p-Hydroxybenzoylformic acid and (R)-(-)-p-hydroxymandelic acid, two antifungal compounds isolated from the liquid culture of the ectomycorrhizal fungus Pisolithus arhizus.

Two antifungal compounds isolated from the liquid culture medium of Pisolithus arhizus were identified as p-hydroxybenzoylformic acid and (R)-(-)-p-hydroxymandelic acid and given the trivial names pisolithin A and pisolithin B, respectively. The efficacy of the compounds to inhibit the germination of conidia of Truncatella hartigii was compared with that of commercially available structural analogues, and a comparable range of effectiveness for 50% germination inhibition (GI50) of conidia was recorded. The commercially available synthetic compounds (R)-mandelic acid, benzoylformic acid, and racemic p-hydroxymandelic acid, had GI50 values of 82, 72, and 59 micrograms/mL, respectively, as compared with the natural compounds pisolithin A, 67 micrograms/mL, and pisolithin B, 71 micrograms/mL. Two synthetic S enantiomers of mandelic acid, (S)-mandelic acid and (S)-(+)-p-hydroxymandelic acid, were the most effective compounds, with GI50 values of 31 and 33 micrograms/mL, respectively. A sodium salt of mandelic acid had no activity below 500 micrograms/mL. Pisolithin A and pisolithin B were compared with polyoxin D for inhibition of hyphal growth, as measured by protein estimation. Both pisolithin A and B measured higher levels of putative extractable protein than polyoxin D, but less mycelial wet weight was measured. It is suggested that the pisolithins caused a disruption of cell turgor. A measurement of mycelial dry weights of phytopathogens, incubated with the commercially available analogues, benzoylformic acid and racemic p-hydroxymandelic acid, indicated that benzoylformic acid was either more effective than, or as effective as, racemic p-hydroxymandelic acid or nystatin in arresting fungal growth.(ABSTRACT TRUNCATED AT 250 WORDS)

Synthesis and antiviral activity of some acyclic and C-acyclic pyrrolo[2,3-d]pyrimidine nucleoside analogues.

A series of acyclic and C-acyclic 7-deazapurine nucleosides have been synthesized and tested for antiviral activity. Reaction of the sodium salt of 2-amino-3,4-bis(aminocarbonyl)-5-(methylthio)pyrrole (6) with an appropriate electrophile gave pyrrole nucleosides which served as common intermediates to both the 7-deazaadenosine and the 7-deazaguanosine series. Several of these 5- and 5,6-substituted pyrrolo[2,3-d]pyrimidine nucleosides have shown activity against HIV virus in preliminary in vitro screens.

Characterization of a chemically synthesized RNA having the sequence of the yeast initiator tRNA(Met).

A 75-unit long oligoribonucleotide corresponding to the sequence of the Saccharomyces cerevisiae initiator tRNA was synthesized chemically. The crude RNA was purified, and the sequence was verified by RNA sequencing techniques. A particularly useful purification step involved hydrophobic chromatography on BND-cellulose. The purified RNA could be aminoacylated to 28% of a bona fide initiator tRNA(Met) sample and threonylated to 76% of the level observed with native tRNA(fMet) from E. coli.

Mixed deoxyribo- and ribo-oligonucleotides with catalytic activity.

The RNA of viroids and virusoids in plants, and the RNA transcripts of some tandemly repeated DNA sequences in the newt, can undergo self-catalysed cleavage to generate RNA with 5'-OH and 2',3'-cyclic-phosphate termini. These catalytic RNAs, or ribozymes, form a stem-loop secondary structure called a 'hammerhead' in which the catalytic (ribozyme) and substrate sequences are brought close together. Catalytically active mimics of hammerhead ribozymes can be readily made using oligoribonucleotides. Consequently, hammerhead analogues in which certain ribonucleotides are replaced by different ones have been constructed both to identify consensus residues required for cleavage activity and to determine the details of the cleavage mechanism. But these ribonucleotide-replacements tend to alter the conformation of the hammerhead by changing hydrogen-bonding and stacking potential at the position of substitution. We have now constructed structurally less-disrupted hammerhead analogues in which deoxyribonucleotides, which lack 2'-OH groups, are substituted for ribonucleotides. These mixed RNA-DNA polymers were synthesized using a strategy for the chemical synthesis of RNA that is compatible with DNA synthesis. Analysis of the cleavage products of several of these hammerhead analogues confirms the involvement in the reaction of the 2'-OH adjacent to the cleavage site in the substrate, and demonstrates that some 2'-OH groups in the catalytic region strongly affect activity. The results also indicate that the three-dimensional structure producing nucleic acid-type catalysis is not restricted to RNA.

Disposition and elimination of BIOLF-143, an antiviral agent, in the rabbit.

BIOLF-143, (N-(dimethylamino)methylene-9- [[2-hydroxy-1-(hydroxymethyl)ethoxy]methyl]guanine), an experimental, purine-based, acyclic nucleoside was administered by iv or ip injection to adult, male and female, albino New Zealand rabbits in order to determine: (1) the pharmacokinetic disposition, (2) the route and rate of excretion, (3) the biotransformation, and (4) the acute toxicity of the agent. HPLC analysis of blood plasma concentrations of BIOLF-143 was conducted following iv injections of 50 or 100 mg/kg and ip injections of 250 mg/kg. Tissue levels of BIOLF-143 were analyzed at 60 min following an ip injection of 100 mg/kg. Metabolism/excretion studies were conducted over a 48-hr period following ip injections of BIOLF-143 (100 mg/kg). The nucleoside was rapidly distributed in the body, with the dose-dependent, estimated plasma half-life being 21-44 min. The drug molecule was not extensively bound to proteins, being quantitatively recovered from plasma (94.4 +/- 3.2%) and a variety of tissues (85-100%). The bulk of the drug (80-87%) was recovered in the urine within 48 hr of treatment, with no metabolites or unique, unidentifiable peaks being detected in HPLC chromatograms. No drug residue was found in feces. No overt toxicity or untoward signs of latent toxicity were observed in animals receiving acute doses of BIOLF-143 up to 250 mg/kg ip. A potential target organ might be the kidney since high levels of drug residue were detected 60 min post-treatment and this appeared to be the route of elimination from the body.

The synthesis and functional evaluation of RNA and DNA polymers having the sequence of Escherichia coli tRNA(fMet).

Stepwise, solid-phase chemical synthesis has provided long RNA and DNA polymers related to the sequence of Escherichia coli tRNA(fMet). The 34-ribonucleotide oligomer corresponding to the sequence of the 5'-half tRNA molecule has been synthesized and then characterized by gel purification, terminal nucleotide determinations and sequence analysis. This 34-nucleotide oligomer serves as an acceptor in the RNA-ligase-catalyzed reaction with a phosphorylated 43-ribonucleotide oligomer corresponding to the sequence of the 3'-half molecule of tRNA(fMet). The DNA molecule having the sequence of tRNA(fMet) is a 76-deoxyribonucleotide oligomer with a 3'-terminal riboadenosine residue and all U residues replaced by T. These polymers have been compared with an oligodeoxyribonucleotide lacking all 2'-hydroxyl groups except for the 3'-terminal 2'-OH, an oligoribonucleotide lacking modified nucleosides and E. coli tRNA(fMet). The all-RNA 77-nucleotide oligomer can be aminoacylated by E. coli methionyl-tRNA synthetase preparation from E. coli with methionine and threonylated in the A37 position using a yeast extract. In agreement with work by Khan and Roe using tDNA(Phe) and tDNA(Lys), the rA77-DNA(fMet) can be aminoacylated, and preliminary evidence suggests that it can be threonylated to a small extent. Kinetic data support the notion that aminoacylation of tRNA(fMet) does not depend on the presence of 2'-hydroxyl groups with the exception of that in the 3'-terminal nucleotide.

Prevention of chain cleavage in the chemical synthesis of 2'-silylated oligoribonucleotides.

Strong aqueous ammonium hydroxide used to remove N-acyl protecting groups from synthetic oligoribonucleotides causes removal of some alkylsilyl protecting groups from 2'-hydroxyls and leads to chain cleavage. This problem is most severe when 30% ammonium hydroxide is used and substantially reduced but still detectable when 3:1 ammonium hydroxide-ethanol is used. We have virtually eliminated this unwanted cleavage by incorporating the labile phenoxyacetyl amino protecting group on adenosine and guanosine. The N-benzoyl protecting group remains adequate for cytidine nucleosides. Synthetic oligoribonucleotides containing these N-acylated nucleosides and 2'-t-butyldimethylsilyl or 2'-triisopropylsilyl protecting groups can be deacylated by room temperature treatment in saturated anhydrous methanolic ammonia (8-12 h) without causing any detectable chain cleavage.

Derivatization of controlled pore glass beads for solid phase oligonucleotide synthesis.

An improved and simplified procedure for the attachment of nucleosides onto long chain alkylamine controlled pore glass beads (LCAA-CPG) is presented. This procedure uses 1-(3-dimethylamino-propyl)-3-ethylcarbodiimide (DEC) to couple nucleoside 3'-succinates directly to the LCAA-CPG. The preparation of nucleoside 3'-succinate anhydrides, p-nitrophenyl, or pentachlorophenyl esters and the use of highly toxic dicyclohexylcarbodiimide (DCC) is no longer required. Procedures involving acidic activation of the LCAA-CPG before derivatization and a pre-synthesis capping are also described, which prevent the formation of oligonucleotides linked by 3'-phosphates to the LCAA-CPG. Evidence is presented indicating that this type of linkage is responsible for the apparently greater than 100% coupling yields observed for the first coupling cycle.

Total chemical synthesis of a 77-nucleotide-long RNA sequence having methionine-acceptance activity.

Chemical synthesis is described of a 77-nucleotide-long RNA molecule that has the sequence of an Escherichia coli Ado-47-containing tRNA(fMet) species in which the modified nucleosides have been substituted by their unmodified parent nucleosides. The sequence was assembled on a solid-phase, controlled-pore glass support in a stepwise manner with an automated DNA synthesizer. The ribonucleotide building blocks used were fully protected 5'-monomethoxytrityl-2'-silyl-3'-N,N-diisopropylaminophosphoram idites. p-Nitro-phenylethyl groups were used to protect the O6 of guanine residues. The fully deprotected tRNA analogue was characterized by polyacrylamide gel electrophoresis (sizing), terminal nucleotide analysis, sequencing, and total enzyme degradation, all of which indicated that the sequence was correct and contained only 3-5 linkages. The 77-mer was then assayed for amino acid acceptor activity by using E. coli methionyl-tRNA synthetase. The results indicated that the synthetic product, lacking modified bases, is a substrate for the enzyme and has an amino acid acceptance 11% of that of the major native species, tRNA(fMet) containing 7-methylguanosine at position 47.

Conformational properties of branched RNA fragments in aqueous solution.

The conformational properties of branched trinucleoside diphosphates ACC, ACG, AGC, AGG, AUU, AGU, AUG, ATT, GUU, and aAUU [XYZ = X(2'p5'Y)3'p5'Z] have been studied in aqueous solution by nuclear magnetic resonance (1H, 13C), ultraviolet absorption, and circular dichroism. It is concluded from these studies that the purine ring of the central residue (X; e.g., adenosine) forms a base-base stack exclusively with the purine or pyrimidine ring of the 2'-nucleotidyl unit (Y; 2'-residue). The residue attached to the central nucleoside via the 3'-5'-linkage (Z; 3'-residue) is "free" from the influence of the other two heterocyclic rings. The ribose rings of the central nucleoside and the 2'- and 3'-residues exist as equilibrium mixtures of C2'-endo (2E)-C3'-endo (3E) conformers. The furanose ring of the central nucleoside (e.g., A) when linked to a pyrimidine nucleoside via the 2'-5'-linkage shows a higher preference for the 2E pucker conformation (e.g., AUG, AUU, ACG, ca. 80%) than those linked to a guanosine nucleoside through the same type of bond (AGU, AGG, AGC, ca. 70%). This indicates some correlation between nucleotide sequence and ribose conformational equilibrium. The 2E-3E equilibrium of 2'-pyrimidines (Y) shows significant, sometimes exclusive, preference (70-100%) for the 3E conformation; 3'-pyrimidines and 2'-guanosines have nearly equal 2E and 3E rotamer populations; and the ribose conformational equilibrium of 3'-guanosines shows a preference (60-65%) for the 2E pucker. Conformational properties were quantitatively evaluated for most of the bonds (C4'-C5', C5'-O5', C2'-O2', and C3'-O3') in the branched "trinucleotides" AUU and AGG by analysis of 1H-1H, 1H-31P, and 13C-31P coupling constants. The C4'-C5' bond of the adenosine units shows a significant preference for the gamma + conformation. The dominant conformation about C4'-C5' and C5'-O5' for the 2'-and 3'-nucleotidyl units is gamma + and beta t, respectively, with larger gamma + and beta t rotamer populations for the 2'-unit. The increased conformational purity in the 2'-residue, compared to the 3'-residue, is ascribed to the presence of an ordered (adenine----2'-residue) stacked state. The favored rotamers about C3'-O3' and C2'-O2' are epsilon- and epsilon'-, respectively. The conformational features of AUU and AGG were compared to those of their constitutive dimers A3'p5'G, A2'p5'G, A3'p5'U, and A2'p5'U and monomers 5'pG and 5'pU.

Synthesis of hexanucleotide analogues containing diisopropylsilyl internucleotide linkages.

The synthesis of two silyl-linked hexanucleotide analogues is described. Hypochromicity and CD measurements indicate that the thymidine hexanucleotide analogue bears a strong resemblance to its phosphodiester-linked counterpart.

The acute toxicity of BIOLF-143 in the rat.

BIOLF-143, an experimental, purine-based acyclic nucleoside, was administered by iv or ip injection to young, adult, male and female Sprague-Dawley rats in order to determine the (1) pharmacokinetic disposition, (2) route and rate of excretion, and (3) acute toxicity. HPLC analysis of plasma, hepatic, and renal tissue levels was conducted following iv injections of 50 and 100 mg/kg and ip injections of 500 mg/kg. Metabolism/excretion studies were conducted following ip injections of BIOLF-143 (100 mg/kg). The assessment of acute toxicity was done following the ip injection of agent (250 mg/kg/hr for 8 consecutive hr). BIOLF-143 was rapidly distributed in the body, the estimated half-life in blood plasma being 18-23 min. The molecule was essentially unbound to plasma proteins (99% free) and was excreted unchanged in the urine. The recovery of the parent compound was 74.3 +/- 5.9% and 88.5 +/- 15.9% for male and female rats, respectively, with no metabolites or unidentifiable peaks being detected in HPLC chromatograms. No overt toxicity or untoward signs of latent toxicity were observed in the animals receiving doses up to 2000 mg/kg ip. No residues were detected in tissues at 24 hr post-treatment. A potential target organ in subchronic studies might be the kidney. High residue levels of BIOLF-143 were detected 1.0 hr post-treatment; however, the organ had cleared all residues by 24 hr after administration.

Prevention of guanine modification and chain cleavage during the solid phase synthesis of oligonucleotides using phosphoramidite derivatives.

Phosphoramidite reagents can phosphitylate guanine bases at the O6-position during solid phase synthesis and serious chain cleavage occurs if the base phosphitylation is not eliminated before the iodine/water oxidation step. This can be accomplished by blocking the O6-position with a 2-cyanoethyl protecting group for deoxyribonucleotides or with a p-nitrophenylethyl group for ribonucleotides, regenerating the guanine base with water or acetate ions, or using N-methylanilinium trifluoroacetate (TAMA) as the phosphoramidite activator. The effectiveness of these methods was demonstrated by both 31P NMR studies and by the synthesis of d(Gp)23G, (Gp)14G, and d-(Gp)13rG sequences.

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.

Antimyocarditic activity of the guanine derivative BIOLF-70 in a coxsackievirus B3 murine model.

Prophylactic administration of a nontoxic dose of 9-[[2-benzyloxyl-1-(benzyloxymethyl)ethoxy]methyl]-6-chlo roguanine (BIOLF-70) to mice reduced the number of myocarditic lesions induced by coxsackievirus B3 (CVB3). BIOLF-70 exhibited minimal antiviral activity against CVB3 in HeLa cells and murine neonatal skin fibroblasts and minimally reduced CVB3 yields in heart tissues. The drug had no effect on serum anti-CVB3 neutralizing antibody titers and did not induce the production of interferon. Flow microfluorometric analyses of splenic lymphocytes taken from BIOLF-70-treated, CVB3-inoculated mice at 7 days postinoculation showed that the proportion of T lymphocytes was increased, as measured by fluorescent staining of Thy-1 and Lyt-2 surface markers, compared with the proportion of T lymphocytes in splenic cells from virus-inoculated or BIOLF-70-treated or normal groups of mice. Splenic lymphocytes from BIOLF-70-treated, CVB3-inoculated mice showed reduced cytotoxic activity against CVB3-infected target fibroblasts. Splenic cells from BIOLF-70-treated, CVB3-inoculated mice had slightly higher natural killer cell activity than did those from the other three groups of mice, which had comparatively similar levels of natural killer cell activity. The data suggest that BIOLF-70 exerts antimyocarditic activity perhaps by some antiviral activity in heart tissues and by immunomodulatory mechanisms which appear to involve T suppressor or T cytotoxic lymphocyte subpopulations and natural killer cells.

Experimental ocular herpetic infections in rabbits. Treatment with 9-([2-hydroxy-1-(hydroxymethyl)ethoxy]methyl)guanine.

A new acyclic nucleoside, 9-([2-hydroxy-1-(hydroxymethyl)ethoxy]methyl)guanine (BIOLF-62), was found to be efficacious in the treatment of experimental ocular herpes simplex virus infections in rabbits. Complete healing of herpetic lesions occurred in a majority of animals after six days of topical treatment, three times per day. No toxic effects were observed in uninfected, drug-treated eyes. The BIOLF-62 treatment blocked viral replication in infected eyes sufficiently to make recovery of virus from any of the drug-treated eyes impossible, whereas virus was recovered from all placebo-treated eyes.

Sensitivity of equine herpesviruses 1 and 3 in vitro to a new nucleoside analogue, 9-[[2-hydroxy-1-(hydroxymethyl) ethoxy] methyl] guanine.

The following members of the Herpetoviridae family were tested to determine their sensitivities to the new antiviral drug, BIOLF-62: equine herpesvirus types 1 and 3, human herpesvirus types 1 and 2, swine herpesvirus, bovine herpesvirus type 4, feline herpesvirus, canine herpesvirus, and herpes simiae virus. Equine herpesviruses 1 and 3, human herpesviruses 1 and 2, and herpes simiae virus were all sensitive to BIOLF-62 at concentrations of less than 0.55 micrograms/ml. Equine herpesvirus types 1 and 3 were particularly sensitive, viral median effective dose (ED50) concentrations of the drug being only 0.033 and 0.16 micrograms/ml, respectively. Such high antiviral potency and low cell toxicity indicate that BIOLF-62 might be useful in the treatment of infected animals.

Synergism among BIOLF-62, phosphonoformate, and other antiherpetic compounds.

9-[[2-Hydroxy-1-(hydroxymethyl)ethoxy]methyl]guanine (BIOLF-62) is highly synergistic with either phosphonoformate or phosphonoacetate when used in combination against herpes simplex virus types 1 and 2 in vitro. Acycloguanosine did not show significant synergism with these two compounds. Bromovinyldeoxyuridine and phosphonoformate were highly synergistic against herpes simplex virus type 2, but not against type 1.

A new nucleoside analog, 9-[[2-hydroxy-1-(hydroxymethyl)ethoxyl]methyl]guanine, highly active in vitro against herpes simplex virus types 1 and 2.

A novel nucleoside analog, 9-[[2-hydroxy-1-(hydroxymethyl)ethoxy]methyl]-guanine (BIOLF-62), was found to have potent antiviral activity against herpes simplex virus types 1 and 2 at concentrations well below cytotoxic levels. For example, the Patton strain of herpes simplex virus type 1 was susceptible at concentrations 140- to 2,900-fold below that which inhibited cell division by 50%, depending upon the cell line used for assay. Different herpesvirus strains varied considerably in their susceptibility to the drug, as did results obtained with the same virus strain in different cell lines. BIOLF-62 compared favorably with 5-iodo-2'-deoxyuridine and acyclovir with respect to ratios of viral to cell inhibitory drug concentrations. Patterns of drug resistance to herpesvirus mutants suggested that the primary mode of action of BIOLF-62 is different from that of known antiviral compounds. Human adenovirus type 2, varicella-zoster virus, and Epstein-Barr virus were inhibited by this drug but at concentrations within the cell inhibitory range. Vaccinia virus and human cytomegalovirus were not inhibited at high drug concentrations.