Identification of the first homozygous 1-bp deletion in GDF9 gene leading to primary ovarian insufficiency by using targeted massively parallel sequencing.

Targeted massively parallel sequencing (TMPS) has been used in genetic diagnosis for Mendelian disorders. In the past few years, the TMPS has identified new and already described genes associated with primary ovarian insufficiency (POI) phenotype. Here, we performed a targeted gene sequencing to find a genetic diagnosis in idiopathic cases of Brazilian POI cohort. A custom SureSelectXT DNA target enrichment panel was designed and the sequencing was performed on Illumina NextSeq sequencer. We identified 1 homozygous 1-bp deletion variant (c.783delC) in the GDF9 gene in 1 patient with POI. The variant was confirmed and segregated using Sanger sequencing. The c.783delC GDF9 variant changed an amino acid creating a premature termination codon (p.Ser262Hisfs*2). This variant was not present in all public databases (ExAC/gnomAD, NHLBI/EVS and 1000Genomes). Moreover, it was absent in 400 alleles from fertile Brazilian women screened by Sanger sequencing. The patient's mother and her unaffected sister carried the c.783delC variant in a heterozygous state, as expected for an autosomal recessive inheritance. Here, the TMPS identified the first homozygous 1-bp deletion variant in GDF9. This finding reveals a novel inheritance pattern of pathogenic variant in GDF9 associated with POI, thus improving the genetic diagnosis of this disorder.

Malignant testicular germ cell tumors in postpubertal individuals with androgen insensitivity: prevalence, pathology and relevance of single nucleotide polymorphism-based susceptibility profiling.

STUDY QUESTION: What is the prevalence of malignant testicular germ cell tumors (TGCT) and its precursors, (pre-) germ cell neoplasia in situ (GCNIS), in late teenagers and adults who have androgen insensitivity syndrome (AIS) and the impact of an individual's genetic susceptibility to development of TGCT? SUMMARY ANSWER: No GCNIS or TGCT was diagnosed, but pre-GCNIS was identified in 14 and 10% of complete and partial AIS patients, respectively, and was associated with a higher genetic susceptibility score (GSS), with special attention for KITLG (rs995030) and ATFZIP (rs2900333). WHAT IS KNOWN ALREADY: Many adult women with AIS decline prophylactic gonadectomy, while data regarding the incidence, pathophysiology and outcomes of TGCT in postpubertal individuals with AIS are lacking. The relevance of genetic factors, such as single nucleotide polymorphisms (SNPs), in predisposing AIS individuals to TGCT is unknown. STUDY DESIGN, SIZE, DURATION: This multicenter collaborative study on prophylactically removed gonadal tissue was conducted in a pathology lab specialized in germ cell tumor biology. PARTICIPANTS/MATERIALS, SETTING, METHODS: Material from 52 postpubertal individuals with molecularly confirmed AIS (97 gonadal samples) was included; the median age at surgery was 17.5 (14-54) years. Immunohistochemical studies and high-throughput profiling of 14 TGCT-associated SNPs were performed. The main outcome measures were the prevalence of pre-GCNIS, GCNIS and TGCT, and its correlation with a GSS, developed based on the results of recent genome-wide association studies. MAIN RESULTS AND ROLE OF CHANCE: The earliest recognizable change preceding GCNIS, referred to as pre-GCNIS, was present in 14% of individuals with complete and 10% of those with partial AIS at a median age of 16 years. No GCNIS or invasive TGCT were found. The median GSS was significantly greater for those with, compared to those without, pre-GCNIS (P = 0.01), with an overlap between groups. Our data suggest important roles for risk alleles G at KITLG (rs995030) and C at ATFZIP (rs2900333), among the 14 studied TGCT-associated SNPs. LARGE SCALE DATA: N/A. LIMITATIONS REASONS FOR CAUTION: A limited number of cases were included. WIDER IMPLICATIONS OF THE FINDINGS: Our data suggest that the prevalence of pre-GCNIS in individuals with AIS beyond puberty is around 15%. Genetic susceptibility likely contributes to pre-GCNIS development in AIS but factors related to malignant progression remain unclear. Although data in older patients remain scarce, malignant progression appears to be a rare event, although the natural history of the premalignant lesion remains unknown. Therefore, the practice of routine prophylactic gonadectomy in adults with AIS appears questionable and the patient's preference, after having been fully informed, should be decisive in this matter. STUDY FUNDING/COMPETING INTEREST(S): This study was supported by research grants from the Research Foundation Flanders (FWO) (to M.C.), the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq G0D6713N) (to B.B.M. and M.C.) and the European Society for Pediatric Endocrinology (ESPE), granted by Novo Nordisk AB (to J.K.). There are no competing interests.

Effects of Type 1 Insulin-Like Growth Factor Receptor Silencing in a Human Adrenocortical Cell Line.

Type 1 insulin-like growth factor receptor (IGF-1R) is overexpressed in a variety of human cancers, including adrenocortical tumors. The aim of the work was to investigate the effects of IGF-1R downregulation in a human adrenocortical cell line by small interfering RNA (siRNA). The human adrenocortical tumor cell line NCI H295R was transfected with 2 specific IGF1R siRNAs (# 1 and # 2) and compared with untreated cells and a negative control siRNA. IGF1R expression was determined by quantitative reverse-transcription PCR (qRTPCR) and Western blot. The effects of IGF-1R downregulation on cell proliferation and apoptosis were assessed. IGF-1R levels were significantly decreased in cells treated with IGF-1R siRNA # 1 or # 2. Relative expression of IGF1R mRNA decreased approximately 50% and Western blot analysis revealed a 30% of reduction in IGF-1R protein. Downregulation of this gene resulted in 40% reduction in cell growth in vitro and 45% increase in apoptosis using siRNA # 2. These findings demonstrate that decreasing IGF-1R mRNA and protein expression in NCI H295R cells can partially inhibit adrenal tumor cell growth in vitro. Targeting IGF1R is a promising therapy for pediatric malignant adrenocortical tumor and can still be an option for adult adrenocortical cancer based on personalized genomic tumor profiling.

Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.

OBJECTIVE: PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. DESIGN: Pituitary function and imaging assessment and molecular analysis of PROP1. PATIENTS: Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. METHODS: Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. RESULTS: MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. CONCLUSIONS: We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.

Mutations in the SRY, DAX1, SF1 and WNT4 genes in Brazilian sex-reversed patients

In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions) of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication) of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N), was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade

Mutations in the SRY, DAX1, SF1 and WNT4 genes in Brazilian sex-reversed patients.

In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions) of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication) of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N), was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade.

Molecular analysis of SRY gene in Brazilian 46,XX sex reversed patients: absence of SRY sequence in gonadal tissue.

BACKGROUND: The importance of the Y chromosome in male determination has been well established for a long time. The presence of a translocation of chromosomal material encoding the Testis-Determining Factor from Y to another chromosome has been one of the hypothesis to explain testicular development in XX sex-reversed patients. MATERIAL AND METHODS: In the present study, we searched for SRY sequence in genomic DNA isolated from peripheral leukocytes in eleven 46,XX true hermaphrodites and four 46,XX males (only one with ambiguous genitalia). We also analyzed the presence of SRY sequence in fresh gonadal tissues from two 46,XX true hermaphrodites. RESULTS: SRY sequence was absent in DNA blood samples of all true hermaphrodites and in testicular and ovarian tissues of two cases studied. Of the four 46,XX males, two with normal male external genitalia were SRY positive. CONCLUSIONS: We did not identify the SRY gene in 46,XX true hermaphrodites and 46,XX males with ambiguous genitalia, therefore SRY translocation to X chromosome or autosome is unlikely. Hidden Y mosaicism in gonadal tissues was also ruled out in two cases, suggesting that cryptic SRY mosaicism in gonadal tissues is not the usual mechanism responsible for testicular development in patients with 46,XX true hermaphroditism. However, SRY gene was identified in two 46,XX males with male external genitalia showing that SRY gene determined their male phenotype. Despite the recent advances in the knowledge of the role of several genes involved in sexual determination we are still unable to explain the cause of most of Y-chromosome-negative 46,XX sex-reversed patients.

A novel missense mutation, GLY424SER, in Brazilian patients with 21-hydroxylase deficiency.

A previous screening of 17 mutations in 130 Brazilian patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency did not identify mutations in 20% of the alleles. To diagnose these alleles we sequenced the entire CYP21 gene of one Mulatto patient with the simple virilizing form, who had only the R356W mutation in a heterozygous state. We identified a heterozygous G-A transition in codon 424. This mutation leads to a substitution of glycine by serine in a conserved region where glycine is conserved in at least 4 species. This novel mutation eliminates 1 of the restriction sites of the BanI enzyme, which made its screening possible for the whole series. The G424S mutation was found in a compound heterozygous state in 5 families; 4 presented the simple virilizing form, and 1 presented the nonclassical form. Interestingly, 3 of 5 families have a Mulatto origin. This mutation was not identified in 118 CYP21 alleles of normal individuals, ruling out the possibility of a polymorphism, or in 80 pseudogenes, indicating a casual mutagenic event and not a microconversion event. All patients with the G424S mutation presented CYP21P and C4A gene deletions and human leukocyte antigen DR17 on the same haplotype, suggesting a linkage disequilibrium and a probable founder effect. Search for the G424S mutation in other populations will reveal whether it is restricted to the Brazilian patients or if it has a wider ethnic distribution.

Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction.

Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.