ABSTRACT
BACKGROUND: In patients with cutaneous melanoma, sentinel lymph node biopsy (SLNB) serves as an important technique to asses disease stage and to guide adjuvant systemic therapy. A model using clinicopathologic and gene expression variables (CP-GEP; Merlin Assay) has recently been introduced to identify patients that may safely forgo SLNB. Herein we present data from an independent validation cohort of the CP-GEP model in Swedish patients. METHODS: Archival histological material (primary melanoma tissue) from a prospectively collected cohort of 421 consecutive patients with pT1-T4 melanoma undergoing SLNB between 2006 and 2014 was analyzed using the CP-GEP model. CP-GEP combines Breslow thickness and patient age with the expression levels of eight genes from the primary melanoma. Stratification is based on their risk for nodal metastasis: CP-GEP Low Risk or CP-GEP High Risk. RESULTS: The SLNB positivity rate was 13%. Of 421 primary melanomas, the CP-GEP model identified 86 patients as having a low risk for nodal metastasis. In patients with pT1-2 melanomas, the SLNB reduction rate was 35.4% (95% CI: 29.4-41.8) with a negative predictive value (NPV) of 96.5% (95% CI: 90.0-99.3). Among patients with pT1-3 melanomas, CP-GEP suggested a SLNB reduction rate of 24.0% (95% CI: 19.7-28.8) and a NPV of 96.5% (95% CI: 90.1-99.3). Only one of 118 pT3 tumors was classified as CP-GEP Low Risk, and all pT4 tumors were classified as being high risk for nodal metastasis. CONCLUSION: This study demonstrates that CP-GEP can identify patients with a low risk for nodal metastasis. Patients with pT1-2 melanomas have the highest clinical benefit from using the test, where 35% of the patients could forgo a SLNB procedure.
Subject(s)
Melanoma/genetics , Sentinel Lymph Node Biopsy , Sentinel Lymph Node/pathology , Skin Neoplasms/genetics , Transcriptome , Aged , Chemotherapy, Adjuvant , Cohort Studies , Female , Humans , Lymphatic Metastasis/genetics , Male , Melanoma/pathology , Melanoma/surgery , Middle Aged , Predictive Value of Tests , Reproducibility of Results , Skin Neoplasms/pathology , Skin Neoplasms/surgeryABSTRACT
Canine atopic dermatitis is an inflammatory, genetic, pruritic and chronic dermatosis that affects between 10 and 30% of dogs and one of the most important allergens is grass pollen. The objective of this study was to evaluate the sensitization to grass pollen allergens in dogs with canine atopic dermatitis and to compare intradermal skin test (IDT) with percutaneous test (PT). For this study, ten healthy dogs and 39 dogs with atopic dermatitis were tested. Dogs were submitted to IDT and PT for Lolium multiflorum, Cynodon dactylon and Paspalum notatum. The IDT and PT tests were compared using the Proportion Test. All healthy dogs were negative to both tests. Ten atopic dogs (25.6%) responded positively to the PT and none were positive in IDT. C. dactylon, L. multiflorum and P. notatum were responsible for positive reactions in 70%, 70% and 30% of positive dogs, respectively. The number of positive reactions in PT were statistically higher than IDT (P<0.05). In conclusion, grass pollen can be important source of allergens for dogs in Paraná state (Brazil) and the PT showed higher sensitization to grass pollen in dogs with atopic dermatitis than IDT.(AU)
A dermatite atópica canina é uma dermatose inflamatória, genética, prurítica e crônica que afeta entre 10% e 30% dos cães, e um dos alérgenos mais importantes são os polens de gramíneas. O objetivo deste estudo é avaliar a sensibilização a alérgenos de polens de gramíneas em cães com dermatite atópica e comparar o teste intradérmico (TID) com o teste percutâneo (TP). Para o estudo, 10 cães hígidos e 39 cães com dermatite atópica foram testados. Estes foram submetidos ao TID e ao TP para Lolium multiflorum, Cynodon dactylon e Paspalum notatum. TID e TP foram comparados usando-se o teste de proporção. Todos os cães hígidos foram negativos em ambos os testes. Dez cães atópicos (25,6%) responderam positivamente ao TP e nenhum ao TID. C. dactylon, L. multiflorum e P. notatum foram responsáveis por reações positivas de 70%, 70% e 30% dos cães positivos, respectivamente. O número de reações positivas no TP foi estatisticamente maior que no TID (P<0,05). Foi concluído que os polens de gramíneas podem ser importantes fontes de alérgenos para cães no estado do Paraná (Brasil) e que o TP mostrou maior sensibilização a polens em cães com dermatite atópica que o TID.(AU)
Subject(s)
Animals , Dogs , Pollen/adverse effects , Allergens/analysis , Dermatitis, Atopic/veterinary , Lolium , Skin Tests/veterinary , Cynodon , Paspalum , Poaceae/adverse effectsABSTRACT
We isolated and compared three tomato spotted wilt virus (TSWV) isolates from lettuce (TSWV-Let), pepper (TSWV-Pep), and tomato (TSWV-Tom) from central Mexico to determine their ability to infect a set of eighteen differential plant species from seven families. TWSV-Let was an aggressive isolate with the ability to infect up to 52% of the differential plants, including maize, under greenhouse conditions. The nucleotide (nt) sequences of the three isolates are more than 90% similar in the M and S RNA segments. In the M segment of the TSWV-Let isolate, we detected nt changes in their intergenic region (IGR) and, in the Gc gene, a region containing a recombination site, as well as a synapomorphy associated with one of three sites under positive selection with a change in one aa residue (a cysteine-to-valine mutation). We speculate on the association of these features in the Gc gene with host selection, adaptation, aggressiveness, and ability to infect maize plants.
Subject(s)
Phylogeny , Plant Diseases/virology , Solanum lycopersicum/virology , Tospovirus/genetics , Genome, Viral/genetics , Solanum lycopersicum/genetics , Plant Diseases/genetics , RNA, Viral/genetics , Recombination, Genetic , Tospovirus/classification , Tospovirus/pathogenicityABSTRACT
A female adult dog, with a four-month history of pain and intense pruritus, which eventually resulted in sudden death, was referred for necropsy. Postmortem examination showed thoracic and abdominal serum-sanguineous exudates, multifocal infiltrative renal masses, and similar tumors in the heart. Histopathology revealed midsize infiltrative neoplastic proliferation composed of round cells, sparse cytoplasm, and large hyperchromatic nuclei. Immunohistochemistry revealed CD3+ and CD20-immunoexpression. Histopathological and immunohistochemical findings confirmed the diagnosis of epitheliotropic lymphoma with cardiac and renal metastasis.(AU)
Foi encaminhado para necropsia um cão adulto do sexo feminino, com histórico de dor e prurido intenso com evolução de quatro meses, que acabou resultando em morte súbita. O exame post mortem mostrou presença discreta de exsudato serossanguinolento em cavidades torácica e abdominal, massas renais infiltrativas multifocais e tumores semelhantes no coração. O exame histopatológico revelou proliferação neoplásica infiltrativa composta de células redondas, com citoplasma escasso, e grandes núcleos hipercromáticos. A análise imuno-histoquímica mostrou imunoexpressão CD3+e CD20. Os achados histopatológicos e imuno-histoquímico confirmaram o diagnóstico de linfoma epiteliotrópico com metástase cardíaca e renal.(AU)
Subject(s)
Animals , Female , Dogs , Heart Neoplasms/veterinary , Kidney Neoplasms/veterinary , Mycosis Fungoides/veterinary , Neoplasm Metastasis/diagnosis , Sezary Syndrome/veterinary , Autopsy/veterinary , Immunohistochemistry/veterinary , Lymphoma, T-Cell, Cutaneous/veterinaryABSTRACT
BACKGROUND: Sleep disorders in schoolchildren are a common problem worldwide, and when are not adequately diagnosed and treated, their negative impact on daytime functioning may be significant. The aim of this study was to evaluate the psychometric properties of the Spanish version of the Children's Sleep Habits Questionnaire (CSHQ). METHODS: Participants were 286 school-aged children from a community-based sample, aged 4 to 7 years. The sleep behaviour was evaluated using the CSHQ and actigraphy (ActiSleep monitor). The CSHQ was adapted to the Spanish language. The internal consistency of the questionnaire and the test-retest reliability between scores at baseline and three-weeks-later were estimated. Associations between CSHQ items and accelerometer sleep quality indicators were used as indicators of concurrent validity. RESULTS: Cronbach's alpha coefficients for the subscales ranged from 0.60 to 0.81, and 0.81 for the full scale; the intraclass correlation coefficients ranged from 0.56 to 0.81. A moderate correlation was observed in sleep latency and awakenings measurements using both parents' reported sleep habits (CSHQ-SP) and sleep quality indicators (ActiSleep). CONCLUSIONS: The CSHQ-SP has demonstrated adequate psychometric properties, and it serves as a useful instrument for clinical and research setting.
Subject(s)
Sleep Hygiene , Sleep Initiation and Maintenance Disorders/diagnosis , Actigraphy/methods , Child , Child Behavior , Child, Preschool , Female , Humans , Male , Psychometrics , Reproducibility of Results , Spain , Surveys and QuestionnairesABSTRACT
OBJECTIVE: Arterial stiffness is a contributor to the development of atherosclerosis and cardiovascular disease. The aim of the study was to analyse the relationship between sedentary behaviour and arterial stiffness in a Spanish adult population. METHODS: This cross-sectional study included 1365 subjects belonging to the EVIDENT project. Physical activity and sedentary behaviour were measured objectively over 7 days using ActiGraph accelerometers. Thresholds of 10 consecutive minutes were used to estimate the daily sedentary time in bouts ≥10 min. Each interruption in sedentary time (counts/min ≥100) was considered a break. Arterial stiffness was evaluated using the B-pro device through the following indicators: radial Augmentation Index (rAIx), Ambulatory Arterial Stiffness Index (AASI), and central and peripheral pulse pressure (PP). RESULTS: We found a positive relationship between central and peripheral pulse pressure (office, 24 h, awake and sleep PP) and total sedentary time. These arterial stiffness parameters were also associated with sedentary time in bouts ≥10 min. Significance disappeared in both cases, however, after adjusting for MVPA and breaks per sedentary hour. Adults who reported fewer breaks per sedentary hour (25th percentile < 2 n/day) had higher levels of AASI, awake and sleep PP. CONCLUSIONS: In a medium-sized sample of adult attenders of community clinics our data showed that it seems to be important to avoid prolonged uninterrupted periods of sedentary time.
Subject(s)
Cardiovascular Diseases/physiopathology , Sedentary Behavior , Vascular Stiffness , Actigraphy/instrumentation , Adult , Aged , Aged, 80 and over , Blood Pressure , Blood Pressure Monitoring, Ambulatory , Cardiovascular Diseases/diagnosis , Cardiovascular Diseases/epidemiology , Cross-Sectional Studies , Female , Humans , Male , Middle Aged , Motor Activity , Risk Assessment , Risk Factors , Spain/epidemiology , Time Factors , Young AdultABSTRACT
Background: Brown tumors of bones are an uncommon manifestation of hyperparathyroidism. Case report: We report a 35 years old male presenting with pain and paresis of the left superior limb. Part of his humerus was excised due to a diagnosis of a giant cell tumor. He was admitted again to the hospital due to pelvic pain, malaise and constipation. A right cervical nodule was found. Laboratory evaluation confirmed the presence of a hyperparathyroidism. The biopsy of the pelvic lesion disclosed a brown tumor. The patient was subjected to a parathyroidectomy and the pathological study of the surgical piece showed a right parathyroid adenoma and a right thyroid papillary micro carcinoma. In the postoperative period the patient had a hungry bone syndrome, which was adequately treated.
Introducción: La paratohormona es una hormona encargada de la homeostasis del calcio, el hiperparatiroidismo es una patología con manifestaciones renales y óseas, el Tumor Pardo es una rara presentación de esta enfermedad. Caso clínico: Hombre de 35 años con dolor y paresia en extremidad superior izquierda, fue resecado parte del húmero por un diagnóstico de Tumor de Células Gigantes; reingresa con dolor pélvico derecho, malestar general, astenia y estreñimiento. Se descubre un nódulo cervical derecho e hipersensibilidad en la pelvis derecha. Los exámenes de laboratorio muestran hiperparatiroidismo; la biopsia de la lesión pélvica es diagnóstica de Tumor Pardo, encontrándose además una hipercaptación paratiroidea derecha. Operado, el diagnóstico histopatológico fue: Adenoma paratiroideo derecho y un micro carcinoma papilar tiroideo; en el post-operatorio desarrolló un Síndrome de Bone Hunger, el cual fue superado y dado de alta. Discusión y conclusiones: El Tumor Pardo no es una verdadera neoplasia; producido por intensa actividad osteoclástica, tiene características histológicas y radiológicas inespecíficas y su diagnóstico se realiza por datos clínicos y bioquímicos. El hiperparatiroidismo puede llevar a la formación de Tumores Pardos; se sugiere realizar estudios de la glándula tiroides en pacientes con hiperparatiroidismo.
Subject(s)
Humans , Male , Adult , Carcinoma, Papillary/surgery , Carcinoma, Papillary/complications , Thyroid Neoplasms/surgery , Thyroid Neoplasms/complications , Parathyroid Neoplasms/surgery , Parathyroid Neoplasms/complications , Hypercalcemia , Hyperparathyroidism, Primary/complications , Pelvis/pathologyABSTRACT
BACKGROUND: The development of safe, effective, and affordable vaccines has become a global effort due to its vast impact on overall world health conditions. A brief overview of vaccine characterization techniques, especially in the area of high-resolution mass spectrometry, is presented. It is highly conceivable that the proper use of advanced technologies such as high-resolution mass spectrometry, along with the appropriate chemical and physical property evaluations, will yield tremendous in-depth scientific understanding for the characterization of vaccines in various stages of vaccine development. This work presents the physicochemical and biological characterization of cancer vaccine Racotumomab/alumina, a murine anti-idiotypic antibody that mimics N-glycolyl-GM3 gangliosides. This antibody has been tested as an anti-idiotypic cancer vaccine, adjuvated in Al(OH)3, in several clinical trials for melanoma, breast, and lung cancer. METHODS: Racotumomab was obtained from ascites fluid, transferred to fermentation in stirred tank at 10 L and followed to a scale up to 41 L. The mass spectrometry was used for the determination of intact molecule, light and heavy chains masses; amino acids sequence analysis, N- and C-terminal, glycosylation and posttranslational modifications. Also we used the DLS for the size distribution and zeta potential analysis. The biological analyses were performed in mice and chickens. RESULTS: We observed differences in glycosylation pattern, charge heterogeneity and structural stability between in vivo-produced and bioreactor-obtained Racotumomab products. Interestingly, these modifications had no significant impact on the immune responses elicited in two different animal models. CONCLUSIONS: We are demonstrated that this approach could potentially be more efficient and effective for supporting vaccine research and development.
Subject(s)
Antibodies, Anti-Idiotypic/chemistry , Antibodies, Monoclonal/chemistry , Cancer Vaccines/chemistry , Animals , Antibodies, Monoclonal, Murine-Derived , Bioreactors , Chickens , Chromatography, High Pressure Liquid , Fermentation , Glycosylation , Mass Spectrometry , Mice , Oxidation-Reduction , Particle Size , Peptide Mapping , Protein Processing, Post-Translational , Technology, Pharmaceutical/methods , Vaccine PotencyABSTRACT
Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavric et al. Plant Dis. 85:12, 2001.
ABSTRACT
In this paper, we propose the use of a reflective spatial light modulator (RSLM) controlled by a PC, instead of a metal plate with holes, to produce the interference patterns in Chalmers interferometric test. The main advantage of the proposed method is that with an RSLM, it is possible to test and obtain an interference pattern for any zone of a surface or lens by opening two appropriate apertures. This increases the accuracy of the results and reduces the time required to obtain them.
Subject(s)
Interferometry/instrumentation , Interferometry/methods , Lighting/instrumentation , Lighting/methods , Equipment Design , Equipment Failure AnalysisABSTRACT
Antecedentes y objetivos. La prehipertensión es una nueva categoría de presión arterial, y se considera un factor de riesgo vascular. Hemos estimado la prevalencia de prehipertensión y la asociación entre esta condición y otros factores de riesgo vascular en adultos jóvenes. Sujetos y métodos. Invitamos a participar a los universitarios del primer curso de todas las titulaciones que se imparten en el Campus Universitario de Cuenca. Se consideró prehipertensión a una presión arterial sistólica de 120-139mmHg y/o presión arterial diastólica de 80-89mmHg. Se midieron las variables antropométricas, lipídicas y metabólicas. Se valoró la presencia del síndrome metabólico, y se cuantificó en función de la suma de las puntuaciones estandarizadas del perímetro de cintura, la razón triglicéridos/c-HDL, presión arterial media y R-HOMA (índice de resistencia a la acción hipoglucemiante de la insulina). Resultados. Se incluyeron en el análisis 545 universitarios (edad media [±DE] 20,4±3,9 años; 74,7% mujeres). La prevalencia global de prehipertensión fue del 24% (IC del 95%: 21-27%), (varones: 56,5%; mujeres: 13,0%). La condición de prehipertensión se asoció de forma directa al índice de masa corporal (OR: 1,194; IC del 95%: 1,124-1,311), resistencia al efecto hipoglucemiante de la insulina (R-HOMA, OR: 2,638; IC del 95%: 1,263-4,926) y al índice o cuantificación de la severidad del síndrome metabólico (OR: 4,868; IC del 95%: 3,846-8,328). Por el contrario, la prehipertensión se asoció de forma inversa con la concentración de c-HDL (OR: 0,981; IC del 95%: 0,957-0,993). Conclusiones. Uno de cada 4 adultos jóvenes presenta prehipertensión. Esta condición se asocia a los factores de riesgo vasculares bien establecidos(AU)
Background and objectives. Prehypertension is a new category of blood pressure and is considered a cardiovascular risk factor. This study has aimed to estimate the prevalence of prehypertension and the association between prehypertension and other vascular risk factors in young adults. Material and methods. First year university students from all areas of study in the University of Cuenca were invited to participate. Prehypertension was defined as systolic blood pressure between 120-139mmHg and/or diastolic blood pressure between 80-89mmHg. Anthropometric, lipid and metabolic variables were measures. The presence of metabolic syndrome was evaluated and quantified based on the sum of the standardized scores of the waist circumference, the triglyceride/c-HDL ratio, mean blood pressure and R-HOMA (Index of insulin resistance to glucose lowering effect). Results. A total of 545 university students were included in the analysis (mean age 20.36±3.9 years, 74.7% women). Prehypertension prevalence was 24% (95% CI: 21-27%), (56.5% in men and 13% in women). The condition of prehypertension was directly associated to the body mass index (OR:1.194; 95% CI:1.124-1.311), insulin resistance (R-HOMA, OR:2.638; 95% CI:1.263-4.926) and to the index or quantification of the severity of the metabolic syndrome (OR:4-868; 95% CI:3-846-8-328). On the other hand, HDL-c showed an inverse relationship with prehypertension (OR:0.981; 95% CI:0.957-0.993). Conclusions. One out of every four young adults presents prehypertension. This condition is associated to well-established vascular risk factors(AU)
Subject(s)
Humans , Male , Female , Young Adult , Hypertension/epidemiology , Hypertension/prevention & control , Risk Factors , Arterial Pressure/physiology , Anthropometry/methods , Metabolic Syndrome/epidemiology , Metabolic Syndrome/prevention & control , Body Weights and Measures/trends , Body Weights and Measures , Body Mass Index , Cross-Sectional Studies/methods , Cross-Sectional Studies/trends , Informed Consent/standards , Logistic ModelsABSTRACT
BACKGROUND AND OBJECTIVES: Prehypertension is a new category of blood pressure and is considered a cardiovascular risk factor. This study has aimed to estimate the prevalence of prehypertension and the association between prehypertension and other vascular risk factors in young adults. MATERIAL AND METHODS: First year university students from all areas of study in the University of Cuenca were invited to participate. Prehypertension was defined as systolic blood pressure between 120-139 mmHg and/or diastolic blood pressure between 80-89 mmHg. Anthropometric, lipid and metabolic variables were measures. The presence of metabolic syndrome was evaluated and quantified based on the sum of the standardized scores of the waist circumference, the triglyceride/c-HDL ratio, mean blood pressure and R-HOMA (Index of insulin resistance to glucose lowering effect). RESULTS: A total of 545 university students were included in the analysis (mean age 20.36±3.9 years, 74.7% women). Prehypertension prevalence was 24% (95% CI: 21-27%), (56.5% in men and 13% in women). The condition of prehypertension was directly associated to the body mass index (OR: 1.194; 95% CI: 1.124-1.311), insulin resistance (R-HOMA, OR: 2.638; 95% CI: 1.263-4.926) and to the index or quantification of the severity of the metabolic syndrome (OR: 4-868; 95% CI: 3-846-8-328). On the other hand, HDL-c showed an inverse relationship with prehypertension (OR: 0.981; 95% CI: 0.957-0.993). CONCLUSIONS: One out of every four young adults presents prehypertension. This condition is associated to well-established vascular risk factors.
Subject(s)
Prehypertension/epidemiology , Cross-Sectional Studies , Female , Humans , Male , Prevalence , Risk Factors , Young AdultABSTRACT
It has been hypothesized that zinc (Zn) levels beyond those that are nutritionally required may favor the utilization of dietary lysine, and consequently reduce the level of its inclusion into the diet. Therefore, the possible effects of interaction between chelated Zn and the level of lysine (Lys) on egg production and egg quality of laying hens were evaluated. In total, 720 ISA Brown layer hens aged 24 to 36 wk (early phase) and 48 to 60 wk (late phase) were allotted in a completely randomized factorial design that used 3 Zn and 5 Lys levels (6 replications, 8 birds/replication). All birds aged 37 to 47 wk (between early and late phases) were fed a standard diet and maintained under the same experimental design. The Zn levels used were 137, 309, and 655 mg/kg; and the Lys levels were 0.560, 0.612, 0.677, 0.749, and 0.851%. The optimal levels of Lys digestibility were based on laboratory analyses with regard to the weighted average relationship between 83.5% digestibility and the total Lys from principal ingredients. There was no effect of interaction found between the dietary levels of Zn and Lys for most of the variables studied; however, each had an independent effect on the variables. An increase in Zn from 137 to 655 mg/kg had no significant effect (P > 0.05) on the performance of hens in both phases; however, it showed a significant effect on egg quality (P < 0.01), principally on mineral composition. Increased Zn resulted in decreased shell weight, percentage of ash, yolk ash deposition, and total ash deposition. On the other hand, an increase in Lys from 0.560 to 0.851% significantly affected (P < 0.002) several performance parameters and the chemical composition of the eggs, including feed intake, feed conversion efficiency, BW gain, egg weight, and production. In conclusion, there was no interaction found between Zn and Lys, but higher dietary levels of chelated Zn reduced bird performance and egg quality parameters, whereas higher Lys levels could be beneficial to bird performance and egg quality.
Subject(s)
Animal Feed/analysis , Chickens , Diet/veterinary , Dietary Supplements , Lysine/pharmacology , Zinc/pharmacology , Animals , Eggs/standards , Female , Oviposition/drug effects , Zinc/chemistryABSTRACT
PURPOSE: To explore the response and toxicity of advanced non-metastatic squamous cell carcinomas of upper aerodigestive tract (SCC-UADT) to a combination of cetuximab concomitant with gemcitabine and radiotherapy. METHODS: We managed patients with concomitant treatment of cetuximab (400 mg/m(2) as uploading dose, then 250 mg/m(2), IV) concomitant with gemcitabine (50 mg/m(2)) weekly for seven courses, and radiotherapy in classical fractionation until completion of 70 Gy. Primary endpoints were complete response (CR) to treatment and toxicity. We evaluated patients for toxicity on a weekly basis; evaluation of response included physical examination, endoscopy, computed tomography (CT) scan and biopsy when indicated, and was performed 6 weeks after completion of radiotherapy. Additional evaluations were done every 3 months to document disease status. Between November 2004 and November 2005, 20 patients were included. RESULTS: CR was 82.4%, overall response was 100%. Neck disease reached CR in 61.5% and partial in 38.5% of patients. The main toxicities were nausea, lymphopenia, neutropenia and mucositis. Grade 3 and 4 side effects were presented in 70.6% of patients, but mucositis, and lymphopenia without clinical repercussions, occurred in 88.2% of patients. Gastrostomy was required in 11.8% of patients to maintain nutrition. Radioepithelitis developed in 76.5%, but only three of these (23.1%) were grade III. Median overall survival was 53 months (range 6-55 months) and median progression-free survival has not yet been reached at the time of evaluation. CONCLUSIONS: Although toxicity is important, this approach has interesting activity and deserves further investigation (AU)
Subject(s)
Humans , Male , Female , Middle Aged , Antibodies, Monoclonal, Humanized/administration & dosage , Antibodies, Monoclonal/administration & dosage , Antineoplastic Combined Chemotherapy Protocols/therapeutic use , Carcinoma, Squamous Cell/drug therapy , Carcinoma, Squamous Cell/radiotherapy , Head and Neck Neoplasms/drug therapy , Head and Neck Neoplasms/radiotherapy , Antibodies, Monoclonal/adverse effects , Antineoplastic Combined Chemotherapy Protocols/adverse effects , Combined Modality Therapy/adverse effects , Disease Progression , Head and Neck Neoplasms/mortality , Head and Neck Neoplasms/pathology , Radiotherapy, Adjuvant/adverse effects , Treatment OutcomeABSTRACT
Objetivo. Evaluar histologicamente la biocompatibilidad y propiedad óseoconductora del compuesto de hidroxiapatita - lignina implantado en tibias de conejos. Material y métodos. Se utilizaron 20 conejos de raza nueva Zelanda, en cada uno, la tibia izquierda fue tratada con el compuesto y la tibia derecha no fue tratada y sirvió como control. Con la ayuda de taladro manual y una broca se realizó un defecto óseo de aproximadamente 4 mm de diámetro en la superficie lateral proximal tibial, hasta alcanzar el canal medular. Dos comprimidos del compuesto (400 mg), se utilizaron para rellenar el defecto. El mismo procedimiento quirúrgico se realizó en el grupo control, sin la utilización del compuesto. Las evaluaciones histológicas se realizaron a los 8, 30, 60, 90 y 120 días postcirugía, para lo que fue necesaria la eutanasia de 4 animales por fecha de evaluación. Resultados. En las evaluaciones de 30, 60, 90 y 120 días se observó una formación ósea más acelerada y extensa en el grupo tratado al compararse las lecturas histológicas con el grupo control. Conclusiones. El compuesto hidroxiapatita-lignina permitió el crecimiento de tejido óseo desde los bordes hasta el centro del defecto a un ritmo de crecimiento mayor, con formación de hueso mas organizado que en el grupo control. Además se observó su integración al tejido óseo; lo que sugiere su biocompatibilidad y propiedad óseoconductora, hecho que permite recomendarlo como substituto.
Subject(s)
Rabbits , Heat Conduction , Durapatite , Lignin , RabbitsABSTRACT
Primary malignant melanoma of the esophagus is an extremely rare tumor. Less than 300 cases have been published worldwide. Although surgical excision is the best possible therapeutic option, the prognosis is poor. We report a 70 years old man, who underwent an esophagoscopy due to a 6-months history of dysphagia and upper abdominal discomfort. There was no history of previous cutaneous melanoma. A polypoid and pigmented mass (of 5 cm diameter) almost completely occluding the lumen in the lower third of the esophagus, was found. The histological diagnosis of the initial biopsy was melanoma. Transhiatal esophagectomy was performed and the esophagus was replaced by an isoperistaltic gastric tube with cervical esophageal anastomosis. The excised specimen showed a polypoid tumor with black pigmentation of 5.5 cm. The diagnosis of pathological and immunohistochemical studies was a primary esophageal malignant melanoma. The resection margins of esophagus were free of tumor. He received no postoperative adjuvant therapy and signs of recurrence were observed 3 months after the operation.
El melanoma primario maligno del esófago es extremadamente raro y menos de 300 casos han sido publicados hasta el momento. Aunque la resección quirúrgica ha sido considerada como la mejor opción, el pronóstico es muy pobre. Se presenta a un paciente de 70 años a quien se le realizó una esofagogastroscopía por disfagia y epigastralgia de 6 meses de evolución. No había antecedentes de melanoma cutáneo. El examen demostró una masa polipoidea pigmentada de 5 cm de diámetro en el tercio inferior del esófago, que la biopsia informó como melanoma maligno. Se realizó una esofagectomía transhiatal y el estómago fue reemplazado por un tubo gástrico isoperistáltico con una anastomosis esofagogástrica cervical. El estudio de la pieza operatorio demostró un tumor polipoideo de 5,5 cm, con pigmentación negra. El estudio histológico demostró que el tumor correspondía a un melanoma maligno primario del esófago. Los márgenes de resección oral y caudal estaban libres de tumor. No recibió terapia adyuvante complementaria y a los 3 meses de la intervención había signos clínicos e imagenológicos de recurrencia de la enfermedad.
Subject(s)
Humans , Male , Aged , Esophagectomy , Melanoma/surgery , Esophageal Neoplasms/surgery , Fatal Outcome , Melanoma/pathology , Esophageal Neoplasms/pathology , RecurrenceABSTRACT
This study examined the differences in quality of life (QoL) between active and sedentary schoolchildren and analyzed these differences by gender and weight status. A total of 1409 children, aged 11-13 years, from 20 schools located in 20 municipalities of the province of Cuenca were invited to participate in a cross-sectional study; 1073 children agreed (76.15% response rate), of which 536 (49.9%) were boys. QoL was measured with Child Health and Illness Profile-Child Edition (CHIP-CE), an instrument measuring children's perception of their own health using a Likert-type scale with five dimensions: satisfaction, comfort, resilience, risk avoidance, and achievement. Multivariate analysis of variance using the scores of the different CHIP-CE dimensions as dependent variables, physical activity, gender, and body mass index (BMI) category as fixed factors, and age as co-variate showed the following: (1) the scores of active children were significantly better than the scores of sedentary children for every dimension except risk avoidance; (2) there were no significant differences in QoL by BMI category; and (3) girls had better mean scores than boys for resilience, risk avoidance, and achievement, and worse scores for comfort. These results suggest that active children have a better QoL and that gender differences favoring boys diminish or even reverse to favor active girls.
Subject(s)
Exercise/psychology , Quality of Life , Adolescent , Child , Cross-Sectional Studies , Female , Humans , Male , Multivariate Analysis , SpainABSTRACT
Astrocytomas develop intense vascular proliferation, essential for tumour growth and invasiveness. Angiotensin II (ANGII) was initially described as a vasoconstrictor; recent studies have shown its participation in cellular proliferation, vascularisation, and apoptosis. We conducted a prospective study to evaluate the expression of ANGII receptors - AT1 and AT2 - and their relationship with prognosis. We studied 133 tumours from patients with diagnosis of astrocytoma who underwent surgery from 1997 to 2002. AT1 and AT2 were expressed in 52 and 44% of the tumours, respectively, when determined by both reverse transcriptase-polymerase chain reaction and immunohistochemistry. Ten per cent of low-grade astrocytomas were positive for AT1, whereas grade III and IV astrocytomas were positive in 67% (P<0.001). AT2 receptors were positive in 17% of low-grade astrocytomas and in 53% of high-grade astrocytomas (P=0.01). AT1-positive tumours showed higher cellular proliferation and vascular density. Patients with AT1-positive tumours had a lower survival rate than those with AT1-negative (P<0.001). No association to survival was found for AT2 in the multivariate analysis. Expression of AT1 and AT2 is associated with high grade of malignancy, increased cellular proliferation, and angiogenesis, and is thus related to poor prognosis. These findings suggest that ANGII receptors might be potential therapeutic targets for high-grade astrocytomas.
Subject(s)
Astrocytoma/metabolism , Brain Neoplasms/metabolism , Receptor, Angiotensin, Type 1/biosynthesis , Receptor, Angiotensin, Type 2/biosynthesis , Astrocytoma/pathology , Brain Neoplasms/pathology , Female , Humans , Male , Middle Aged , PrognosisABSTRACT
Con un diseño descriptivo longitudinal se incluyeron 120 pacientes, hombres y mujeres, ASA I-II, sin medicación preanestésica, con un esquema estandarizado para inducción y mantenimiento anestésico. Se midió la profundidad anestésica en base de los valores del Cerebral State Monitor (CSM X06) y se interrogó sobre los eventos de memoria implícita y explicita tanto de la inducción anestésica como del transanestésico en el postoperatorio inmediato y mediato. Se consideró como memoria implícita a la información en la memoria que no tiene recuerdo consciente, y como memoria explícita a la información retenida conscientemente, en el 95% de los casos (n = 114), no se reporto ningún tipo de recuerdo; el 4,24% (n = 5) reportó el recuerdo del momento de la intubación orotraqueal (IOT) como algo.
With a longitudinal descriptive design 120 patients, men and women were included, ASA I-II, without medication before the anesthesia, with an outline standardized for induction and anesthetic maintenance. The anesthetic depth was measured in base of the values of the Cerebral State Monitor (CSM X06) and it was interrogated by heart on the events implicit and explicit point of the anesthetic induction as of the surgery and the postoperative immediate and mediate. It was considered as implicit memory to the information in the memory that doesn't have conscious memory, and explicit memory to the information retained consciously, in 95% of the cases (n = 114), you doesn't report any memory type; 4,24% (n = 5) it reported the memory of the moment of the orotracheal intubation (IOT) as something unpleasant.
Subject(s)
Anesthesia , Anesthesia, General , MemoryABSTRACT
Introducción: La hepatectomía extendida, definida como la resección de 5 o más segmentos hepáticos, se ha asociado a un elevado riesgo perioperatorio. El objetivo del presente estudio es comparar los resultados quirúrgicos de pacientes sometidos a resecciones hepáticas de más de 2 segmentos versus hepatectomía extendida. Material y Método: Se analizó nuestra serie prospectiva de pacientes entre agosto 2002 y junio 2005. Se excluyeron resecciones laparoscópicas, unisegmentarias y no anatómicas. Se configuraron 2 grupos: Grupo I: Hepatectomías extendidas, Grupo II: Resecciones hepáticas de 2 a 4 segmentos. Se analizaron variables demográficas, indicaciones, uso de hemoderivados, función hepática postoperatoria, morbilidad y mortalidad. Resultados: En este período se realizaron 59 hepatectomías. Veintinueve cumplieron los criterios de inclusión. Grupo I: (n=14,) Grupo II: (n=15). Todos los pacientes del primer grupo fueron resecados por lesiones malignas (9 metástasis, 5 tumores primarios). El promedio de segmentos resecados fue 5.5 para el grupo I y 2.3 para el Grupo II. Los tiempos operatorios promedio fueron 283 y 199 minutos, respectivamente (p=0.025). Se transfundieron un promedio de 2.69 y 0.85 U GR en cada grupo (p=0.009). La estadía hospitalaria promedio fue 13.6 días para el primer grupo, y 7.35 para el segundo (p=0.004). En el Grupo I, 4 de 14 pacientes presentaron complicaciones quirúrgicas y 1 de 15 en el grupo II (p=0.1). Fallece un paciente de cada grupo, debido a insuficiencia hepática postoperatoria. Conclusiones: A pesar del gran volumen de parénquima resecado, la hepatectomía extendida es una alternativa segura para el tratamiento de lesiones hepáticas malignas.
Introduction: Extended hepatectomy has been associated with a high perioperative risk. The aim of this study is to compare the surgical results in patients who underwent a hepatic resection of more than two Couinaud's segments versus an extended hepatectomy (more than four segments). Methods: Our prospective database from August 2002 to June 2005 was reviewed. Non-anatomical, unisegmental and laparoscopic resections were excluded. There were two groups. Group I: Extended hepatectomies; Group II: Hepatic resections from 2 to 4 segments. Demographic characteristics, indications for surgery, technical aspects, use of hemocomponents, post-operative liver function, morbidity and mortality were reviewed. Results: In this period, 59 hepatectomies were performed. 29 procedures achieved the inclusion criteria. Group I: (n=14), Group II: (n=15). Hepatobiliary malignancy was the surgical indication in all cases in Group I (9 liver metastases, 5 primary liver tumors). Mean number of resected segments were 5.5 for Group 1, and 2.3 for Group II. Mean operative time was 283 and 199 minutes, respectively (p=0.025). Mean red blood cell units transfused were 2.69 and 0.85 in each group (p=0.009). Mean postop hospital stay was 13.6 days por the first group and 7.3 for the second group (p=0.004). In Group I, 4 of 14 patients developed a postoperative complication and 1 of 15 in Group II (p=0.1). Postoperative liver failure was present in two patients from Group I, one of them died. In Group II, 1 patient died secondary to liver failure. Conclussions: Extended hepatectomy is a safe procedure for hepatobiliary malignancy even when a large amount of liver parenchyma is resected.