Regeneration of Fertile Barley Plants from Mechanically Isolated Protoplasts of the Fertilized Egg Cell.

A simple procedure is described for the mechanical isolation of protoplasts of unfertilized and fertilized barley egg cells from dissected ovules. Viable protoplasts were isolated from ~75% of the dissected ovules. Unfertilized protoplasts did not divide, whereas almost all fertilized protoplasts developed into microcalli. These degenerated when grown in medium only. When cocultivated with barley microspores undergoing microspore embryogenesis, the protoplasts of the fertilized egg cells developed into embryo-like structures that gave rise to fully fertile plants. On average, 75% of cocultivated protoplasts of fertilized egg cells developed into embryo-like structures. Fully fertile plants were regenerated from ~50% of the embryo-like structures. The isolation-regeneration techniques may be largely genotype independent, because similar frequencies were obtained in two different barley varieties with very different performance in anther and microspore culture. Protoplasts of unfertilized and fertilized eggs of wheat were isolated by the same procedure, and a fully fertile wheat plant was regenerated by cocultivation with barley microspores.

Structure and expression of the barley lipid transfer protein gene Ltp1.

We have characterized a gene (Ltp1) encoding a barley lipid transfer protein. Northern blot analysis showed that Ltp1 mRNA accumulates specifically in the aleurone layer of developing and germinating seeds. Southern blot analysis indicated that LTP1 protein is encoded by a single gene in barley. Sequence analysis of Ltp1 showed that it contains an open reading frame of 351 bp interrupted by a single intron of 133 bp. Transient expression assays indicated that 702 bp of the 5' upstream region of Ltp1 is sufficient to direct aleurone-specific expression during late seed development and early germination.

C-terminal processing of barley alpha-amylase 1 in malt, aleurone protoplasts, and yeast.

C-terminal processing of low pI barley alpha-amylase (AMY1) results in multiple forms in malt, aleurone protoplasts, and transformed yeast. Expression of an AMY1 cDNA in yeast thus leads to four secreted forms with distinct pI values between 4.7 and 5.1 and essentially identical Mr. AMY1-1 and AMY1-2 lacking the C-terminal Arg-Ser are generated by carboxypeptidase in vitro from AMY1-3 and AMY1-4, respectively. In vivo processing is due to the KEX1-encoded yeast carboxypeptidase. AMY1-2 and AMY1-4 are fully active, whereas AMY+-1 and AMY1-3 retain 3-4% activity toward p-nitrophenyl maltoheptaoside and have one fewer SH group, due to reaction with glutathione. AMY1-1-AMY1-4 are indistinguishable from malt AMY1 with respect to Ca(2+)-, substrate-, and beta-cyclodextrin-binding as well as recognition by three monoclonal antibodies and limited proteolysis by proteinase K. Transient AMY1 precursors present in barley aleurone protoplasts were trapped by addition of serine carboxypeptidase inhibitors, indicating that endogenous carboxypeptidase participates in the maturation of AMY1 during germination. Three pairs of precursor/mature AMY1 forms are recognized, presumably corresponding to the three genes encoding AMY1. Malt carboxypeptidase II can convert in vitro the precursors isolated from protoplasts into processed enzyme, and AMY1 from malt accordingly lacks the C-terminal heptapeptide. This report thus demonstrates posttranslational protein modification by carboxypeptidase in higher plants.

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

Isolation and cultivation of embryogenic microspores from barley (Hordeum vulgare L.).

Two different techniques for mechanical isolation of microspores from the barley cultivar 'Igri' have been evaluated. The anthers were subjected to mannitol pretreatment prior to microspore isolation, which was performed either by maceration with a pestle or by blending of the excised anthers. The microspores were purified by centrifugation and washing and cultured in liquid medium on a membrane support. In the following four weeks the microspores developed into embryoids, which were subsequently regenerated to plants on solid medium. Microblending of the anthers was found to be more reproducible than pestle maceration, and the yield of large microspores was 100% higher using this method. With the microblending technique a mean of 9.4 green plants and 0.4 albino plants were regenerated per plated anther while a mean of only 2.8 green and 0.17 albino plants per anther were regenerated from microspores isolated after pestle maceration of the anthers. Microspores isolated from mass cultures were also cultured as single cells in microdroplets, and it was shown that microspores isolated from 3-5 days old mass cultures could develop into plants although at a low frequency (0.3%). Finally, the potential of using microinjection for transforming embryogenic microspores has been evaluated.