miR156- and miR171-binding sites in the protein-coding sequences of several plant genes.

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a-j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a-d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a-c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a-c families should be in one family.

Plant respiratory burst oxidase homologs impinge on wound responsiveness and development in Lycopersicon esculentum.

Plant respiratory burst oxidase homologs (Rboh) are homologs of the human neutrophil pathogen-related gp91(phox). Antisense technology was employed to ascertain the biological function of Lycopersicon esculentum (tomato) Rboh. Lines with diminished Rboh activity showed a reduced level of reactive oxygen species (ROS) in the leaf, implying a role for Rboh in establishing the cellular redox milieu. Surprisingly, the antisense plants acquired a highly branched phenotype, switched from indeterminate to determinate growth habit, and had fasciated reproductive organs. Wound-induced systemic expression of proteinase inhibitor II was compromised in the antisense lines, indicating that ROS intermediates supplied by Rboh are required for this wound response. Extending these observations by transcriptome analysis revealed ectopic leaf expression of homeotic MADS box genes that are normally expressed only in reproductive organs. In addition, both Rboh-dependent and -independent wound-induced gene induction was detected as well as transcript changes related to redox maintenance. The results provide novel insights into how the steady state cellular level of ROS is controlled and portrays the role of Rboh as a signal transducer of stress and developmental responses.