Alfalfa vein mottling virus, a novel potyvirid infecting Medicago sativa L.

BACKGROUND: We have recently identified a novel virus detected in alfalfa seed material. The virus was tentatively named alfalfa-associated potyvirus 1, as its genomic fragments bore similarities with potyvirids. In this study, we continued investigating this novel species, expanding information on its genomic features and biological characteristics. METHODS: This research used a wide range of methodology to achieve end results: high throughput sequencing, bioinformatics tools, reverse transcription-polymerase chain reactions, differential diagnostics using indicator plants, virus purification, transmission electron microscopy, and others. RESULTS: In this study, we obtained a complete genome sequence of the virus and classified it as a tentative species in the new genus, most closely related to the members of the genus Ipomovirus in the family Potyviridae. This assumption is based on the genome sequence and structure, phylogenetic relationships, and transmission electron microscopy investigations. We also demonstrated its mechanical transmission to the indicator plant Nicotiana benthamiana and to the natural host Medicago sativa, both of which developed characteristic symptoms therefore suggesting a pathogenic nature of the disease. CONCLUSIONS: Consistent with symptomatology, the virus was renamed to alfalfa vein mottling virus. A name Alvemovirus was proposed for the new genus in the family Potyviridae, of which alfalfa vein mottling virus is a tentative member.

First report of Globisporangium uncinulatum (syn. Pythium uncinulatum) causing Pythium wilt of lettuce in Arizona.

In 2021 and 2022, wilt symptoms were observed in lettuce (Lactuca sativa L.) fields in Yuma County, Arizona (AZ). Incidence was < 1% at all locations. Symptoms included stunting, yellowing and wilting of outer leaves. As disease progressed, outer leaves wilted and turned necrotic. In advanced stages, tap roots turned brown-gray, with few feeder roots. The crown remained intact until the plant collapsed. Symptomatic romaine and iceberg plants were collected from two sites. Necrotic roots were washed and then plated on amended corn meal agar (PARP) (Kannwischer et al. 1978). After 2-3 days, slow growing, coenocytic, submerged mycelia grew from these pieces. In culture, profuse oogonia formed with diameters of 30-39 (avg. = 33.7) µm and spiny protuberances (5-8 [avg. = 6.4] µm long) with thickened bases. Oospores were spherical and aplerotic, with diameters of 25-32 (avg. = 27.8) µm. Lettuce with identical symptoms from the Salinas Valley, California (CA) were also tested and similar isolates were recovered. Pathogenicity was tested using six AZ and one CA isolates. Inoculum was grown on barley seeds moistened with sterile distilled water, autoclaved three times (at 24 h intervals), then inoculated with colonized agar plugs and incubated at 20°C. Inoculum was used after two weeks. For each isolate, 12 3-week-old iceberg (cv. Speedway) and romaine (cv. Del Sol) plants were inoculated by placing 3-4 colonized barley seed next to the roots of the potted plants. Plants were maintained in a greenhouse at 24-26°C (daytime high) with ambient light. After eight days, all inoculated plants exhibited chlorotic lower leaves that later wilted. Both feeder roots and taproots showed brown-gray discoloration and were necrotic. Microscopy showed the presence of spiny oogonia in inoculated roots. Symptoms caused by the AZ and CA isolates were indistinguishable from each other. Isolations from necrotic tissue resulted in colonies morphologically identical to the original isolates. Twelve control plants inoculated with uncolonized barley seed developed no symptoms. DNA was extracted from all seven AZ and CA isolates pre-inoculation, and AZ isolate 2 recovered from both lettuce types post-inoculation for molecular characterization. The internal transcribed spacer (ITS) and cytochrome C oxidase subunit 2 (COX II) were amplified for the above isolates using primer sets ITS1/ITS4 (White et al. 1990) and FM66/FM58 (Villa et al. 2006), then sequenced. ITS of pre- and post-inoculated isolates for AZ (OQ054806 and OQ054807) and CA (OQ564388) matched 1078/1078 bases of Globisporangium uncinulatum (syn. Pythium uncinulatum; AY598712.2) with 99.8% identity. There were two SNPs in COX II for AZ isolate 1 (OR069239); all other isolates pre- and post- inoculation for AZ (OR069240 and OR069242) and CA (OR069241) uniformly matched 533/535 bases of G. uncinulatum (KJ595385.1) with 99.4% identity. Based on these molecular and morphological data, the isolates were identified as G. uncinulatum (Blok and Van Der Plaats-Niterink 1978; Van Der Plaats-Niterink 1981). To our knowledge, this is the first report of G. uncinulatum on lettuce in AZ. Designated as Pythium wilt, this disease is reported on lettuce in The Netherlands (Blok and Van Der Plaats-Niterink 1978), Japan (Matsuura, et al. 2010), and CA (Davis, et al. 1995). Arizona is an important lettuce growing region; if this disease becomes more prevalent, lettuce production in this region could be negatively impacted.

First Report of Tomato Spotted Wilt Virus infecting Lettuce in Yuma, Arizona.

Tomato spotted wilt virus (TSWV, family Tospoviridae, genus Orthotospovirus) is a thrips-vectored pathogen that infects lettuce (Lactuca sativa) and many vegetable crops (Kuo et al. 2014, Hasegawa et al. 2022). Another thrips-borne pathogen of lettuce, impatiens necrotic spot virus (INSV, Tospoviridae, Orthotospovirus), was first reported in 2021 in Yuma, Arizona (Hasegawa et al. 2022). Symptoms of both viruses in lettuce are similar and include necrotic spotting, leaf chlorosis and plant stunting (Kuo et al. 2014). Beginning February through April of 2022, lettuce displaying symptoms of orthotospovirus infection was collected from romaine lettuce (var. longifolia) fields in three regions of Yuma County. A total of 96 plants were collected (5 from Tacna on 2/21, 5 from Wellton on 2/21, 15 from Wellton on 3/23, 30 from Tacna on 4/4, 20 from Wellton on 4/4, and 21 from Yuma Valley on 4/4). The area of the fields ranged from 10 to 18 acres, and the percent disease incidence ranged from 0.8% (Tacna on 4/4) to 2.75% (Tacna on 2/21). Thrips vector were present in all fields were symptomatic plants were observed. One leaf disk per plant (8 mm in diameter) was sampled with a cork borer and grounded individually with a micro pestle in a 1.7 ml microcentrifuge tube with 150 ul of Tri-reagent (Molecular Research Center). Total RNA was extracted from each sample using the Zymo Direct-zol-96 kit (Zymo Research). Samples were diluted with water to a ratio of 1:10 after RNA extraction. RT-qPCR was performed in 20 ul reactions with 5 ul of input RNA using the PCR Biosystems qPCRBIO Probe 1-Step Go No-ROX for the cDNA/qPCR master mix. RT-qPCR assays were carried out in multiplex reactions using primers specific for TSWV and INSV, in addition to a lettuce internal control gene (LOC111918243), along with negative controls. Primer and probe sequence details are reported in supplemental Table 1. We used a cycle threshold (ct) < 40 to indicate a positive result for both INSV and TSWV (Chen et al. 2013; Boonham et al. 2002). RT-qPCR successfully amplified INSV in 90 out of 96 samples and TSWV in 8 out of 96 samples. These 8 samples tested positive for both TSWV and INSV, showing that INSV and TSWV co-infected lettuce plants. Thus overall, ∼ 95% of symptomatic plants were infected with INSV alone, and ∼ 8% were co-infected with TSWV and INSV. Amplicons of 4 samples testing positive for TSWV were sent for Sanger sequencing (Eurofins Genomics, Louisville, KY). All were identified as TSWV. One amplicon with TSWV was sequenced for INSV and double infection was confirmed. BLAST results from the NCBI nt database show 100% (138 bp) identity to TWSV (MW519211) for the 4 TWSV amplicons and 99.22% (137 bp) identity to INSV (KX790323) for the INSV amplicon. Sanger sequence data are in the GenBank (accession: OQ685940-OQ685944). Based on RT-qPCR results, all TSWV infected plants were also infected with INSV. INSV may have been introduced to Yuma by infected plants or thrips from lettuce transplants produced in California (Hasegawa et al. 2022). TSWV could have been introduced similarly. To our knowledge, this is the first report of TSWV infecting lettuce in Yuma and the first report of INSV and TSWV co-infecting lettuce. TSWV and INSV infections have remained low since their discovery in Yuma, in part due to effective cultural and chemical management by lettuce growers (Palumbo, 2022). However, an increase in disease incidence and severity in the future could have a significant negative impact on production of romaine lettuce in the region.

Pest population dynamics are related to a continental overwintering gradient.

Overwintering success is an important determinant of arthropod populations that must be considered as climate change continues to influence the spatiotemporal population dynamics of agricultural pests. Using a long-term monitoring database and biologically relevant overwintering zones, we modeled the annual and seasonal population dynamics of a common pest, Helicoverpa zea (Boddie), based on three overwintering suitability zones throughout North America using four decades of soil temperatures: the southern range (able to persist through winter), transitional zone (uncertain overwintering survivorship), and northern limits (unable to survive winter). Our model indicates H. zea population dynamics are hierarchically structured with continental-level effects that are partitioned into three geographic zones. Seasonal populations were initially detected in the southern range, where they experienced multiple large population peaks. All three zones experienced a final peak between late July (southern range) and mid-August to mid-September (transitional zone and northern limits). The southern range expanded by 3% since 1981 and is projected to increase by twofold by 2099 but the areas of other zones are expected to decrease in the future. These changes suggest larger populations may persist at higher latitudes in the future due to reduced low-temperature lethal events during winter. Because H. zea is a highly migratory pest, predicting when populations accumulate in one region can inform synchronous or lagged population development in other regions. We show the value of combining long-term datasets, remotely sensed data, and laboratory findings to inform forecasting of insect pests.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Effects of Temperatures on Immature Development and Survival of the Invasive Stink Bug (Hemiptera: Pentatomidae).

Bagrada hilaris (Burmeister) (Hemiptera: Pentatomidae) is a non-native stink bug that feeds primarily on cole crops and wild mustards. Its invasion into desert agriculture in California and Arizona presents a conundrum between rapid pest development at warm temperatures and severe damage to cool season crops. In this study, the development and survival of B. hilaris were determined at nine constant temperatures (ranging from 20-42°C) when reared on organically grown broccoli florets. Egg hatching was greatly delayed at 20°C, and first instar nymphs did not survive at this temperature. No eggs hatched at 42°C. The highest survival rates (70.0-86.7%) of B. hilaris were observed at temperatures ranging from 24 to 35°C. The total developmental rate of B. hilaris from egg to adult increased from 0.027 to 0.066/d from 24 to 35°C, and then slightly dropped to 0.064/d at 39°C. Based on the linear model, B. hilaris requires 285.4 degree-days to complete its development. The Briere 1 model predicted the lower and upper temperature thresholds as 16.7 and 42.7°C, respectively. The optimal temperature for development (TOpt) was estimated as 36°C. According to the results, B. hilaris is well adapted to warm conditions, and temperatures of 33-39°C are well suited for B. hilaris development. Information from this study helps explain the rapid range expansion of B. hilaris across the southern United States and will be instrumental in predicting future expansion across the rest of the country and in other parts of the world. The relationship between thermal thresholds and invasion dynamics of this pest are discussed.

Validation of a Landscape-Based Model for Whitefly Spread of the Cucurbit Yellow Stunting Disorder Virus to Fall Melons.

The cucurbit yellow stunting disorder virus (CYSDV) transmitted by Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) has caused significant reductions in fall melon (Cucumis melo L.) yields in Yuma County, Arizona. In a recent landscape-based study, we found evidence that cotton and spring melon fields increased abundance of B. tabaci and spread of CYSDV infection in fall melon fields. Here, we show that a statistical model derived from data collected in 2011-2012 and based on areas of cotton and spring melon fields located within 1,500 m from edges of fall melon fields was sufficient to retrospectively predict incidence of CYSDV infection in fall melon fields during 2007-2010. Nevertheless, the slope of the association between areas of spring melon fields and incidence of CYSDV infection was three times smaller in 2007-2010 than in 2011-2012, whereas the slope of the association between areas of cotton fields and incidence of CYSDV infection was consistent between study periods. Accordingly, predictions were more accurate when data on areas of cotton alone were used as a basis for prediction than when data on areas of cotton and spring melons were used. Validation of this statistical model confirms that crop isolation has potential for reducing incidence of CYSDV infection in fall melon fields in Yuma County, although isolation from cotton may provide more consistent benefits than isolation from spring melon.

Effects of foliar and systemic insecticides on whitefly transmission and incidence of Cucurbit yellow stunting disorder virus.

BACKGROUND: Cucurbit yellow stunting disorder virus (CYSDV) is a cosmopolitan viral disease transmitted by Bemisia tabaci that infects cucurbit crops. Cantaloupe production in the southwestern USA has been confronted by epidemics of CYSDV since 2006 when it was first identified in Arizona and California. As a phloem-limited virus that is vectored in a semi-persistent manner by B. tabaci, CYSDV has transmission characteristics that may be suppressed by select insecticide applications. RESULTS: Eight active ingredients formulated as foliar and/or soil-applied insecticides were tested to determine the suppressive effect on transmission and incidence of CYSDV in greenhouse and field studies. Many compounds limited virus transmission to <10% infected plants even when challenged by 30 viruliferous whiteflies. Foliar formulations had greater knockdown activity than their soil-applied analogs and resulted in lower virus transmission. Insecticides that had the greatest effect on reducing virus transmission in the greenhouse also showed the lowest incidence of CYSDV in field trials. CONCLUSIONS: Select insecticides can significantly reduce transmission of CYSDV. However, insecticide management of CYSDV incidence in cantaloupes has limitations in chronically high infestation areas such as the southwestern USA, and is often only able to delay disease onset rather than prevent its occurrence. © 2016 Society of Chemical Industry.

Biology, Ecology, and Management of an Invasive Stink Bug, Bagrada hilaris, in North America.

The painted bug, Bagrada hilaris, native to eastern and southern Africa and Asia, was detected in California in 2008, and it has spread rapidly throughout several southwestern US states. A polyphagous insect, it is particularly damaging to the billion dollar cole crop industry. B. hilaris frequently causes damage when it migrates to newly planted crops from weedy hosts. Feeding produces circular or star-shaped chlorotic lesions that become necrotic, and infested plants may be distorted. Currently, no reliable sampling methods for B. hilaris exist, nor are there effective natural enemies in the United States. Therefore, management has relied on multiple applications of insecticides and cultural practices such as removal of weedy hosts, destruction of crop residues, timing of planting, and use of transplants. Several pyrethroid and neonicotinoid insecticides are most effective for controlling the insect. Reliable sampling methods and further development of integrated pest management strategies to manage this invasive pest are urgently needed as its range continues to expand.

Extremely stretchable and conductive water-repellent coatings for low-cost ultra-flexible electronics.

Rapid advances in modern electronics place ever-accelerating demands on innovation towards more robust and versatile functional components. In the flexible electronics domain, novel material solutions often involve creative uses of common materials to reduce cost, while maintaining uncompromised performance. Here we combine a commercially available paraffin wax-polyolefin thermoplastic blend (elastomer matrix binder) with bulk-produced carbon nanofibres (charge percolation network for electron transport, and for imparting nanoscale roughness) to fabricate adherent thin-film composite electrodes. The simple wet-based process produces composite films capable of sustained ultra-high strain (500%) with resilient electrical performance (resistances of the order of 10(1)-10(2) Ω sq(-1)). The composites are also designed to be superhydrophobic for long-term corrosion protection, even maintaining extreme liquid repellency at severe strain. Comprised of inexpensive common materials applied in a single step, the present scalable approach eliminates manufacturing obstacles for commercially viable wearable electronics, flexible power storage devices and corrosion-resistant circuits.

Susceptibility of Bagrada hilaris (Hemiptera: Pentatomidae) to Insecticides in Laboratory and Greenhouse Bioassays.

Field-collected nymphs and adults of Bagrada hilaris (Burmeister) (Hemiptera: Penatatomidae) from three locations were evaluated for susceptibility to insecticides representing 10 classes of insecticide chemistry. Although relative susceptibilities differed between leaf-spray and leaf-dip Petri dish bioassays, consistently low LC50 values were determined for chlorpyrifos, bifenthrin, and lambda-cyhalothrin. Fenpropathrin and methomyl had intermediate values. Susceptibility to dinotefuran varied depending on the bioassay, possibly owing to leaf substrates used in the two bioassays. In soil systemic bioassays, the LC50 value of dinotefuran was significantly greater than that of two other neonicotinoids, imidacloprid and thiamethoxam, and the anthranilic diamide, cyantraniliprole. Mortality and feeding damage of B. hilaris and plant growth on insecticide-treated plants in greenhouse trials were consistent with the laboratory bioassays; the best results were seen with bifenthrin, methomyl, and chlorpyrifos. Mortality to the neonicotinoids was not evident; however, feeding damage and plant growth responses on dinotefuran-treated plants damage were similar to the noninfested control. This highlights the apparent antifeedant properties of dinotefuran that may have prevented adults from injuring broccoli plants after exposure to foliar spray residues. Data presented serve as baseline susceptibilities that can be used to monitor for resistance development in field populations of B. hilaris.

Diel activity and behavior of Bagrada hilaris (Hemiptera: Pentatomidae) on desert cole crops.

Patterns of diel activity and behavior of the Bagrada bug, Bagrada hilaris (Burmeister) (Hemiptera: Pentatomidae), were investigated in a series of field and greenhouse experiments in Yuma, AZ. Adults of B. hilaris were monitored by on-site direct observation on broccoli and cauliflower plants in large-block experimental plots at various intervals throughout consecutive 24-h periods. In the field trials, mean number of B. hilaris adults differed among sampling times, with peak abundance observed consistently between 1300 and 1800 hours. There was a positive correlation between temperature and numbers ofB. hilaris adults in all fields, and a negative relationship between humidity and adult numbers in 7 of 12 fields. Significant relationships between temperature and B. hilaris numbers were revealed in regression models for all trials. Slopes were not significantly different among all broccoli blocks or in three of the four cauliflower fields. In greenhouse studies, mating occurred throughout the day but peaked between 1000 and 1600 hours. Females of B. hilaris caused more feeding damage than males on the first true leaf of broccoli, and additional differences in behavior between sexes were observed. Our results suggest that higher temperatures increase field activity and influence the behavior of adult B. hilaris, and temperature is a more reliable indicator to predict the activity of B. hilaris than other environmental parameters measured. The implications of these findings for developing monitoring and management programs for B. hilaris in cruciferous crops are discussed.

Thermal phase transformations in LaGaO(3) and LaAlO(3) perovskites: an experimental and computational solid-state NMR study.

Multinuclear (71)Ga, (69)Ga, (27)Al and (17)O NMR parameters of various polymorphs of LaGaO(3) and LaAlO(3) perovskites were obtained from the combination of solid-state MAS NMR with solid-state DFT calculations. Some of the materials studied are potential candidate electrolyte materials with applications in intermediate temperature solid oxide fuel cells (ITSOFCs). Small variations in the local distortions of the subject phases are experimentally observed by (71)Ga (and (69)Ga) and (27)Al NMR in the LaGaO(3) and LaAlO(3) phases, respectively, with heating to 1400 K. The orthorhombic-to-rhombohedral phase transformation occurring in LaGaO(3) at approximately 416 K is clearly observed in the (71)Ga/(69)Ga NMR spectra and is associated with a significant increase in the quadrupolar coupling constant (QCC). Thereafter a gradual decrease in QCC is observed, consistent with increased motion of the GaO(6) octahedral units and a reduction in the degree of octahedral tilting. The experimental and theoretical (71)Ga, (69)Ga, (27)Al and (17)O NMR parameters (including isotropic and anisotropic chemical shift parameters, quadrupolar coupling constants, and associated asymmetries) of the low and high temperature polymorphs are compared. In general, the calculated values display good agreement with experimental data, although some significant deviations are identified and discussed.

Large-scale, spatially-explicit test of the refuge strategy for delaying insecticide resistance.

The refuge strategy is used worldwide to delay the evolution of pest resistance to insecticides that are either sprayed or produced by transgenic Bacillus thuringiensis (Bt) crops. This strategy is based on the idea that refuges of host plants where pests are not exposed to an insecticide promote survival of susceptible pests. Despite widespread adoption of this approach, large-scale tests of the refuge strategy have been problematic. Here we tested the refuge strategy with 8 y of data on refuges and resistance to the insecticide pyriproxyfen in 84 populations of the sweetpotato whitefly (Bemisia tabaci) from cotton fields in central Arizona. We found that spatial variation in resistance to pyriproxyfen within each year was not affected by refuges of melons or alfalfa near cotton fields. However, resistance was negatively associated with the area of cotton refuges and positively associated with the area of cotton treated with pyriproxyfen. A statistical model based on the first 4 y of data, incorporating the spatial distribution of cotton treated and not treated with pyriproxyfen, adequately predicted the spatial variation in resistance observed in the last 4 y of the study, confirming that cotton refuges delayed resistance and treated cotton fields accelerated resistance. By providing a systematic assessment of the effectiveness of refuges and the scale of their effects, the spatially explicit approach applied here could be useful for testing and improving the refuge strategy in other crop-pest systems.

Baseline susceptibilities of B- and Q-biotype Bemisia tabaci to anthranilic diamides in Arizona.

BACKGROUND: Development of pyriproxyfen and neonicotinoid resistance in the B-biotype whitefly and recent introduction of the Q biotype have the potential to threaten current whitefly management programs in Arizona. The possibility of integrating the novel anthranilic diamides chlorantraniliprole and cyantraniliprole into the current program to tackle these threats largely depends on whether these compounds have cross-resistance with pyriproxyfen and neonicotinoids in whiteflies. To address this question, the authors bioassayed a susceptible B-biotype strain, a pyriproxyfen-resistant B-biotype strain, four multiply resistant Q-biotype strains and 16 B-biotype field populations from Arizona with a systemic uptake bioassay developed in the present study. RESULTS: The magnitude of variations in LC(50) and LC(99) among the B-biotype populations or the Q-biotype strains was less than fivefold and tenfold, respectively, for both chlorantraniliprole and cyantraniliprole. The Q-biotype strains were relatively more tolerant than the B-biotype populations. No correlations were observed between the LC(50) (or LC(99)) values of the two diamides against the B- and Q-biotype populations tested and their survival rates at a discriminating dose of pyriproxyfen or imidacloprid. CONCLUSION: These results indicate the absence of cross-resistance between the two anthranilic diamides and the currently used neonicotinoids and pyriproxyfen. Future variation in susceptibility of field populations to chlorantraniliprole and cyantraniliprole could be documented according to the baseline susceptibility range of the populations tested in this study.

Influenza testing and antiviral prescribing practices among emergency department clinicians in 9 states during the 2006 to 2007 influenza season.

STUDY OBJECTIVE: Influenza causes significant widespread illness each year. Emergency department (ED) clinicians are often first-line providers to evaluate and make treatment decisions for patients presenting with influenza. We sought to better understand ED clinician testing and treatment practices in the Emerging Infections Program Network, a federal, state, and academic collaboration that conducts active surveillance for influenza-associated hospitalizations. METHODS: During 2007, a survey was administered to ED clinicians who worked in Emerging Infections Program catchment area hospitals' EDs. The survey encompassed the role of the clinician, years since completing clinical training, hospital type, influenza testing practices, and use of antiviral medications during the 2006 to 2007 influenza season. We examined factors associated with influenza testing and antiviral use. RESULTS: A total of 1,055 ED clinicians from 123 hospitals responded to the survey. A majority of respondents (85.3%; n=887) reported they had tested their patients for influenza during the 2006 to 2007 influenza season (Emerging Infections Program site range: 59.3 to 100%; P<.0001). When asked about antiviral medications, 55.7% (n=576) of respondents stated they had prescribed antiviral medications to some of their patients in 2006 to 2007 (Emerging Infections Program site range 32.9% to 80.3%; P<.0001). A positive association between influenza testing and prescribing antiviral medications was observed. Additionally, the type of hospital, location in which an ED clinician worked, and the number of years since medical training were associated with prescribing antiviral influenza medications. CONCLUSION: There is much heterogeneity in clinician-initiated influenza testing and treatment practices. Additional exploration of the role of hospital testing and treatment policies, clinicians' perception of influenza disease, and methods for educating clinicians about new recommendations is needed to better understand ED clinician testing and treatment decisions, especially in an environment of rapidly changing influenza clinical guidelines. Until influenza testing and treatment guidelines are better promulgated, clinicians may continue to test and treat influenza with inconsistency.

IPM for fresh-market lettuce production in the desert southwest: the produce paradox.

In the 'Integrated Control Concept', Stern et al. emphasized that, although insecticides are necessary for agricultural production, they should only be used as a last resort and as a complement to biological control. They argued that selective insecticide use should only be attempted after it has been determined that insect control with naturally occurring biotic agents is not capable of preventing economic damage. However, they concluded their seminal paper by emphasizing that integrated control will not work where natural enemies are inadequate or where economic thresholds are too low to rely on biological control. Thus, it is no surprise that insect control in high-value, fresh-market lettuce crops grown in the desert southwest have relied almost exclusively on insecticides to control a complex of mobile, polyphagous pests. Because lettuce and leafy greens are short-season annual crops with little or no tolerance for insect damage or contamination, biological control is generally considered unacceptable. High expectations from consumers for aesthetically appealing produce free of pesticide residues further forces vegetable growers to use chemical control tactics that are not only effective but safe. Consequently, scientists have been developing integrated pest management (IPM) programs for lettuce that are aimed at reducing the economic, occupational and dietary risks associated with chemical controls of the past. Most of these programs have drawn upon the integrated control concept and promote the importance of understanding the agroecosystem, and the need to sample for pest status and use action thresholds for cost-effective insect control. More recently, pest management programs have implemented newly developed, reduced-risk chemistries that are selectively efficacious against key pests. This paper discusses the influence that the integrated control concept, relative to zero-tolerance market standards and other constraints, has had on the adoption of pest management in desert lettuce crops.

Newer insecticides for plant virus disease management.

Effective management of insect and mite vectors of plant pathogens is of crucial importance to minimize vector-borne diseases in crops. Pesticides play an important role in managing vector populations by reducing the number of individuals that can acquire and transmit a virus, thereby potentially lowering disease incidence. Certain insecticides exhibit properties other than lethal toxicity that affect feeding behaviours or otherwise interfere with virus transmission. To evaluate the potential of various treatments against the Bemisia tabaci-transmitted Cucurbit yellow stunting disorder virus (CYSDV), insecticide field trials were conducted in Yuma, AZ, USA, during spring and autumn growing seasons. Differences in vector-intensity each season led to mixed results, but at least five insecticide treatments showed promise in limiting virus spread during spring 2008. Increasing concern among growers in this region regarding recent epidemics of CYSDV is leading to more intensive use of insecticides that threatens to erupt into unmanageable resistance. Sustainability of insecticides is an important goal of pest management and more specifically resistance management, especially for some of the most notorious vector species such as B. tabaci and Myzus persiscae that are likely to develop resistance.

Unexplained deaths in Connecticut, 2002-2003: failure to consider category a bioterrorism agents in differential diagnoses.

BACKGROUND: Recognition of bioterrorism-related infections by hospital and emergency department clinicians may be the first line of defense in a bioterrorist attack. METHODS: We identified unexplained infectious deaths consistent with the clinical presentation of anthrax, tularemia, smallpox, and botulism using Connecticut death certificates and hospital chart information. Minimum work-up criteria were established to assess the completeness of diagnostic testing. RESULTS: Of 4558 unexplained infectious deaths, 133 were consistent with anthrax (2.9%) and 6 (0.13%) with tularemia. None were consistent with smallpox or botulism. No deaths had anthrax or tularemia listed in the differential diagnosis or had disease-specific serology performed. Minimum work-up criteria were met for only 53% of cases. CONCLUSIONS: Except for anthrax, few unexplained deaths in Connecticut could possibly be the result of the bioterrorism agents studied. In 47% of deaths from illnesses that could be anthrax, the diagnosis would likely have been missed. As of 2004, Connecticut physicians were not well prepared to intentionally or incidentally diagnose initial cases of anthrax or tularemia. More effective clinician education and surveillance strategies are needed to minimize the potential to miss initial cases in a bioterrorism attack.