ABSTRACT
The structure of Colletotrichum lupini mitogenome is typical of a fungus from the genus Colletotrichum similar to C. acutatum and C. lindemuthianum. The sequenced mitogenome has a total length of 36 554 bp. The nucleotide composition in the following genome is: 35.7% - A, 16.5% - C, 13.4% - G and 29.9% - T. In the C. lupini mitogenome we identified 46 genes: 15 protein coding genes, two ribosomal RNAs and 29 tRNA genes.
ABSTRACT
Container nurseries in northeastern Poland annually provide several million tree seedlings used for afforestation of post-agricultural soils and restocking of forests. Beech (Fagus sylvatica), one of the main forest tree species in Poland, is largely applied in this process. We have observed in container nurseries of young beech saplings in Poland symptoms of wilting and damping off. The average rate of damage in container cultures was 21 to 31%, including those beech seedlings (5 to 7%) that eventually succumbed. The infected leaves, stems, and roots were washed in distilled water and then disinfected with 70% ethanol and 1% sodium hypochlorite. The plates with plant material were incubated at 22°C for approximately 7 days. A total of 14 single-spore fungal cultures isolated from infected beech seedlings were identified, based on morphological features, as F. avenaceum (1,2). PDA colonies consisted of flat, aerial mycelium that was white to rose, with rose to carmine pigment on the reverse surface, with small black sclerotial bodies. Microconidia were cylindrical with one to four septa, predominantly 10 to 25 µm long. Macroconidia were hyaline, straight to slightly curved, four- to six-septate (generally 50 to 65 × 4 to 4.5 µm). All isolates were deposited in the Department of Plant Diagnostics and Pathophysiology Fungal Culture Collection (Accession Nos. FL.Ol.35.13-42.13) (University of Warmia and Mazury in Olsztyn, Poland) and are stored in 15% glycerol at -80°C. DNA from the fungal cultures was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete of EF1α gene sequence was amplified with the primers avef11 (CGACTCTGGCAAGTCGACCA) and avef12 (TACCAATGACGGTGACATAG) and sequenced. A single sequence from isolate FL.Ol.35.13, which was used in the beech infection study (Gen Bank Accession No. KM985475), was obtained. It had the length of 411 bp and was 100% identical to sequences of several isolates of F. avenaceum at GenBank (HQ704072.1, EF512014.1, and HQ704073). To verify pathogenicity of the fungus, a controlled infection was carried out with spores of isolate FL.Ol.35.13. The spores were used at the density of 2 × 105/ml. Seeds of beech were sown to sterile perlite, and after cotyledon emergence they were watered with F. avenaceum spore suspension (5 ml/plant). Control plants were treated with water only. After 30 days, the rate of disease was estimated. Severely infected seedlings showed typical symptoms of damping-off and Fusarium wilt, while in less-affected seedlings, zonated spots with F. avenaceum sporodochia could be seen on cotyledons. No infection symptoms were seen on control seedlings. Fungal cultures were started from plants subjected to controlled infection, and, based on morphological features, the fungus was identified again as F. avenaceum. To our knowledge this is the first report of Fusarium (F. avenaceum) disease of beech in container nurseries in Poland. References: (1) W. Gerlach and H. I. Nirenberg. Mitt. Biol. Bundesanst. Land- Forstwirsch., Berlin-Dahlem 209:1, 1982. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Professional, Ames, IA, 2006.
ABSTRACT
UNLABELLED: Lignans are a group of diphenolic compounds with anticancer and antioxidant properties which are present in various grains, although their effect on toxigenic fungi has been poorly examined to date. In this study, the impact of the plant lignans pinoresinol and secoisolariciresinol on growth and trichothecene biosynthesis by five Fusarium graminearum strains of different chemotypes was examined in vitro. Both tested lignans exhibited radial growth inhibition against the fungal strains. RT-qPCR analyses of tri4, tri5 and tri11 genes encoding the first steps of the trichothecene biosynthesis pathway revealed a decrease in tri mRNA levels in lignan-treated fungal cultures. Correspondingly, decreased accumulation of toxins in lignan-treated cultures was confirmed by GC-MS analysis. This is the first study to demonstrate the inhibitory effect of both pinoresinol and secoisolariciresinol on growth and trichothecene biosynthesis in F. graminearum. SIGNIFICANCE AND IMPACT OF THE STUDY: Knowledge of the regulation of trichothecene production in Fusarium graminearum by environmental cues is key to the design of novel strategies to reduce mycotoxin levels in grains. Here, we show that the lignans pinoresinol and secoisolariciresinol, which occur in wheat grains, inhibit radial growth and decrease trichothecene levels in five F. graminearum strains. RT-qPCR analysis reveals that the reduction in trichothecene level in lignan-treated fungal cultures is associated with decreased mRNA transcript levels for the tri4, tri5 and tri11 genes that are involved in the trichothecene biosynthesis pathway.
