Towards optimizing the protocol for untargeted profiling of urine volatiles via gas chromatography-ion mobility spectrometry. A pilot study.

The analysis of volatile organic compounds (VOCs) present in various biological samples holds immense potential for non-invasive disease diagnostics and metabolic profiling. One of the biological fluids that are suitable for use in clinical practice is urine. Given the limited quantity of VOCs in the urine headspace, it's imperative to enhance their extraction into the gaseous phase and prevent any degradation of VOCs during the thawing process. The study aimed to test several key parameters (incubation time, temperature, and thawing) that can influence urine volatilome and monitor selected VOCs for their stability. The analysis in this study was performed using a BreathSpec® (G.A.S., Dortmund, Germany) device consisting of a gas chromatograph (GC) coupled with an ion mobility spectrometer (IMS). Testing three different temperatures and incubation times yielded a low number of VOCs (9 out of 34) that exhibited statistically significant differences. However, examining three thawing conditions revealed no VOCs with statistically significant changes. Thus, we conclude that urine composition remains relatively stable despite exposure to various thermal stresses.

Analysis of the complete sequences of two biologically distinct Zucchini yellow mosaic virus isolates further evidences the involvement of a single amino acid in the virus pathogenicity.

The complete genome sequences of two Slovak Zucchini yellow mosaic virus isolates (ZYMV-H and ZYMV-SE04T) were determined. These isolates differ significantly in their pathogenicity, producing either severe or very mild symptoms on susceptible cucurbit hosts. The viral genome of both isolates consisted of 9593 nucleotides in size, and contained an open reading frame encoding a single polyprotein of 3080 amino acids. Despite their different biological properties, an extremely high nucleotide identity could be noted (99.8%), resulting in differences of only 5 aa, located in the HC-Pro, P3, and NIb, respectively. In silico analysis including 5 additional fully-sequenced and phylogenetically closely-related isolates known to induce different symptoms in cucurbits was performed. This suggested that the key single mutation responsible for virus pathogenicity is likely located in the N-terminal part of P3, adjacent to the PIPO.

Relation between preclinical atherosclerosis and venous thromboembolism in patients with thrombophilias - longitudinal study.

Preclinical atherosclerosis may represent a risk factor for venous thromboembolism (VTE). In longitudinal study we followed longitudinally 96 patients (32 men) with thrombophilias with (n=51) and without (n=45) history of VTE. In both groups we studied the changes of preclinical atherosclerosis at peripherally located arteries detected by ultrasound. In addition, we assessed changes in selected risk factors of atherosclerosis. During the mean follow-up of 56.0+/-7.62 months we did not find significant change in preclinical atherosclerosis defined as Belcaro score in either group (-3 % in the VTE group vs 0 % in non VTE group). Significant increase in body mass index (1.03+/-1.98 kg*m(-2), resp. 1.21+/-1.67 kg*m(-2), p<0.01) and non-significant increase in systolic blood pressure were detected in both groups. Waist circumference increased significantly only in patients without VTE (4.11+/-7.84 cm, p<0.05). No differences in changes of risk factors under study between both groups were detected. In summary, patients with thrombophilia and history of VTE showed no evidence of greater progression of atherosclerosis or increase in traditional risk factors of atherosclerosis than patients with thrombophilia without history of VTE. Unfavorable changes of body mass index, waist circumference and systolic blood pressure were detected in both groups during study period.

A single amino acid mutation alters the capsid protein electrophoretic double-band phenotype of the Plum pox virus strain PPV-Rec.

Plum pox virus (PPV) isolates differ by their capsid protein (CP) mobility in SDS-PAGE. These electrophoretic phenotypes are likely to result from post-translational modifications of the CP. We demonstrated that the CP mobility was solely determined by the CP N-terminal region. Sequence comparison pinpointed a possible role of mutations at position 66 in determining the CP phenotype of PPV-Rec isolates. Site-directed mutagenesis of a chimeric clone demonstrated that Gly(66) in the CP resulted in the double-band phenotype, while Arg(66) led to a single-band CP pattern, possibly by preventing the phosphorylation of a nearby Ser residue by steric hindrance.

First Report of Wheat streak mosaic virus in Slovakia.

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5' GAGAGCAATACTGCGTGTACG 3' and WS-8909R 5' GCATAATGGCTCGAAGTGATG 3') designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

Expression of a part of the Potato virus A non-structural protein P3 in Escherichia coli for the purpose of antibody preparation and P3 immunodetection in plant material.

The N-terminal part of the Potato virus A (PVA) P3 protein was cloned into two E. coli fusion expression systems. An overexpression of the P3 fragment fused with thioredoxin was observed between 2 and 21 h after induction. The protein formed insoluble inclusions. Decreasing the cultivation temperature did not enhance its solubility. To obtain antigen for antibody preparation, inclusions were concentrated and purified by sucrose gradient centrifugation, and subjected to SDS-polyacrylamide gel electrophoresis. The band specific for the protein was excised from the gel and used for rabbit immunization. Obtained antibody tested positive with high specificity in immunoblots of expressed PVA P3 fused with either thioredoxin or GST. The antibody was also applied for the detection of P3 protein in plant material by immunoblot. Previous plant sap concentration was essential for most samples. Three concentration methods were tested: simple centrifugal size-exclusion filtration, the same preceded with high-speed centrifugation at 250,000 x g, and differential ammonium sulfate precipitation. The last approach was the most convenient. Plants tested included PVA P3-transgenic tobacco lines as well as PVA-infected wild-type tobacco. In all cases, mature P3 with a molecular mass of 40 kDa was detected.

Detection of transgene copy number by analysis of the T1 generation of tobacco plants with introduced P3 gene of potato virus A.

Real-time PCR, namely the deltadeltaCt method was used to determine the relative copy number of Potato virus A (PVA) P3 gene in the genome of the T1 generation of 18 transgenic tobacco lines. These results were compared with segregation ratios of kanamycin (Km)-resistant phenotype in T1 plants of each line and were found to be, in general, concordant. All the five lines with the Mendelian segregation ratio of 3:1 carried one gene copy. In 12 of 13 lines with uneven segregation more inserted gene copies were detected. Only for one line the real-time PCR and phenotype segregation differed. According to our results the real-time PCR of T1 generation may be used as supplementary method of estimation of the number of transgene copies in the case of nonavailability of the original T0 plants.

Plum Pox Virus Mixed Infection Detected on Apricot in Pakistan.

Sharka, caused by Plum pox virus (PPV), is the most detrimental viral disease of stone fruit trees. First reported from Bulgaria in 1917, the virus is now widespread in Europe, the Mediterranean Basin, and Asia Minor and is sporadically present in North and South America. On the basis of molecular and serological properties, six PPV subgroups are recognized, from which PPV-D, PPV-M, and PPV-Rec are the most common (1,2). Several apricot trees (Prunus armeniaca) showing mild, pale green rings and diffuse chlorotic spots on leaves were found in a small orchard in the Baltistan District in northern Pakistan at approximately 2,400 m above sea level. Dried leaf samples from one symptomatic tree randomly selected from the orchard were positive for PPV using double-antibody sandwich enzyme-linked immunosorbent assay with antisera prepared in the laboratory, immunoblot analysis, and reverse transcription-polymerase chain reaction (RT-PCR) targeting the capsid protein (CP) gene using standard procedures (1). To check the subgroup affiliation and evaluate the molecular variability, the 562-bp variable region spanning the C-terminus of NIb and the N-terminus of the CP was amplified, the RT-PCR product was cloned into the pGEM-T Easy vector (Promega, Madison, WI), and positive clones were analyzed by restriction and sequence analyses. Interestingly, sequence analysis of four clones revealed mixed infection, i.e., the presence of two different PPV isolates in the apricot sample. One isolate belonged to PPV-D (GenBank Accession No. DQ422147) and the other belonged to the PPV-Rec subgroup (GenBank Accession No. DQ422148). Multiple alignment of the sequenced genome portion of the Pakistan PPV-D isolate indicated 96 to 99% nt identity with various PPV-D isolates without unique, clear-cut differences. Similarly, the PPV-Rec isolate had 98 to 99% identity with European PPV-Rec isolates and retained the cross-over at nucleotide position 8450 in the 3' terminus of NIb. This sequence had the amino acid signature at the N-terminus of the CP typical of the PPV-Rec subgroup (2). Moreover, no particular clustering of the Pakistan isolates within PPV-D and PPV-Rec could be observed after phylogenetic analysis. The DAG motif, essential for aphid transmission, was present in both sequences. To our knowledge, this is the first indication of PPV occurrence in Pakistan and first identification of the PPV-Rec isolate outside Europe. Together with previous reports on the PPV presence in China and Kazakhstan (3,4), this report indicates the need for more detailed epidemiological studies focusing the PPV spread and its molecular diversity in Asia. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) M. Glasa et al. J. Gen. Virol. 85:2671, 2004. (3) M. Navrátil et al. Plant Dis. 89:338, 2005. (4) S. Spiegel et al. Plant Dis. 88:973, 2004.

Hypertension-related intermyocyte junction remodelling is associated with a higher incidence of low-K(+)-induced lethal arrhythmias in isolated rat heart.

The aim of this study was to characterise the arrhythmogenic mechanisms involved in hypokalaemia-induced sustained ventricular fibrillation (SVF), in hypertensive rats. The hearts from rats with hypertension induced by the nitric oxide synthase inhibitor L-NAME, and age-matched normotensive controls, were perfused in Langendorff mode with oxygenated Krebs-Henseleit solution followed by a K(+)-deficient solution. In additional experiments, free intracellular Ca(2+) concentration ([Ca(2+)](i)) was measured using fura-2 in conjunction with an epicardial optical probe. The epicardial electrocardiogram was continuously monitored during all experiments. The gap junction protein connexin-43 and the ultrastructure of the cardiomyocytes were examined, and selected enzyme activities were measured in situ. There was a higher incidence of low-K(+)-induced SVF in the hearts of hypertensive compared to normotensive rats (83 % vs. 33 %, P < 0.05). Perfusion with a low-K(+)-containing solution lead to elevation of diastolic [Ca(2+)](i) that was accompanied by premature beats, bigeminy, ventricular tachycardia and transient ventricular fibrillation. These events occurred earlier with increased incidence and duration in the hearts of hypertensive rats (arrhythmia scores: hypertensive, 4.9 +/- 0.7; normotensive, 3.1 +/- 0.1; P < 0.05), which exhibited apparent remodelling accompanied by a significant decrease in the density of connexin-43-positive gap junctions. Moreover, low-K(+)-related myocardial changes, including local impairment of intermyocyte junctions, ultrastructural alterations due to Ca(2+) overload and intercellular uncoupling, and decreased enzyme activities were more pronounced and more dispersed in hypertensive than normotensive rats. In conclusion, nitric oxide-deficient hypertension is associated with decreased myocardial coupling at gap junctions. The further localised deterioration of junctional coupling, due to low-K(+)-induced Ca(2+) disturbances, as well as spatial heterogeneity of myocardial alterations including interstitial fibrosis, probably provide the mechanisms for re-entry and sustaining ventricular fibrillation.

Analysis of thiocyanate in biological fluids by capillary zone electrophoresis.

A new sensitive and simple method has been developed for the determination of thiocyanate in human serum, urine and saliva. The determinations were performed in a fused-silica capillary [64.5 cm (56 cm effective length) x 75 microm] using 0.1 M beta-alanine-HCl (pH 3.50) as a background electrolyte, separation voltage 18 kV (negative polarity), temperature of capillary 25 degrees C and direct detection at 200 nm. Serum samples were 10-times diluted with deionised water and deproteinised with acetonitrile in the ratio 1:2. Urine and saliva samples need only 20-fold dilution with deionised water. The proposed method was successfully applied to the determination of thiocyanate in various human serum, saliva and urine samples.

[Experimental study and standardization of propanide in water]. / Eksperimentalno prouchvane i normirane na propanid vuv vodite.

Hygiene-toxicological and ecotoxicological studies of amide herbicide propanide are performed in view of its standardization in waters. Experiments are carried out for defining its effect on the organoleptic quality of the waters, ecotoxicological effect in water medium and toxic effect on warm blooded organisms. Threshold and subthreshold concentrations and doses of harmful effect are defined. Differentiated hygiene norms (MAC) are developed for toxicological resources; for first category (after toxicological indication)--0.1 mg/l; for second and third (after ecotoxicological symptom) respectively 1.0 mg/l and 2.0 mg/l.

[Effect of several microelements contained in drinking water on the development of atherosclerosis]. / Prouchvane vliianieto na niakoi mikroelementi, sudurzhashti se v piteinite vodi, vurkhu razvitieto na aterosklerozata.

During his whole life man drinks water - about 2 litres in 24 hours for an adult in the countries with moderate climate. Usually, drinking water contains many microelements. Their type and concentration depend mainly on the geochemical characteristic of the earth layers. The pollution of waters by industrial enterprises has, very likely, an effect on the content of microelements. According to literature data, in epidemiological studies information was collected, providing grounds to admit that some microelements have an effect ion atherosclerosis advancement. The results obtained are not convincing enough to judge if a casual relationship exists between the microelements in the drinking water and atherosclerosis advancement. In order to supplement the existing studies, the authors carried out investigations to elucidate the role of some microelement in the progress of experimental atherosclerosis. The results obtained provided grounds to claim that the microelements chromium, zinc, lead, cadmium, vanadium stimulate or restrict the advancement of experimental atherosclerosis.

[Toxicologic characteristics of several pesticides and standards for them in water]. / Toksikologichna kharakteristika na niakoi pestitsidi i normiraneto im vuv vodite.

The progressive increase of production and application of chemicals for plant protection transmuted the problem of protection of water cleanliness into an international and national problem. The cases with incidental pesticide pollution of water-reservoirs became more numerous. A necessity arose of the supplement of our sanitary legislation with hygienic standards (MAC) for the water for the newly implemented chemicals for plant protection in the country. During the last several years, some of the most frequently used and formulated in our country pesticides were experimentally studied: Afalon and Patoran (from chemical group of carbamates and dithiocarbamates) and amide herbicide: Dimid, Ramrod, Lasso, Treflan. Complex hygienic-toxicological studies were carried out in order to study the toxicological effect of the pesticides mentioned and to elaborate hygienic norms (MAC) of the same in the water. The effect on the organoleptic qualities of water was determined as well as on the sanitary regime of waterreservoirs (according to BON5, sanitary-indictory microflora and toxicity for fishes). Toxicological studies were performed under the conditions of acute, subacute and chronic experiment. The results obtained allowed the hygienic-toxicological characteristics and the proposal of hygienic standards (MAC) for the pesticides studied in water.

[Effect of fluorine on development of experimental atherosclerosis]. / Prouchvane vliianieto na fluora vurkhu razvitieto na eksperimentalnata ateroskleroza.

A four-month experiment with rabbits was carried out, aiming at the elucidation of fluorine effect in the development of experimental hypercholesterolemia. The experimental animals were grouped into five groups: group I--control; group II--treated with 0,5 mg/kg cholesterol; group III--administered 10 MAC fluorine; group IV and V--treated with combination fluorine and cholesterol. The animals were monthly examined and the dynamics of body weight, total blood count were followed up as well as the biochemical indices/ total lipids, cholesterol, beta-lipoproteins, blood sugar, urea, uric acid and some electrolytes/. Femurs and teeth of the experimental animals were tested for fluorine content and dry substance in them. Pathoanatomical and histochemical investigations were also performed. The results obtained allow to admit that fluorine, as a mictoelement, plays a certain role in the inhibition of the development of the experimental hypercholesterolemia and atherosclerosis.

[Experimental studies for the hygienic standardization of Lasso in water]. / Eksperimentalni izsledvaniia za khigienno normirovane na laso vuv voda.

Experimental hygienic-toxical study was carried out on amide herbicide lasso, aiming at its hygienic standardization in water. The studies were carried out in three aspects for the determination of its effect upon the organoleptic qualities of water, on the sanitary regime of water-reservoirs and toxic effect on organism. Threshold and subthershold concentrations of the deleterious effect on colour, small and taste of water were determined as well as on B0N5, on sanitary-indication microflora and on cold blooded organisms. The toxicological parameters for acute, subacute and chronic oral toxicity on albino rats were established. On the base of the experimental studies, differentiated hygienic norms (MAC) of lasso were elaborated in the three categories water-reservoirs - I mg/1 for I category and 5 mg/1 for II and II category.