Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 63
Filter
1.
Int J Tuberc Lung Dis ; 23(9): 980-988, 2019 09 01.
Article in English | MEDLINE | ID: mdl-31615604

ABSTRACT

BACKGROUND: Achieving the 90-90-90 targets for tuberculosis (TB) will require interventions that enhance diagnosis, linkage, treatment and adherence to care. As a first step in the process, our team designed a suite of smartphone applications known as miLINC to improve time from diagnosis to treatment initiation in drug-resistant TB patients.SETTING: Three clinical locations in a large, peri-urban district in KwaZulu-Natal, South Africa.OBJECTIVE: To assess the acceptability, feasibility and impact of the miLINC mobile health applications as a solution to reducing the time from presentation to treatment initiation of rifampicin-resistant (RR) TB patients.METHODS: We used a prospective, observational quality improvement evaluation of miLINC's impact among newly diagnosed patients with RR-TB.RESULTS: A convenience sample comprising details of 6341 patients with presumptive TB were entered into miLINC. Of the 631 TB-positive sputum specimens, 41 (6.5%) were found to be RR-TB. The mean time from clinical presentation to RR-TB treatment initiation was 3 days, 21 h, 17 min.CONCLUSION: This is the first study to suggest that the time from presentation to diagnosis and to treatment initiation for patients with RR-TB can be significantly improved using an integrated approach combining technology with appropriate human resources.


Subject(s)
Antitubercular Agents/administration & dosage , Mobile Applications , Smartphone , Tuberculosis, Multidrug-Resistant/drug therapy , Adolescent , Adult , Aged , Aged, 80 and over , Child , Child, Preschool , Female , Humans , Infant , Male , Middle Aged , Mycobacterium tuberculosis/drug effects , Mycobacterium tuberculosis/isolation & purification , Prospective Studies , Rifampin/administration & dosage , South Africa , Time-to-Treatment , Tuberculosis, Multidrug-Resistant/diagnosis , Young Adult
2.
BJS Open ; 2(4): 246-253, 2018 Aug.
Article in English | MEDLINE | ID: mdl-30079394

ABSTRACT

BACKGROUND: Length of hospital stay (LOS) may serve as a surrogate measure of healthcare quality and resource use, particularly when transfers of care and readmissions are accounted for. This study aimed to benchmark true hospital stay by measuring index, transfer and readmission stays across the range of digestive cancer surgery. METHODS: A cohort study of all patients undergoing resection for cancer of the oesophagus, stomach, liver, pancreas, colon or rectum in 2012-2016 was undertaken. Index LOS, transfer and readmission stays were merged into an 'aggregated' length of stay (a-LOS), and compared between organ sites and between open and minimal-access approaches. RESULTS: In total, 24 354 resections were reported (mean age of patients 68·3 years; 51·3 per cent were men). Resections were reported as laparoscopic for 9151 procedures (37·6 per cent), with a further 283 (3·0 per cent) described as converted to open surgery. Use of a-LOS compared with standard LOS added a median of 5 days for pancreatoduodenectomy, 4 days for major liver resections, 3 days for oesophageal and gastric resections, and 2 days for minor liver, distal pancreatic and rectal resections. CONCLUSION: Overall hospital stay across organ sites and procedures is better described by a-LOS. The study benchmarks the use of total hospital days during the first 30 days in a universal healthcare system.

3.
Int J Circumpolar Health ; 76(1): 1391651, 2017.
Article in English | MEDLINE | ID: mdl-29069984

ABSTRACT

Patients, relatives, healthcare workers and administrators are concerned about the quality of care offered. We aimed to explore the treatment of acute myocatrdial infarction (AMI) in Northern Norway, compare it with the national figures, and document whether there is an equal quality of care or not. The retrospective study included data on patients' treatment for AMI. The following sources were employed. The Norwegian Patient Registry, National Quality of Care Database, Norwegian Myocardial Infarction Registry and data from the National Air Ambulance Services of Norway. The period 2012-2014/15 was studied and the variables were: incidence of AMI, gender and age adjusted rates of AMI and revascularization (PCI, CABG) based on patient's place of living (according to hospital catchment area) and 30-day survival rate. The annual incidence of AMI was 9% higher in the northern region. Significant incidence variations (2.7-5.9 AMI/1000 inhabitants) between the hospitals' catchment areas were revealed. The 30-day survival rate varied between 85.1-92.1% between hospitals. The variation in revascularization/AMI rate was 0.72-1.54. Air amublance services' availability varied through the day. In conclusion, significant variations in the AMI rate and an unequal service within the region was revealed.


Subject(s)
Myocardial Infarction/epidemiology , Myocardial Infarction/surgery , Quality of Health Care/statistics & numerical data , Residence Characteristics/statistics & numerical data , Air Ambulances/statistics & numerical data , Arctic Regions/epidemiology , Coronary Artery Bypass/methods , Coronary Artery Bypass/mortality , Humans , Incidence , Myocardial Infarction/mortality , Norway/epidemiology , Percutaneous Coronary Intervention/methods , Quality Indicators, Health Care , Registries , Retrospective Studies , Socioeconomic Factors , Survival Analysis
4.
Br J Anaesth ; 113(5): 800-6, 2014 Nov.
Article in English | MEDLINE | ID: mdl-25031262

ABSTRACT

BACKGROUND: Bone cement implantation syndrome (BCIS) is characterized by hypoxia, hypotension, and loss of consciousness occurring around the time of bone cementation. Using a recently proposed severity classification of BCIS, we estimated the incidence of and risk factors for BCIS and its impact on mortality in cemented hemiarthroplasty for femoral neck fractures. METHODS: In this retrospective study, 1016 patients undergoing cemented hemiarthroplasty were included. Medical history and medication were obtained from medical records. Anaesthesia charts for all patients were reviewed for mean arterial pressure, arterial oxygen saturation, and heart rate before, during, and after cementation. Each patient was classified as having no BCIS (grade 0) or BCIS grade 1, 2, or 3, depending on the degree of hypotension, arterial desaturation, or loss of consciousness around cementation. RESULTS: The incidence of BCIS grade 1, 2, and 3 were 21%, 5.1%, and 1.7%, respectively. Early mortality in BCIS grade 1 (9.3%) did not differ significantly from BCIS grade 0 (5.2%), while early mortality in BCIS grade 2 (35%) and grade 3 (88%) were significantly higher when compared with grades 0 and 1. Early mortality was also higher in BCIS grade 3 when compared with grade 2. Independent predictors for severe BCIS were: ASA grade III-IV, chronic obstructive pulmonary disease, and medication with diuretics or warfarin. Severe BCIS was associated with 16-fold increase in mortality. CONCLUSIONS: BCIS is a commonly occurring phenomenon in cemented hemiarthroplasty and severe BCIS has a huge impact on early and late mortality.


Subject(s)
Arthroplasty/adverse effects , Bone Cements/adverse effects , Femoral Neck Fractures/surgery , Syndrome , Aged , Aged, 80 and over , Arthroplasty/mortality , Female , Femoral Neck Fractures/mortality , Humans , Incidence , Kaplan-Meier Estimate , Male , Middle Aged , Orthopedic Procedures/adverse effects , Risk Factors , Survival Analysis , Treatment Outcome
5.
Int J Tuberc Lung Dis ; 18(4): 438-40, 2014 Apr.
Article in English | MEDLINE | ID: mdl-24670699

ABSTRACT

In a mobile deployment of Xpert(®) MTB/RIF (Xpert) at the public event for 2012 South African World TB Day, Xpert testing was offered to tuberculosis (TB) symptomatic clients from gold mining and surrounding communities. Considerations before implementation included effective TB symptom screening; safe, effective sputum collection; uninterrupted electricity supply; stringent instrument verification and provision of on-site results. Public event Xpert testing is feasible; however, the case-finding rate was very low (0.7%). We recommend exploring enhanced symptom screening algorithms to improve pre-test probability, cost-effectiveness analysis, exploring alternate electrical fail-safes and on-site data connectivity and improving management of client expectations.


Subject(s)
Bacteriological Techniques , Community Health Services/organization & administration , DNA, Bacterial/genetics , Mobile Health Units/organization & administration , Molecular Diagnostic Techniques , Mycobacterium tuberculosis/genetics , Tuberculosis, Pulmonary/diagnosis , DNA, Bacterial/isolation & purification , Feasibility Studies , Health Services Accessibility/organization & administration , Humans , Mycobacterium tuberculosis/isolation & purification , Outcome and Process Assessment, Health Care , Predictive Value of Tests , Prevalence , Program Evaluation , South Africa/epidemiology , Sputum/microbiology , Time Factors , Tuberculosis, Pulmonary/epidemiology , Tuberculosis, Pulmonary/microbiology
6.
J Endod ; 40(3): 412-6, 2014 Mar.
Article in English | MEDLINE | ID: mdl-24565662

ABSTRACT

INTRODUCTION: Root canal irrigation is vital to thorough debridement and disinfection, but the mechanisms that contribute to its effectiveness are complex and uncertain. Traditionally, studies in this area have relied on before-and-after static comparisons to assess effectiveness, but new in situ tools are being developed to provide real-time assessments of irrigation. The aim in this work was to measure a cross section of the velocity field in the fluid flow around a polymer rotary finishing file in a model root canal. METHODS: Fluorescent microparticles were seeded into an optically accessible acrylic root canal model. A polymer rotary finishing file was activated in a static position. After laser excitation, fluorescence from the microparticles was imaged onto a frame-transfer camera. Two consecutive images were cross-correlated to provide a measurement of a projected, 2-dimensional velocity field. RESULTS: The method reveals that fluid velocities can be much higher than the velocity of the file because of the shape of the file. Furthermore, these high velocities are in the axial direction of the canal rather than only in the direct of motion of the file. CONCLUSIONS: Particle image velocimetry indicates that fluid velocities induced by the rotating file can be much larger than the speed of the file. Particle image velocimetry can provide qualitative insight and quantitative measurements that may be useful for validating computational fluid dynamic models and connecting clinical observations to physical explanations in dental research.


Subject(s)
Dental Pulp Cavity/anatomy & histology , Root Canal Irrigants/chemistry , Therapeutic Irrigation/instrumentation , Acrylic Resins/chemistry , Equipment Design , Fluorescent Dyes , Humans , Hydrodynamics , Lasers, Solid-State , Models, Anatomic , Optical Imaging/methods , Photography/methods , Polymers/chemistry , Rheology/methods , Rotation , Surface Properties
7.
Neuropsychologia ; 53: 233-45, 2014 Jan.
Article in English | MEDLINE | ID: mdl-24296251

ABSTRACT

The involvement of the hippocampus (HC) in episodic memory is well accepted; however it is unclear how each subfield within the HC contributes to memory function. Recent magnetic resonance imaging (MRI) studies suggest differential involvement of hippocampal subfields and subregions in episodic memory. However, most structural MRI studies have examined the HC subfields within a single subregion of the HC and used specialised experimental memory paradigms. The purpose of the present study was to determine the association between volumes of HC subfields throughout the entire HC structure and performance on standard neuropsychological memory tests in a young, healthy population. We recruited 34 healthy participants under the age of 50. MRI data was acquired with a fast spin echo (FSE) sequence yielding a 0.52×0.68×1.0 mm(3) native resolution. The HC subfields - the cornu ammonis 1-3 (CA), dentate gyrus (DG), and subiculum (SUB) - were segmented manually within three hippocampal subregions using a previously defined protocol. Participants were administered the Wechsler Memory Scale, 4th edition (WMS-IV) to assess performance in episodic memory using verbal (Logical Memory, LM) and visual (Designs, DE; visual-spatial memory, DE-Spatial; visual-content memory, DE-Content) memory subtests. Working memory subtests (Spatial Addition, SA; and Symbol Span, SSP) were included as well. Working memory was not associated with any HC volumes. Volumes of the DG were correlated with verbal memory (LM) and visual-spatial memory (DE-Spatial). Posterior CA volumes correlated with both visual-spatial and visual-object memory (DE-Spatial, DE-Content). In general, anterior subregion volumes (HC head) correlated with verbal memory, while some anterior and many posterior HC subregion volumes (body and tail) correlated with visual memory scores (DE-Spatial, DE-Content). In addition, while verbal memory showed left-lateralized associations with HC volumes, visual memory was associated with HC volumes bilaterally. This the first study to examine the associations between hippocampal subfield volumes across the entire hippocampal formation with performance in a set of standard memory tasks.


Subject(s)
Hippocampus/anatomy & histology , Memory, Episodic , Adult , Age Factors , Brain Mapping , Dentate Gyrus/anatomy & histology , Female , Humans , Magnetic Resonance Imaging/methods , Male , Memory, Short-Term , Middle Aged , Neuropsychological Tests , Organ Size , Space Perception , Speech Perception , Visual Perception , Young Adult
8.
Dent Today ; 26(1): 98-103; quiz 103, 115, 2007 Jan.
Article in English | MEDLINE | ID: mdl-17278604

ABSTRACT

This article focuses on the endodontic-restorative interface. The reduction of bacterial contamination via chemical-mechanical debridement during conventional endodontic treatment, in conjunction with canal obturation and timely restorative treatment using a rubber dam to prevent the microbial recontamination of the canal system, will significantly improve the clinical outcome.


Subject(s)
Post and Core Technique , Root Canal Irrigants , Root Canal Obturation/methods , Root Canal Preparation/methods , Calcium Hydroxide , Chelating Agents , Chlorhexidine , Edetic Acid , Humans , Prognosis , Root Canal Preparation/instrumentation , Sodium Hypochlorite , Ultrasonic Therapy
9.
Respir Med ; 93(3): 196-201, 1999 Mar.
Article in English | MEDLINE | ID: mdl-10464878

ABSTRACT

This study aimed to determine the relationship between improvement in lung function and changes in transthoracic electrical bioimpedance (TEB) after thoracentesis in patients with pleural effusions. Fifteen patients with pleural effusions due to either malignant (n = 8) or cardiac (n = 7) diseases were included. Pulmonary function was assessed before and after thoracentesis. During thoracentesis the patients were monitored with TEB. Using linear correlation analysis, the increases for each litre of aspirated thoracic fluid were: forced expiratory volume in 1 s (FEV1) 0.261; forced vital capacity (FVC) 0.331; total lung capacity (TLC) 0.58; and the lung diffusing capacity (DLCO); 2.4 ml min-1 mmHg-1. Baseline impedance increased by 2.3 Ohm l-1 aspirated thoracic fluid. The relative increase in baseline impedance was twice as high for patients with cancer as for patients with heart failure (P < 0.05). We found only minor changes in systolic blood pressure and mean arterial pressure. The improvements in diffusing capacity, airflow, and lung volumes after thoracentesis are correlated to an increase in baseline impedance, but changes are dependent on the primary disease.


Subject(s)
Cardiography, Impedance , Paracentesis , Pleural Effusion/surgery , Respiration , Aged , Female , Forced Expiratory Volume , Humans , Male , Middle Aged , Pleural Effusion/physiopathology , Respiratory Function Tests , Total Lung Capacity , Vital Capacity
10.
J Endod ; 20(8): 389-94, 1994 Aug.
Article in English | MEDLINE | ID: mdl-7996106

ABSTRACT

The osseous reaction of IRM and EBA cement were studied utilizing an intraosseous implant technique in rats. Samples of IRM, EBA cement, and amalgam were placed into polyethylene tubes and subsequently introduced surgically into rat tibias. Specimens of each were evaluated histologically after 7, 14, 21, 56, and 100 days. The IRM and amalgam samples demonstrated essentially complete healing at 56 days. The EBA cement samples displayed a slightly greater inflammatory response up to the 56-day interval; however, they also showed complete healing by 100 days. A favorable osseous reaction was seen with both of these zinc oxide-eugenol materials.


Subject(s)
Aluminum Oxide/toxicity , Methylmethacrylates/toxicity , Osteitis/chemically induced , Root Canal Filling Materials/toxicity , Zinc Oxide-Eugenol Cement/toxicity , Animals , Bone and Bones/drug effects , Male , Prostheses and Implants/adverse effects , Rats , Rats, Sprague-Dawley , Tibia/drug effects , Tibia/pathology , Time Factors
11.
Plant Cell ; 6(4): 531-543, 1994 Apr.
Article in English | MEDLINE | ID: mdl-12244247

ABSTRACT

A simple procedure is described for the mechanical isolation of protoplasts of unfertilized and fertilized barley egg cells from dissected ovules. Viable protoplasts were isolated from ~75% of the dissected ovules. Unfertilized protoplasts did not divide, whereas almost all fertilized protoplasts developed into microcalli. These degenerated when grown in medium only. When cocultivated with barley microspores undergoing microspore embryogenesis, the protoplasts of the fertilized egg cells developed into embryo-like structures that gave rise to fully fertile plants. On average, 75% of cocultivated protoplasts of fertilized egg cells developed into embryo-like structures. Fully fertile plants were regenerated from ~50% of the embryo-like structures. The isolation-regeneration techniques may be largely genotype independent, because similar frequencies were obtained in two different barley varieties with very different performance in anther and microspore culture. Protoplasts of unfertilized and fertilized eggs of wheat were isolated by the same procedure, and a fully fertile wheat plant was regenerated by cocultivation with barley microspores.

12.
Plant Mol Biol ; 18(3): 585-9, 1992 Feb.
Article in English | MEDLINE | ID: mdl-1536930

ABSTRACT

We have characterized a gene (Ltp1) encoding a barley lipid transfer protein. Northern blot analysis showed that Ltp1 mRNA accumulates specifically in the aleurone layer of developing and germinating seeds. Southern blot analysis indicated that LTP1 protein is encoded by a single gene in barley. Sequence analysis of Ltp1 showed that it contains an open reading frame of 351 bp interrupted by a single intron of 133 bp. Transient expression assays indicated that 702 bp of the 5' upstream region of Ltp1 is sufficient to direct aleurone-specific expression during late seed development and early germination.


Subject(s)
Carrier Proteins/genetics , Hordeum/genetics , Amino Acid Sequence , Antigens, Plant , Base Sequence , Blotting, Northern , Genes, Plant , Hordeum/metabolism , Introns , Kinetics , Molecular Sequence Data , Open Reading Frames , Plant Proteins , RNA, Messenger/genetics , RNA, Messenger/metabolism , Seeds/metabolism , Transcription, Genetic
13.
Acta Oncol ; 31(5): 577-83, 1992.
Article in English | MEDLINE | ID: mdl-1358136

ABSTRACT

Ever since its introduction in 1952, Ketogan has consisted of a combination of the opioid cetobemidone and a spasmolytic drug, A29, in the ratio of 1:5. Its main limitations are the relatively short duration of action and an apparent ceiling effect due to A29. We therefore developed a cetobemidone formulation with sustained release properties (cetobem. s.r.). Forty-seven patients with advanced cancer with moderate/severe pain, treated with regular doses of Ketogan tablets took part in an open phase 1 type pharmacologic/toxicologic study comparing Ketogan tablets and cetobem. s.r. The patients spent at least 4 days in the department. After evaluation during 12 h with Ketogan tablets (3-4 dosing intervals), a loading phase lasting for 36 h with cetobem. s.r. given twice/24 h (total dose of Ketogan tablets per 24 h divided by 2), and synchronous reduction of the dose of Ketogan tablets, a similar evaluation period of 12 h was performed when on treatment with cetobem. s.r. alone. Comparison of data from the two observation periods showed the following: Average relative bioavailability 0.77 SD 0.28. Only 2 patients were remedicated before 12 h when on cetobem. s.r. Duration of action mean 11.9 h, SD 0.3 h. There was no significant difference between Ketogan tablets and cetobem. s.r. periods concerning 'time with no pain'. Side-effects were few. The only significant difference was dry mouth being more severe during the tablet period. Vital signs were unaffected by treatment. It is concluded that cetobem. s.r. can be given every 12 h to cancer patients with chronic pain with satisfactory analgesic effect, a very modest change in side-effect profile and no significant effects on vital signs when substituting cetobem. s.r. for Ketogan tablets in equal daily doses.


Subject(s)
Analgesics, Opioid/administration & dosage , Meperidine/analogs & derivatives , Neoplasms/physiopathology , Pain, Intractable/drug therapy , Adult , Aged , Analgesics, Opioid/pharmacokinetics , Biological Availability , Capsules , Delayed-Action Preparations , Female , Humans , Male , Meperidine/administration & dosage , Meperidine/pharmacokinetics , Middle Aged , Neoplasms/mortality
14.
Ugeskr Laeger ; 154(5): 255-60, 1992 Jan 27.
Article in Danish | MEDLINE | ID: mdl-1736457

ABSTRACT

The theory, method and apparatus behind a new computer technology for transthoracic electrical bioimpedance are described. Measurements and calculations of changes in the electrical conductivity of the thoracic segment during systolic upstroke provides the basis for non-invasive determination of stroke volume and cardiac output. Bioimpedance further offers a sensitive indicator of the content of thoracic fluid. Reports comparing measurements of cardiac output in various clinical conditions by bioimpedance versus invasive methods in general show good correlation. The field of applications and limitations of bioimpedance are described. Measurements are reproducible and the method can also be used in evaluating the cardiodynamic exercise response.


Subject(s)
Cardiography, Impedance/methods , Cardiac Output/physiology , Cardiography, Impedance/instrumentation , Cardiography, Impedance/standards , Computers , Hemodynamics , Humans
15.
Proc Natl Acad Sci U S A ; 88(18): 8140-4, 1991 Sep 15.
Article in English | MEDLINE | ID: mdl-1896461

ABSTRACT

C-terminal processing of low pI barley alpha-amylase (AMY1) results in multiple forms in malt, aleurone protoplasts, and transformed yeast. Expression of an AMY1 cDNA in yeast thus leads to four secreted forms with distinct pI values between 4.7 and 5.1 and essentially identical Mr. AMY1-1 and AMY1-2 lacking the C-terminal Arg-Ser are generated by carboxypeptidase in vitro from AMY1-3 and AMY1-4, respectively. In vivo processing is due to the KEX1-encoded yeast carboxypeptidase. AMY1-2 and AMY1-4 are fully active, whereas AMY+-1 and AMY1-3 retain 3-4% activity toward p-nitrophenyl maltoheptaoside and have one fewer SH group, due to reaction with glutathione. AMY1-1-AMY1-4 are indistinguishable from malt AMY1 with respect to Ca(2+)-, substrate-, and beta-cyclodextrin-binding as well as recognition by three monoclonal antibodies and limited proteolysis by proteinase K. Transient AMY1 precursors present in barley aleurone protoplasts were trapped by addition of serine carboxypeptidase inhibitors, indicating that endogenous carboxypeptidase participates in the maturation of AMY1 during germination. Three pairs of precursor/mature AMY1 forms are recognized, presumably corresponding to the three genes encoding AMY1. Malt carboxypeptidase II can convert in vitro the precursors isolated from protoplasts into processed enzyme, and AMY1 from malt accordingly lacks the C-terminal heptapeptide. This report thus demonstrates posttranslational protein modification by carboxypeptidase in higher plants.


Subject(s)
alpha-Amylases/metabolism , Amino Acid Sequence , Edible Grain , Hordeum , Isoelectric Point , Kinetics , Molecular Sequence Data , Protein Processing, Post-Translational , Recombinant Proteins , Saccharomyces cerevisiae , Sequence Alignment , alpha-Amylases/chemistry
16.
Proc Natl Acad Sci U S A ; 88(16): 7266-70, 1991 Aug 15.
Article in English | MEDLINE | ID: mdl-1831269

ABSTRACT

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.


Subject(s)
Abscisic Acid/pharmacology , DNA/genetics , Genes, Plant/drug effects , Gibberellins/pharmacology , Hordeum/genetics , Oryza/genetics , Transcription, Genetic/drug effects , Base Sequence , Chloramphenicol O-Acetyltransferase/genetics , Chloramphenicol O-Acetyltransferase/metabolism , DNA/drug effects , Hordeum/enzymology , Molecular Sequence Data , Promoter Regions, Genetic , Protoplasts/physiology , Recombinant Proteins/metabolism , TATA Box , Transfection , alpha-Amylases/genetics
19.
Hereditas ; 115(3): 255-66, 1991.
Article in English | MEDLINE | ID: mdl-1816169

ABSTRACT

Two different techniques for mechanical isolation of microspores from the barley cultivar 'Igri' have been evaluated. The anthers were subjected to mannitol pretreatment prior to microspore isolation, which was performed either by maceration with a pestle or by blending of the excised anthers. The microspores were purified by centrifugation and washing and cultured in liquid medium on a membrane support. In the following four weeks the microspores developed into embryoids, which were subsequently regenerated to plants on solid medium. Microblending of the anthers was found to be more reproducible than pestle maceration, and the yield of large microspores was 100% higher using this method. With the microblending technique a mean of 9.4 green plants and 0.4 albino plants were regenerated per plated anther while a mean of only 2.8 green and 0.17 albino plants per anther were regenerated from microspores isolated after pestle maceration of the anthers. Microspores isolated from mass cultures were also cultured as single cells in microdroplets, and it was shown that microspores isolated from 3-5 days old mass cultures could develop into plants although at a low frequency (0.3%). Finally, the potential of using microinjection for transforming embryogenic microspores has been evaluated.


Subject(s)
Hordeum/physiology , Cells, Cultured , Hordeum/growth & development , Seeds/physiology , Spores/physiology
20.
APMIS ; 99(1): 65-8, 1991 Jan.
Article in English | MEDLINE | ID: mdl-1993116

ABSTRACT

The agarose migration technique was used for demonstration of delayed-type hypersensitivity to arterial vessel wall antigens in patients suffering from chronic essential hypertension. By means of this technique, it was demonstrated that the migration indices from the hypertensive patients differed significantly from the normotensive control persons, P less than 0.005. The significant difference was abolished when anti-LIF was added to the migration tests. This means that a hypersensitivity of the delayed type had developed in the hypertensive patients and the results indicated that the hypersensitivity was an autoimmunity to arterial vessel wall antigens.


Subject(s)
Hypersensitivity, Delayed , Hypertension/immunology , Adult , Animals , Cell Migration Inhibition , Female , Humans , Leukocyte Migration-Inhibitory Factors/immunology , Male , Middle Aged , Rabbits
SELECTION OF CITATIONS
SEARCH DETAIL