Staphylococcus aureus in the nose and throat of Iowan families.

The study objective was to determine the prevalence of Staphylococcus aureus colonisation in the nares and oropharynx of healthy persons and identify any risk factors associated with such S. aureus colonisation. In total 263 participants (177 adults and 86 minors) comprising 95 families were enrolled in a year-long prospective cohort study from one urban and one rural county in eastern Iowa, USA, through local newspaper advertisements and email lists and through the Keokuk Rural Health Study. Potential risk factors including demographic factors, medical history, farming and healthcare exposure were assessed. Among the participants, 25.4% of adults and 36.1% minors carried S. aureus in their nares and 37.9% of adults carried it in their oropharynx. The overall prevalence was 44.1% among adults and 36.1% for minors. Having at least one positive environmental site for S. aureus in the family home was associated with colonisation (prevalence ratio: 1.34, 95% CI: 1.07-1.66). The sensitivity of the oropharyngeal cultures was greater than that of the nares cultures (86.1% compared with 58.2%, respectively). In conclusion, the nares and oropharynx are both important colonisation sites for healthy community members and the presence of S. aureus in the home environment is associated with an increased probability of colonisation.

Attitudes and potential barriers towards hepatitis C treatment in patients with and without HIV coinfection.

This study aimed to assess attitudes and potential barriers towards treatment in patients with hepatitis C virus (HCV) infection, comparing those with and without HIV coinfection. A cross-sectional survey of 82 HCV-infected adults with and without HIV was conducted in greater Los Angeles between November 2013 and July 2015. Overall, there were 53 (64.6%) with HIV coinfection, 20 (25.0%) with self-reported cirrhosis, and 22 (26.8%) with a history of prior HCV treatment. Of all, 93.2% wanted HCV treatment, but 45.9% were unwilling/unable to spend anything out of pocket, 29.4% were waiting for new therapies, and 23.5% were recommended to defer HCV treatment. HIV/HCV-coinfected patients were more likely to want treatment within one year (90.2% versus 68.2%, p = 0.02), more willing to join a clinical trial (74.5% versus 8.0%, p < 0.01), more willing to take medications twice daily (86.3% versus 61.5%, p = 0.01), and more likely to prefer hepatitis C treatment by an infectious diseases/HIV physician (36.7% versus 4.0%, p < 0.01). Of all, 77.1% of coinfected patients were willing to change antiretroviral therapy if necessary to treat HCV, but only 48.0% of patients were willing to take a medication if it had not been studied in HIV-positive patients. Treatment preferences differ between HIV/HCV-coinfected and HCV-monoinfected patients. Despite a strong willingness among the study cohort to start HCV treatment, other factors such as cost, access to medications, and provider reluctance may be delaying treatment initiation.

Size and polydispersity trends found in gold nanoparticles synthesized by laser ablation in liquids.

In this work, the effect of laser fluence on Au nanoparticles synthesized via laser ablation in liquids is studied for 1064 nm irradiation with 25 ps pulses. Particle size and polydispersity is found to display a negative trend with fluences up to ∼14 J cm(-2). Erratic size tendencies are observed at low fluences, i.e. slightly above the ablation threshold. This overall behavior is reconciled with recent computational studies and to fluctuations in ablation due to surface morphology. The effectiveness of the commonly used surfactant sodium dodecyl sulfate (SDS) is shown to diminish at higher fluence due to pyrolysis. In addition, shadowgraph imaging of the cavitation bubble is shown as a useful technique for determining the ablation threshold. Our findings are in good agreement with threshold values determined by traditional methods and are comparable to computational values, when differences in pulse duration are taken into account.

Molecular typing of antibiotic-resistant Staphylococcus aureus in Nigeria.

BACKGROUND: Antibiotic-resistant Staphylococcus aureus including methicillin-resistant strains (MRSA) are a major concern in densely populated urban areas. Initial studies of S. aureus in Nigeria indicated existence of antibiotic-resistant S. aureus strains in clinical and community settings. METHODS: 73 biological samples (40 throat, 23 nasal, 10 wound) were collected from patients and healthcare workers in three populations in Nigeria: Lagos University Teaching Hospital, Nigerian Institute of Medical Research, and Owerri General Hospital. RESULTS: S. aureus was isolated from 38 of 73 samples (52%). Of the 38 S. aureus samples, 9 (24%) carried the Panton-Valentine leukocidin gene (PVL) while 16 (42%) possessed methicillin resistance genes (mecA). Antibiotic susceptibility profiles indicated resistance to several broad-spectrum antibiotics. CONCLUSION: Antibiotic-resistant S. aureus isolates were recovered from clinical and community settings in Nigeria. Insight about S. aureus in Nigeria may be used to improve antibiotic prescription methods and minimize the spread of antibiotic-resistant organisms in highly populated urban communities similar to Lagos, Nigeria.

Highly aligned epitaxial nanorods with a checkerboard pattern in oxide films.

One of the central challenges of nanoscience is fabrication of nanoscale structures with well-controlled architectures using planar thin-film technology. Herein, we report that ordered nanocheckerboards in ZnMnGaO4 films were grown epitaxially on single-crystal MgO substrates by utilizing a solid-state method of the phase separation-induced self-assembly. The films consist of two types of chemically distinct and regularly spaced nanorods with mutually coherent interfaces, approximately 4 x 4 x 750 nm3 in size and perfectly aligned along the film growth direction. Surprisingly, a significant in-plane strain, more than 2%, from the substrate is globally maintained over the entire film thickness of about 820 nm. The strain energy from Jahn-Teller distortions and the film-substrate lattice mismatch induce the coherent three-dimensional (3D) self-assembled nanostructure, relieving the volume strain energy while suppressing the formation of dislocations.

Identification of the RNA binding domain of T4 RegA protein by structure-based mutagenesis.

The T4 translational repressor RegA protein folds into two structural domains, as revealed by the crystal structure (Kang, C.-H. , Chan, R., Berger, I., Lockshin, C., Green, L., Gold, L., and Rich, A. (1995) Science 268, 1170-1173). Domain I of the RegA protein contains a four-stranded beta-sheet and two alpha-helices. Domain II contains a four-stranded beta-sheet and an unusual 3/10 helix. Since beta-sheet residues play a role in a number of protein-RNA interactions, one or both of the beta-sheet regions in RegA protein may be involved in RNA binding. To test this possibility, mutagenesis of residues on both beta-sheets was performed, and the effects on the RNA binding affinities of RegA protein were measured. Additional sites for mutagenesis were selected from molecular modeling of RegA protein. The RNA binding affinities of three purified mutant RegA proteins were evaluated by fluorescence quenching equilibrium binding assays. The activities of the remainder of the mutant proteins were evaluated by quantitative RNA gel mobility shift assays using lysed cell supernatants. The results of this mutagenesis study ruled out the participation of beta-sheet residues. Instead, the RNA binding site was found to be a surface pocket formed by residues on two loops and an alpha-helix. Thus, RegA protein appears to use a unique structural motif in binding RNA, which may be related to its unusual RNA recognition properties.

Comparison of the heme iron utilization systems of pathogenic Vibrios.

Vibrio alginolyticus, Vibrio fluvialis, and Vibrio parahaemolyticus utilized heme and hemoglobin as iron sources and contained chromosomal DNA similar to several Vibrio cholerae heme iron utilization genes. A V. parahaemolyticus gene that performed the function of V. cholerae hutA was isolated. A portion of the tonB1 locus of V. parahaemolyticus was sequenced and found to encode proteins similar in amino acid sequence to V. cholerae HutW, TonB1, and ExbB1. A recombinant plasmid containing the V. cholerae tonB1 and exbB1D1 genes complemented a V. alginolyticus heme utilization mutant. These data suggest that the heme iron utilization systems of the pathogenic vibrios tested, particularly V. parahaemolyticus and V. alginolyticus, are similar at the DNA level, the functional level, and, in the case of V. parahaemolyticus, the amino acid sequence or protein level to that of V. cholerae.

Origins of binding specificity of the A1 heterogeneous nuclear ribonucleoprotein.

The A1 heterogeneous nuclear ribonucleoprotein (hnRNP) is the best studied of the "core" hnRNP proteins that are tightly associated with heterogeneous nuclear RNA (hnRNA) within eukaryotic nuclei. Previous studies suggested that hnRNP A1 preferentially binds (under nonequilibrium conditions) to the pyrimidine-rich span of sequence at the 3'splice site of most introns [Swanson, M.S., & Dreyfuss, G. (1988) EMBO J. 11, 3519-3529; Buvoli et al. (1990) Nucleic Acids Res. 18, 6595-6600; Ishikawa et al. (1993) Mol. Cell. Biol. 13, 4301-4310]. Recently, Burd and Dreyfuss [(1994) EMBO J. 13, 1197-1204] used selection/amplification from pools of random sequence RNA to uncover an even higher-affinity A1 oligo that contained two copies of a high-affinity consensus sequence, UAGGGU/A. We have extended these studies by using a fluorescence assay to characterize the equilibrium binding properties of A1 to each of these oligonucleotides. By also characterizing the binding of A1 to sequence-randomized control oligonucleotides, we have been able to better evaluate the inherent "sequence-specific" binding properties of A1. Although these studies indicate that under equilibrium conditions A1 cannot specifically recognize the beta-globin, 3'-splice site DNA oligo analogue studied by Buvoli et al. (1990), they confirmed the high-affinity binding to the "winner" 20-mer RNA that was uncovered via selection/amplification and that has the sequence UAUGAUAGGGACUUAGGGUG (Burd & Dreyfuss, 1994). In 0.1 M NaCl, we found that A1 has approximately 100-fold higher affinity for this winner sequence sequence than it does for either a randomized version of this sequence or a 20-mer oligo corresponding to an unrelated beta-globin intron sequence. This winner RNA oligo aggregates in solution to form an apparent dimer that may represent a G-quartet resulting from dimerization of two Hoogsteen base-paired hairpins. On the basis of salt sensitivity studies carried out with various fragments of A1, the ability of A1 to discriminate the winner sequence from its randomized control results primarily from increased ionic interactions with the glycine-rich, COOH terminal domain of A1 that extends from residue 196 to 319. Nonetheless, most of the overall energy of binding for the A1 winner complex results from determinants that are resident within the first 195 residues of A1. The unique ability of the winner sequence (but not its sequence-randomized control) to form a higher-order aggregate, which may correspond to a G-tetrad, appears to facilitate the additional ionic interactions with the COOH terminal domain. Taken together, these data suggest the need to reevaluate possible and probable functions of A1 in vivo.

Mutagenesis of the COOH-terminal region of bacteriophage T4 regA protein.

The bacteriophage T4 regA protein is a translational repressor that regulates the synthesis of > 12 T4 proteins. Earlier studies demonstrated that photocross-linking of the 122-residue regA protein to (dT)16 occurs at two sites, with the major site occurring at Phe-106. Amino acid substitutions were introduced at Phe-106 to evaluate its role in nucleic acid binding. Binding affinities of mutants F106C, F106V, and F106Y for nonspecific and specific RNA ligands indicated little difference between the Kapp of the mutants and wild type regA protein, for either poly(U) or for a specific gene 44 oligoribonucleotide. Thus, Phe-106 does not contribute measurably to the overall free energy of binding. Partial proteolysis of regA protein was carried out to further probe its domain structure. Chymotryptic cleavage produced a fragment of 11,095 Da that has reduced affinity for poly(U) and that contains the first 93 residues of regA protein. Interestingly, proteolysis of regA protein is reduced in the presence of the specific target, gene 44 RNA. Two deletion mutants, 1-->94 and 1-->109, have also been cloned and purified. The binding affinities of these deletion mutants indicated a 100-1000-fold reduction in their affinities for poly(U). These studies indicate the last 13 amino acids in regA protein make a significant contribution to RNA binding.

Fluorescence studies of normal and sickle beta apohemoglobin self-association.

The acrylamide quenching of the intrinsic tryptophanyl fluorescence of normal and sickle beta apohemoglobins has been studied in 0.05 M potassium phosphate buffer, pH 7.5, at 5 degrees C over a protein concentration range from 1 to 50 microM. Analysis of quenching dynamics revealed a strong dependence on acrylamide concentration for the intrinsic fluorescence of both normal and sickle beta apohemoglobins, suggesting that one tryptophanyl residue [presumably that at position 37(C3)], was more accessible to collisional quencher than the other beta tryptophanyl residue [15(A12)]. Additional studies, which altered viscosity and subunit assembly experimental parameters, supported the assignment of residue 37 as the more dynamically accessible residue. Finally, the quenching data were also found to be dependent on protein concentration, implying that this difference in the mobility between the two residues is a sensitive probe of self-aggregation. Extrapolated dynamic quenching constants at low concentration of acrylamide were used to estimate the dimer-monomer equilibrium dissociation constants of normal and sickle beta apohemoglobins, and were found to be 5.6 and 2.4 microM, respectively, thus demonstrating distinct self-association properties of beta A and beta S apohemoglobins.

Monitoring the effect of subunit assembly on the structural flexibility of human alpha apohemoglobin by steady-state fluorescence.

A single energy transfer distance, between the sole intrinsic tryptophanyl donor [14(A12)] and a nonfluorescent sulfhydryl acceptor probe (4-phenylazophenylmaleimide, PAPM) attached to the only cysteine [104(G11)], has been employed to examine the effect of subunit assembly on the structure of the heme-free human alpha-hemoglobin. Efficiencies of energy transfer were measured in 0.05 M potassium phosphate buffer, pH 7.0, at 5 degrees C, and the structural flexibility of alpha-apohemoglobin, in the absence and presence of human beta-heme-containing chains, was examined by a steady-state solute quenching technique. The quenched efficiencies (EQ) and Förster distances (R0Q) were analyzed by least-squares to determine the goodness of fit (chi R2) for the assumed distribution parameters: average distance r and half-width hw. Data for alpha-apohemoglobin in the absence and presence of beta h chains yielded values for r of 18 and 22 A and hw of 20 and 8.5 A, respectively. Although the increase in r for alpha-apohemoglobin in the presence of beta h chains was presumably a consequence of additional quenching from the heme moiety, the change in the half-width strongly indicated a decrease in the flexibility of the alpha-apohemoglobin chain within the assembled protein. A transition in structural flexibility similar to that demonstrated here may be an important aspect of human hemoglobin assembly.

Steady state fluorescence energy transfer measurements of human alpha apohemoglobin structure.

A nonfluorescent reagent, 4-phenylazophenylmaleimide [4-PAPM], was attached to the sole cysteine residue [104(G11)] of alpha apohemoglobin (alpha degree) and served as an energy acceptor for the single intrinsic tryptophanyl [14(A12)] donor. This novel fluorescence system provided a transmolecular vehicle by which the overall structure of alpha degree could be monitored in 0.05 M potassium phosphate buffer at 5(0) C. Ratio of the emission intensities at 335 nm for monomeric solutions (5 x 10(-6) M) of both alpha degree and alpha degree [4-PAPM] furnished a measure of the efficiency of energy transfer and average distance of separation (r). An apparent increase in the value of r was observed from pH 6.5 to 8.5, suggesting that the conformation (the structural relationship of the A and G helical segments) of alpha degree is responsive to its electrostatic environment.