCL-2017-mature B-cell lymphoma regimen. Thus far, all chemotherapy cycles have been completed, the patient remains in complete remission, and the follow-up is ongoing. Clinicians should pay close attention to PCNSL in children.
ABSTRACT
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
ABSTRACT
Compared with single therapy, radiotherapy combined with chemotherapy, endocrine therapy, molecular targeted therapy and immunological therapy can not only shorten the treatment cycle, but also improve the local control rate and prolong the survival of patients. However, the safety of combined therapy still needs to be further clarified to comprehensively evaluate the feasibility. Therefore, exploring the efficacy and safety of radiotherapy combined with systematic therapy will provide evidence for clinical benefits.
ABSTRACT
Objective:To explore the clinical features of childhood lymphoma complicated with Pneumocystis jirovecii pneumonia (PJP).Methods:The clinical data, diagnosis and treatment of 5 children with lymphoma complicated with PJP admitted to Beijing Children's Hospital from January 2013 to April 2022 were retrospectively analyzed.Results:Among 5 patients, there were 3 males and 2 females, the median onset age was 7 years old; 4 cases were non-Hodgkin lymphoma and 1 case was Hodgkin lymphoma. Fever and cough occurred 5-18 months after chemotherapy; typical mosaic sign could be seen in 2 cases without pneumothorax and pleural effusion as well as other pathogenic infection; all 5 cases had hypoxemia; 4 cases were diagnosed by next-generation sequencing (NGS). The CD4/CD8 ratio decreased in all cases, and the median CD4 positive T-cell was 200/μl. Trimethoprim-sulfamethoxazole (TMP-SMZ) was irregularly used in 3 cases. During the treatment, all cases received mechanical ventilation, TMP-SMZ intravenously dripping combined with caspofungin, glucocorticoid and gamma globulin. All 5 cases of PJP were cured and there was no recurrent infection.Conclusions:Lymphoma children are susceptible to PJP due to immunocompromise caused by chemotherapy, and their condition progresses rapidly. When encountering fever, shortness of breath, severe lung symptoms and mild signs of children, it is necessary to improve the vigilance of PJP. NGS can help diagnosis, and TMP-SMZ should be actively treated and prevented. Early diagnosis and active treatment can achieve a good prognosis.
ABSTRACT
MicroRNAs (miRNAs) are mediators of the aging process. The purpose of this work was to analyze the miRNA expression profiles of spermatozoa from men of different ages with normal fertility. Twenty-seven donors were divided into three groups by age (Group A, n = 8, age: 20-30 years; Group B, n = 10, age: 31-40 years; and Group C, n = 9, age: 41-55 years) for high-throughput sequencing analysis. Samples from 65 individuals (22, 22, and 21 in Groups A, B, and C, respectively) were used for validation by quantitative real-time polymerase chain reaction (qRT-PCR). A total of 2160 miRNAs were detected: 1223 were known, 937 were newly discovered and unnamed, of which 191 were expressed in all donors. A total of 7, 5, and 17 differentially expressed microRNAs (DEMs) were found in Group A vs B, Group B vs C, and Group A vs C comparisons, respectively. Twenty-two miRNAs were statistically correlated with age. Twelve miRNAs were identified as age-associated miRNAs, including hsa-miR-127-3p, mmu-miR-5100_L+2R-1, efu-miR-9226_L-2_1ss22GA, cgr-miR-1260_L+1, hsa-miR-652-3p_R+1, pal-miR-9993a-3p_L+2R-1, hsa-miR-7977_1ss6AG, hsa-miR-106b-3p_R-1, hsa-miR-186-5p, PC-3p-59611_111, hsa-miR-93-3p_R+1, and aeca-mir-8986a-p5_1ss1GA. There were 9165 target genes of age-associated miRNAs. Gene Ontology (GO) analysis of the target genes identified revealed enrichment of protein binding, membrane, cell cycle, and so on. The Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of age-related miRNAs for target genes revealed 139 enriched pathways, such as signaling pathways regulating stem cell pluripotency, metabolic pathways, and the Hippo signaling pathway. This suggests that miRNAs play a key role in male fertility changes with increasing age and provides new evidence for the study of the mechanism of age-related male fertility decline.
Subject(s)
Humans , Male , Young Adult , Adult , Middle Aged , MicroRNAs/genetics , Signal Transduction/genetics , Spermatozoa/metabolism , Gene Expression ProfilingABSTRACT
Objective To investigate the fluorescence resonance energy transfer (FRET) effect between dylight (DL) and AuNP (AuNP), and to construct a new fluorescence immunoassay for insulin in combination with the immunocompetition method. Methods Insulin antigen (Ag) and insulin antibody (Ab) were conjugated with DL and AuNP respectively to form DL-Ag conjugate and AUNp-AB conjugate. A novel fluorescence immunoassay for insulin was developed on the basis of FRET effect and the immune competition response between them. Then the performance of the method was evaluated and its application in actual samples was explored. Results The fluorescence immunoassay showed high sensitivity (0.015 ng/mL), short measurement time (4 min) and good specificity. It was successfully used in the measurement of serum insulin, and the recovery was between 96.9% and 121.1%. Conclusion FRET effect between AuNP and DL can be applied to develop a fluorescence immunoassay for the measurement of serum insulin.
Subject(s)
Fluorescence Resonance Energy Transfer , Insulin , ImmunoassayABSTRACT
The application of new-generation information technologies such as big data, the internet of things(IoT), and cloud computing in the traditional Chinese medicine(TCM)manufacturing industry is gradually deepening, driving the intelligent transformation and upgrading of the TCM industry. At the current stage, there are challenges in understanding the extraction process and its mechanisms in TCM. Online detection technology faces difficulties in making breakthroughs, and data throughout the entire production process is scattered, lacking valuable mining and utilization, which significantly hinders the intelligent upgrading of the TCM industry. Applying data-driven technologies in the process of TCM extraction can enhance the understanding of the extraction process, achieve precise control, and effectively improve the quality of TCM products. This article analyzed the technological bottlenecks in the production process of TCM extraction, summarized commonly used data-driven algorithms in the research and production control of extraction processes, and reviewed the progress in the application of data-driven technologies in the following five aspects: mechanism analysis of the extraction process, process development and optimization, online detection, process control, and production management. This article is expected to provide references for optimizing the extraction process and intelligent production of TCM.
Subject(s)
Medicine, Chinese Traditional , Drugs, Chinese Herbal , Quality Control , Big Data , AlgorithmsABSTRACT
Currently the main treatment of acute myeloid leukemia (AML) is chemotherapy combining hematopoietic stem cell transplantation. However, the unbearable side effect of chemotherapy and the high risk of life-threatening infections and disease relapse following hematopoietic stem cell transplantation restrict its application in clinical practice. Thus, there is an urgent need to develop alternative therapeutic tactics with significant efficacy and attenuated adverse effects. Here, we revealed that umbilical cord-derived mesenchymal stem cells (UC-MSC) efficiently induced AML cell differentiation by shuttling the neutrophil elastase (NE)-packaged extracellular vesicles (EVs) into AML cells. Interestingly, the generation and release of NE-packaged EVs could be dramatically increased by vitamin D receptor (VDR) activation in UC-MSC. Chemical activation of VDR by using its agonist 1α,25-dihydroxyvitamin D3 efficiently enhanced the pro-differentiation capacity of UC-MSC and then alleviated malignant burden in AML mouse model. Based on these discoveries, to evade the risk of hypercalcemia, we synthetized and identified sw-22, a novel non-steroidal VDR agonist, which exerted a synergistic pro-differentiation function with UC-MSC on mitigating the progress of AML. Collectively, our findings provided a non-gene editing MSC-based therapeutic regimen to overcome the differentiation blockade in AML.
ABSTRACT
Gastric cancer is one of the malignancies with high incidence in the world. Xiangsha Liu Junzitang,a common prescription for the prevention and treatment of gastric cancer,has the effects of moving Qi to relieve pain,drying dampness, and invigorating the spleen. It is especially indicated for gastric cancer of the spleen and stomach qi deficiency syndrome. Based on the databases such as CNKI,Wanfang Data,and PubMed,the clinical efficacy and experimental studies of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer were summarized and sorted out,and the mechanism of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer was elaborated in order to provide useful references for the clinical and basic research on Xiangsha Liu Junzitang in the field of gastric cancer in the future. In clinical practice,Xiangsha Liu Junzitang can treat gastric precancerous lesions,increase the body immunity of patients with gastric cancer,improve the symptoms of spleen and stomach weakness after gastric cancer surgery,and reduce the adverse reactions of the digestive tract after chemotherapy for gastric cancer. Its clinical efficacy is superior to that of western medicine alone whether it is combined with western medicine or used alone. In the experimental research,Xiangsha Liu Junzitang has the effects of regulating inflammatory factors,inhibiting the proliferation of gastric cancer cells,promoting the apoptosis of gastric cancer cells,and improving the activity of pepsin. Modern pharmacological research has shown that Xiangsha Liu Junzitang can conduct a comprehensive intervention with multiple components and multiple targets. The main components of a single drug contained include saponins,polysaccharides,lactones,volatile oils,organic acids,and others, with the effects of protecting gastric mucosa,regulating endocrine,and promoting apoptosis of epithelial cells in gastric mucosal dysplasia,reflecting the advantages and values of traditional Chinese medicine in the prevention and treatment of gastric cancer.
ABSTRACT
Objective: To explore the clinical, pathological, diagnostic, treatment, and prognostic features of children with mature B-cell lymphoma (MBCL) . Methods: This retrospective study included pediatric patients with MBCL with chromosome 11 long-arm abnormalities who were diagnosed and treated at our hospital from December 2018 to February 2023. Results: Among the 11 pediatric patients with MBCL, nine were male and two were female, with a median age of 9 (2-13) years and a median disease course of 1.8 (0.5-24) months. The clinical manifestations were cervical lymph node enlargement in four patients, nasal congestion and snoring in four patients, abdominal pain in two patients, and difficulty breathing in one patient. There were seven cases of Burkitt's lymphoma, two of follicular lymphoma, and two of advanced B-cell lymphoma according to the pathological morphology examination. No patients had central nervous system or bone marrow involvement, and no extensive metastasis was observed on B-ultrasound or positron emission tomography-computed tomography (PET/CT). One patient had a huge tumor lesion. The Revised International Pediatric Non-Hodgkin Lymphoma Staging System classified four patients as stage Ⅱ, five as stage Ⅲ, and two as stage Ⅳ. 11q probe detection showed five cases of 11q gain, three of 11q loss, and three of both gain and loss. FISH showed positive MYC expression in three patients, including eight with advanced B-cell lymphoma with 11q abnormalities and three with Burkitt's lymphoma with 11q abnormalities. According to the 2019 edition of the National Health Commission's diagnostic and treatment guidelines for invasive MBCL in children, one patient was classified as Group A, two as Group B, and eight as Group C. Early evaluation of the efficacy showed complete remission. After mid-term evaluation, the intensity of chemotherapy was reduced in Group B and Group C. Among two cases of chemotherapy, the remaining nine cases had a median follow-up of 32 (6-45) months, and none had event-related survival. Conclusion: The incidence of MBCL with 11q abnormalities in children is low, clinical symptoms are mild, and progression is slow. The absence of MYC, BCL2, BCL6 rearrangements, C-MYC negative and 11q abnormalities on FISH is an important diagnostic indicator, and reducing the intensity of chemotherapy can improve prognosis.
Subject(s)
Humans , Female , Male , Child , Adolescent , Burkitt Lymphoma/genetics , Chromosomes, Human, Pair 11 , Positron Emission Tomography Computed Tomography , Retrospective Studies , Lymphoma, Follicular , Chromosome AberrationsABSTRACT
OBJECTIVE@#To investigate the fate and underlying mechanisms of G2 phase arrest in cancer cells elicited by ionizing radiation (IR).@*METHODS@#Human melanoma A375 and 92-1 cells were treated with X-rays radiation or Aurora A inhibitor MLN8237 (MLN) and/or p21 depletion by small interfering RNA (siRNA). Cell cycle distribution was determined using flow cytometry and a fluorescent ubiquitin-based cell cycle indicator (FUCCI) system combined with histone H3 phosphorylation at Ser10 (pS10 H3) detection. Senescence was assessed using senescence-associated-β-galactosidase (SA-β-Gal), Ki67, and γH2AX staining. Protein expression levels were determined using western blotting.@*RESULTS@#Tumor cells suffered severe DNA damage and underwent G2 arrest after IR treatment. The damaged cells did not successfully enter M phase nor were they stably blocked at G2 phase but underwent mitotic skipping and entered G1 phase as tetraploid cells, ultimately leading to senescence in G1. During this process, the p53/p21 pathway is hyperactivated. Accompanying p21 accumulation, Aurora A kinase levels declined sharply. MLN treatment confirmed that Aurora A kinase activity is essential for mitosis skipping and senescence induction.@*CONCLUSION@#Persistent p21 activation during IR-induced G2 phase blockade drives Aurora A kinase degradation, leading to senescence via mitotic skipping.
Subject(s)
Humans , Aurora Kinase A/metabolism , Cell Line, Tumor , Mitosis , Cell Cycle , Radiation, Ionizing , RNA, Small Interfering/metabolism , Cyclin-Dependent Kinase Inhibitor p21/metabolismABSTRACT
【Objective】 To investigate the current status of incision sites to obtain intact specimens in laparoscopic nephrectomy by urologists in China, so as to provide reference for the standardized procedure. 【Methods】 During Jun.20, 2021 and Jul.4, 2021, more than 20 000 urologists in a WeChat group were surveyed with a questionnaire. The general data, incision sites and related complications were statistically analyzed. 【Results】 A total of 601 valid questionnaires were collected, covering urologists from 31 provinces, autonomous regions and municipalities. Surgical approaches: 68 urologists chose trans-abdominal approach, 432 chose posterior abdominal space approach, 101 chose both surgical approaches. Incision sites: 97 urologists chose lumbar transverse incision, 202 chose dorsal oblique incision of the waist, 119 chose ventral oblique incision, 93 chose the paramedian incision, 112 chose the lower abdominal oblique incision (Gibson), 11 chose the transverse lower abdominal incision (Pfannenstiel), 7 chose the median incision of the lower abdomen, 2 chose the median incision in the upper abdomen, 15 chose axillary midline direct incision; 399 chose to cut off the muscles, and 202 chose not to. Complications: 232 urologists reported pain after 2 weeks, 369 reported no pain; 325 reported numbness after 2 weeks, 276 reported no numbness; 66 reported incisional hernia, 535 reported no hernia. 【Conclusions】 Chinese urologists tend to choose retroperitoneoscopic nephrectomy and waist incision to obtain intact specimens. Transperitoneal laparoscopic nephrectomy has a variety of incisions for intact specimens. There is no standardized incision sites to obtain intact specimens.
ABSTRACT
Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.
Subject(s)
Female , Humans , Carcinoma, Ovarian Epithelial , Receptor, PAR-2 , Ovarian Neoplasms/pathology , Prognosis , RNA, Messenger/metabolismABSTRACT
Background@#The purpose of this research was to assess the role of heparanase (HPSE)/syndecan1 (SDC1)erve growth factor (NGF) on cancer pain from melanoma. @*Methods@#The influence of HPSE on the biological function of melanoma cells and cancer pain in a mouse model was evaluated. Immunohistochemical staining was used to analyze HPSE and SDC1. HPSE, NGF, and SDC1 were detected using western blot. Inflammatory factors were detected using ELISA assay. @*Results@#HPSE promoted melanoma cell viability, proliferation, migration, invasion, and tumor growth, as well as cancer pain, while SST0001 treatment reversed the promoting effect of HPSE. HPSE up-regulated NGF, and NGF feedback promoted HPSE. High expression of NGF reversed the inhibitory effect of HPSE down-regulation on melanoma cell phenotype deterioration, including cell viability, proliferation, migration, and invasion. SST0001 down-regulated SDC1 expression. SDC1 reversed the inhibitory effect of SST0001 on cancer pain. @*Conclusions@#The results showed that HPSE promoted melanoma development and cancer pain by interacting with NGF/SDC1. It provides new insights to better understand the role of HPSE in melanoma and also provides a new direction for cancer pain treatment.