Oral administration of Nigella sativa oil attenuates arsenic-induced redox imbalance, DNA damage, metabolic distress, and histopathological alterations in rat intestine.

BACKGROUND: Exposure to arsenic, a widespread environmental toxin, produces multiple organ toxicity, including gastrointestinal toxicity. Nigella sativa (NS) has long been revered for its numerous health benefits under normal and pathological states. In view of this, the present study attempts to evaluate the protective efficacy of orally administered Nigella sativa oil (NSO) against arsenic-induced cytotoxic and genotoxic alterations in rat intestine and elucidate the underlying mechanism of its action. METHODS: Rats were categorized into the control, NaAs, NSO, and NaAs+NSO groups. After pre-treatment of rats in the NaAs+NSO and NSO groups daily with NSO (2 ml/kg bwt, orally) for 14 days, NSO treatment was further continued for 30 days, with and without NaAs treatment (5 mg/kg bwt, orally), respectively. Various biochemical parameters, such as enzymatic and non-enzymatic antioxidants, carbohydrate metabolic and brush border membrane marker enzyme activities were evaluated in the mucosal homogenates of all the groups. Intestinal brush border membrane vesicles (BBMV) were isolated, and the activities of membrane marker enzyme viz. ALP, GGTase, LAP, and sucrase were determined. Further, the effect on kinetic parameters viz KM (Michaelis-Menten constant) and Vmax of these enzymes was assessed. Integrity of enterocyte DNA was examined using the comet assay. Histopathology of the intestines was performed to evaluate the histoarchitectural alterations induced by chronic arsenic exposure and/or NSO supplementation. Arsenic accumulation in the intestine was studied by inductively coupled plasma-mass spectroscopy (ICP-MS). RESULTS: NaAs treatment caused substantial changes in the activities of brush border membrane (BBM), carbohydrate metabolism, and antioxidant defense enzymes in the intestinal mucosal homogenates. The isolated BBM vesicles (BBMV) also showed marked suppression in the marker enzyme activities. Severe DNA damage and mucosal arsenic accumulation were observed in rats treated with NaAs alone. In contrast, oral NSO supplementation significantly alleviated all the adverse alterations induced by NaAs treatment. Histopathological examination supported the biochemical findings. CONCLUSION: NSO, by improving the antioxidant status and energy metabolism, could significantly alter the ability of the intestine to protect against free radical-mediated arsenic toxicity in intestine. Thus, NSO may have an excellent scope in managing gastrointestinal distress in arsenic intoxication.

Thymoquinone supplementation mitigates arsenic-induced cytotoxic and genotoxic alterations in rat liver.

Arsenic, a widespread environmental toxin, produces multiple organ toxicity, including hepatotoxicity. Thymoquinone (TQ) is known to restore liver functions in several hepatic injury models. This study aims to assess the mitigative potential of TQ against sodium arsenate (NaAs)-induced cytotoxic and genotoxic alterations in the liver. Rats were randomly distributed to control, NaAs, TQ, and NaAs+TQ groups. NaAs+TQ and TQ group of rats were pre-treated with TQ (1.5 mg/kg bwt, orally) for 14 days, and the treatment was further continued for 30 days, with and without NaAs treatment (5 mg/kg bwt, orally), respectively. The deleterious histological alterations in the liver of arsenic intoxicated animals were accompanied by an upsurge in the activities of serum ALT and AST, the diagnostic indicators of liver injury. NaAs caused pronounced alterations in the activities of membrane marker and carbohydrate metabolic enzymes and the enzymatic and non-enzymatic components of hepatic antioxidant defense. Significant hepatocyte DNA damage and hepatic arsenic accumulation were also observed in arsenic-exposed rats. TQ supplementation alleviated these adverse alterations and improved the overall hepatic metabolic and antioxidant status in NaAs-administered rats. Prevention of oxidative injury could be the key mechanism of TQ-elicited protective effects. TQ may have an excellent scope as a dietary supplement in the management of arsenic-induced hepatic pathophysiology.

Oral Nigella sativa oil administration alleviates arsenic-induced redox imbalance, DNA damage, and metabolic and histological alterations in rat liver.

Arsenic, an omnipresent environmental contaminant, is regarded as a potent hepatotoxin. Nigella sativa oil (NSO) consumption has been shown to improve hepatic functions in various in vivo models of acute hepatic injury. The present study evaluates the protective efficacy of NSO against sodium arsenate (As)-induced deleterious alterations in the liver. Male Wistar rats were divided into four groups, namely, control, As, NSO, and AsNSO. After pre-treating rats in AsNSO and NSO groups with NSO (2 mL/kg bwt, orally) for 14 days, NSO treatment was further extended for 30 days, with and without As treatment (5 mg/kg bwt, orally), respectively. As induced an upsurge in serum ALT and AST activities indicating liver injury, as also confirmed by the histopathological findings. As caused significant alterations in the activities of membrane marker enzymes and carbohydrate metabolic enzymes, and in the vital components of antioxidant defense system. Marked DNA damage and hepatic arsenic accumulation were also observed in As-treated rats. Oral NSO administration ameliorated these deleterious alterations and improved overall hepatic antioxidant and metabolic status in As-treated rats. Prevention of oxidative damage could be the underlying mechanism of NSO-mediated protective effects. The results suggest that NSO could be a useful dietary supplement in the management of arsenic hepatotoxicity.

ARSACS as a Worldwide Disease: Novel SACS Mutations Identified in a Consanguineous Family from the Remote Tribal Jammu and Kashmir Region in India.

Autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS) is a rare neurodegenerative disorder characterized by the triad of early-onset cerebellar ataxia, peripheral sensorimotor neuropathy, and lower limb spasticity. Here, we present a 28-year-old male patient with symptoms of ARSACS and mild intellectual disability from a consanguineous family of tribal J&K, India. Whole exome sequencing unraveled a novel homozygous frameshift SACS mutation (Cys2869ValfsTer15) in the patient. In addition to the well-established ARSACS imaging features, MRI revealed T2 hyperintense rim around the thalami ("bithalamic stripes") demonstrating that this feature might serve as an additional supportive diagnostic imaging marker for ARSACS. Moreover, retinal nerve fiber layer thickening which has recently been proposed as a diagnostic biomarker for ARSACS was present on routine optic coherence tomography (OCT) also in this patient, indicating that it might indeed present a relatively universal diagnostic biomarker for ARSACS. In sum, our findings extend the geographical distribution of ARSACS to even very remote tribal regions in Asia (such as the Rajouri region of J&K, India) and extend the mutational and imaging spectrum of ARSACS. They provide further support that brain imaging and OCT markers might serve as diagnostic biomarkers for ARSACS in patients with novel SACS mutations, applicable even in remote regions of the world to identify and confirm ARSACS disease.

Molecular and culture based assessment of bacterial pathogens in subjects with diabetic foot ulcer.

INTRODUCTION: Expeditious and precise discerning of bacterial pathogens is a fundamental grail, of clinical diagnostic microbiology. Genotypic detection is a budding substitute to recognize phenotypic culture based processes in bacterial identification. AIMS: We report a comparative evaluation of biochemical and genomic-based assays for exploring the commonest bacterial flora of infected diabetic foot ulcers along with clinical variables of subjects enrolled. METHODS: The pathogens selected (i) Staphylococcus aureus ii) Pseudomonas aeruginosa, iii) Escherichia coli and iv) Klebsiella pneumonia, stood for the most frequent isolates of diabetic foot infection in previous studies from Northern India. Identification of these pathogens were done by conventional assays and polymerase chain reaction. RESULTS: Of 50 specimens obtained from infected DFUs, 74% of cases were affirmative by bacteriological assays and 90% showed positivity via polymerase chain reaction (PCR). Among processed samples 44 isolates were detectable through phenotypic analysis and 65 bacteria by species-specific PCR. Thirteen samples and 21 isolates could not be scrutinized by phenotypic identification systems. The most prevalent pathogens identifiable were Klebsiella pneumonia, followed by Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. CONCLUSIONS: We have shown that PCR-based diagnostic methods improved the identification compared to conventional methods and highlight the incorporation of PCR due to shorten turnaround time translating into improved clinical outcomes.

Oral thymoquinone administration ameliorates: the effect of cisplatin on brush border membrane enzymes, energy metabolism, and redox status in rat kidney.

Therapeutic use of cisplatin (CP), an effective anticancer drug, is limited by dose dependent nephrotoxicity. Thymoquinone (TQ), the major Nigella sativa seed oil constituent has been shown to prevent progression of various renal disorders. The present study investigates the protective effect of TQ on CP-induced nephrotoxicity. Rats were divided into six groups viz. control, CP, CPTQ1, CPTQ2, CPTQ3, and TQ alone group. Animals in CP and TQ combination groups were administered TQ (0.5, 1.5, and 3 mg/kg bwt, orally) with single intraperitoneal dose of CP (6 mg/kg bwt). The effect of TQ administration was determined on CP-induced alterations in various serum/urine parameters and on the enzymes of brush border membrane enzyme (BBM), carbohydrate metabolism, and antioxidant defense system in renal cortex and medulla. Oral administration of TQ in all the three doses prior to and following a single dose CP treatment caused significant recovery of serum creatinine and blood urea nitrogen levels; however, maximum recovery was seen in CPTQ2 group. TQ administration averted CP-induced decline in BBM activities, both in the cortical and medullary homogenates and in isolated BBM vesicles. TQ administration also ameliorated CP-induced impairments in renal metabolic and antioxidant status. Histopathological studies supported these biochemical findings. TQ ameliorates CP-induced oxidative damage owing to its intrinsic antioxidant properties.

Oral administration of thymoquinone mitigates the effect of cisplatin on brush border membrane enzymes, energy metabolism and antioxidant system in rat intestine.

Cisplatin (CP) is a widely used chemotherapeutic agent that elicits severe gastrointestinal toxicity. Nigella sativa, a member of family Ranunculaceae, is one of the most revered medicinal plant known for its numerous health benefits. Thymoquinone (TQ), a major bioactive component derived from the volatile oil of Nigella sativa seeds, has been shown to improve gastrointestinal functions in animal models of acute gastric/intestinal injury. In view of this, the aim of the present study was to investigate the protective effect of TQ on CP induced toxicity in rat intestine and to elucidate the mechanism underlying these effects. Rats were divided into four groups viz. control, CP, TQ and CP+TQ. Animals in CP+TQ and TQ groups were orally administered TQ (1.5mg/kg bwt) with and without a single intraperitoneal dose of CP (6mg/kg bwt) respectively. The effect of TQ was determined on CP induced alterations in the activities of brush border membrane (BBM), carbohydrate metabolism, and antioxidant defense enzymes in rat intestine. TQ administration significantly mitigated CP induced decline in the specific activities of BBM marker enzymes, both in the mucosal homogenates and in the BBM vesicles (BBMV) prepared from intestinal mucosa. Furthermore, TQ administration restored the redox and metabolic status of intestinal mucosal tissue in CP treated rats. The biochemical results were supported by histopathological findings that showed extensive damage to intestine in CP treated rats and markedly preserved intestinal histoarchitecture in CP and TQ co-treated group. The biochemical and histological data suggest a protective effect of TQ against CP-induced gastrointestinal damage. Thus, TQ may have a potential for clinical application to counteract the accompanying gastrointestinal toxicity in CP chemotherapy.

Inflammatory markers as risk factors for infection with multidrug-resistant microbes in diabetic foot subjects.

BACKGROUND: Diabetic foot ulcers (DFUs), a dreadful microvascular complication of diabetes is responsible for substantial increase in morbidity and mortality. Infection, not a cause, but a consequence in DFUs that accounts for minor or major limb loss. The current study aimed to evaluate the microbial etiology of infected diabetic foot ulcers in northern tertiary care hospital, assessment of risk factors and role of inflammatory markers involved in colonization of multidrug-resistant organisms (MDROs) and their impact on the outcome. METHODS: Pus aspirates and soft tissue samples from 65 patients with infected DFUs were collected and processed for aerobic culture analysis. Serum concentrations of IL-6 and TNF-α were determined by enzyme linked immuno-sorbent assay. RESULTS: Aerobic gram-negative isolates were more commonly present (74.7%), followed by gram-positive aerobes (25.2%). Fifty-seven percent patients were positive for MDROs. IL-6 (pg/mL) was significantly lower in diabetic patients with MDROs infected foot ulcers than without (47.0±17.2 vs. 78.3±22.1 vs. p=<0.001) and TNF-α (pg/mL) was also significantly diminished in MDROs infected subjects than without (144.2±25.8 vs. 168.7±20.9, p<0.001) respectively. CONCLUSIONS: In this study diabetic foot wounds harbored by MDROs were associated with longer duration of ulcer and increased ulcer size. Poor glycemic control was also a confounding factor in mounting MDROs infected ulcers. The declined levels WBCs and neutrophils as well as of cytokines IL-6 and TNF-alpha explains compromised immune responses of host in multi drug resistant infections.

Oral administration of Nigella sativa oil ameliorates the effect of cisplatin on brush border membrane enzymes, carbohydrate metabolism and antioxidant system in rat intestine.

Cisplatin (CP) is an effective chemotherapeutic agent that induces gastrointestinal toxicity. Nigella sativa oil (NSO) has been shown to be beneficial in a wide range of gastrointestinal disorders. The present study investigates the possible protective effect of NSO on CP-induced gastrointestinal toxicity. NSO administration (2ml/kg bwt, orally), prior to and following, a single dose CP treatment (6mg/kg bwt. ip), significantly attenuated the CP-induced decrease in brush border membrane (BBM) enzyme activities in intestinal homogenates and BBM vesicles (BBMV). NSO administration also mitigated CP induced alterations in the activities of carbohydrate metabolism enzymes and in the enzymatic and non-enzymatic antioxidant parameters in the intestine. The results suggest that NSO by empowering the endogenous antioxidant system improves intestinal redox and metabolic status and restores BBM integrity in CP treated rats. Histopathological studies supported the biochemical findings. Thus, NSO may help prevent the accompanying gastrointestinal dysfunction in CP chemotherapy.

Culture-Based Screening of Aerobic Microbiome in Diabetic Foot Subjects and Developing Non-healing Ulcers.

The study was carried on diabetic foot patients to deduce clinical attributes, the occurrence of the range of aerobic microbial flora and to assess their comparative in vitro susceptibility to the customarily used antimicrobials. We also studied the potential risk factors involved in the development of non-healing ulcers. A total of 87 organisms were isolated from 70 specimens, including Escherichia coli (19.5%) among the Gram-negative and Staphylococcus aureus (18.4%) among the Gram-positive as the predominant aerobes explored. Pseudomonas aeruginosa and E. coli were predominant isolates of non-healing ulcers. The antimicrobial sensitivity pattern revealed that vancomycin (100%) and amikacin (90.4%) exhibited highest sensitivity to Gram-positive cocci, while all strains of P. aeruginosa were sensitive toward imipenem (100%). The prevalent uncontrolled glycemic status, altered lipid spectra, the existence of neuropathy, and peripheral vascular disease, suggested predisposition toward the development of non-healing lesions. The study has underlined the need for continuous surveillance of bacteria and their antimicrobial sensitivity blueprints to provide the basis for empirical therapy and to minimize the risk of complications. Further, stringent clinical evaluation, and medical history will help in revealing the risk of developing non-healing status in diabetic foot ulcers.

Correlation of serum chromium, zinc, magnesium and SOD levels with HbA1c in type 2 diabetes: A cross sectional analysis.

UNLABELLED: The loss of dynamic integrity between homoeostasis of free radicals and antioxidants causes the development of complications like retinopathy, nephropathy, neuropathy, atherosclerosis and cardiovascular diseases in T2DM. AIMS AND OBJECTIVES: To assess the concentrations of serum chromium, zinc, magnesium and SOD in subjects of T2DM and control and to investigate the effect of these variables versus HbA1c. RESULTS: Insignificant difference (P=0.493) was reported in age (50±4.7 year compared with 50±7.2 year), while body mass Index (23±2kg/m(2) compared with 26±4.5kg/m(2)) between the T2DM subjects and control subject showed significant difference (<0.0001). Inverse Pearson correlation coefficient, r (-0.376), (-0.689), (-0.05), (-0.05), (-0.40), (-0.14), (-0.342) and (-0.548) were established when HbA1c of control and T2DM patients were compared with control and T2DM patients of serum Cr, Zn, Mg and SOD variables in that order. The overall "p"-value demonstrated highly significant result at p<0.0001 between the T2DM subjects and controls. CONCLUSION: Strong association between serum chromium and SOD in relation to HbA1c in this study gives a strong point that these variables could be used as markers of cell injury with the intention in further part of life en route to progressive complications in T2DM.

Effect of chromium picolinate and melatonin either in single or in a combination in high carbohydrate diet-fed male Wistar rats.

This study is designed to know the effects of chromium picolinate (CrPic) and melatonin (Mel) each alone and in a combination on high carbohydrate diet-fed (HCD-fed) male Wistar rats that exhibit insulin resistance (IR), hyperglycemia, and oxidative stress. Wistar rats have been categorized into five groups. Each group consisted of six male Wistar rats, control rats (group I), HCD (group II), HCD + CrPic (group III), HCD + Mel (group IV), and HCD + CrPic + Mel (group V). Insignificant differences were observed in serum levels of superoxide dismutase, nitric oxide, and zinc in group III, group IV, and group V when each group was compared with group II rats respectively. Significant differences were observed in group III, group IV, and group V when each group was compared with group II in homeostasis model assessment-estimated IR (P < 0.05, <0.0.05, <0.05), and in the levels of blood glucose (P < 0.05, <0.0.05, <0.05), total cholesterol (P < 0.05, <0.001, <0.001), triacylglycerols (<0.05, <0.001, <0.001), high density lipoprotein cholesterol (P < 0.05, <0.001, <0.001), malondialdehyde (P < 0.05, <0.05, <0.001), catalase (P <0.05, <0.05, <0.05), glutathione (P < 0.05, <0.05, <0.05), Mel (P < 0.05, <0.05, <0.001), and copper (P < 0.05, <0.05, < 0.001). In view of these results, HCD-fed male Wistar rats that are destined to attain IR and T2DM through diet can be prevented by giving CrPic and Mel administration in alone or in a combination.

Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Plasma thyroxine and cortisol profiles and gill and kidney Na+/K+-ATPase and SDH activities during acclimation of the catfish Heteropneustes fossilis (bloch) to higher salinity, with special reference to the effects of exogenous cortisol on hypo-osmoregulatory ability of the catfish.

When the stenohaline catfish Heteropneustes fossilis was transferred from fresh water (FW) to 30% seawater (SW), the Na(+)/K(+)-ATPase activity significantly increased in the kidney, while in gills it remained more or less constant. A reverse pattern was observed for succinic dehydrogenase (SDH) activity inasmuch as it significantly increased in gills and remained unchanged in the kidney. Plasma osmolality significantly increased within 3 days of transfer to 30% SW and remained significantly higher throughout the duration of experiment. These results suggest that catfish gills may not be able to reverse their function from salt uptake in FW to salt excretion at higher salinity, and that the elimination of monovalent as well as divalent ions is performed by the kidney but not the gills. The significant decline in plasma cortisol (F) levels following transfer to higher salinity may not be due to reduced production but rather to an enhanced utilization and clearance rate, a conclusion supported by the fact that exogenous administration of cortisol acetate (FA) resulted in significant increases in branchial and renal Na(+)/K(+)-ATPase in FW and 30% SW. FA also improved the plasma osmotic regulatory ability of the catfish, possibly due to a change in branchial function from salt-absorption to salt excretion, as was evident from a significant increase in branchial Na(+)/K(+)-ATPase activity in the fish in 30% SW pretreated with FA for 5 days. Consistently higher levels of plasma thyroxine (T4) following transfer to higher salinity suggest the involvement of this hormone at higher salinity.

Characterization of Smoc-1 uncovers two transcript variants showing differential tissue and age specific expression in Bubalus bubalis.

BACKGROUND: Secreted modular calcium binding protein-1 (Smoc-1) belongs to the BM-40 family which has been implicated with tissue remodeling, angiogenesis and bone mineralization. Besides its anticipated role in embryogenesis, Smoc-1 has been characterized only in a few mammalian species. We made use of the consensus sequence (5' CACCTCTCCACCTGCC 3') of 33.15 repeat loci to explore the buffalo transcriptome and uncovered the Smoc-1 transcript tagged with this repeat. The main objective of this study was to gain an insight into its structural and functional organization, and expressional status of Smoc-1 in water buffalo, Bubalus bubalis. RESULTS: We cloned and characterized the buffalo Smoc-1, including its copy number status, in-vitro protein expression, tissue & age specific transcription/translation, chromosomal mapping and localization to the basement membrane zone. Buffalo Smoc-1 was found to encode a secreted matricellular glycoprotein containing two EF-hand calcium binding motifs homologous to that of BM-40/SPARC family. In buffalo, this single copy gene consisted of 12 exons and was mapped onto the acrocentric chromosome 11. Though this gene was found to be evolutionarily conserved, the buffalo Smoc-1 showed conspicuous nucleotide/amino acid changes altering its secondary structure compared to that in other mammals. In silico analysis of the Smoc-1 proposed its glycoprotein nature with a calcium dependent conformation. Further, we unveiled two transcript variants of this gene, varying in their 3'UTR lengths but both coding for identical protein(s). Smoc-1 evinced highest expression of both the variants in liver and modest to negligible in other tissues. The relative expression of variant-02 was markedly higher compared to that of variant-01 in all the tissues examined. Moreover, expression of Smoc-1, though modest during the early ages, was conspicuously enhanced after 1 year and remained consistently higher during the entire life span of buffalo with gradual increment in expression of variant-02. Immunohistochemically, Smoc-1 was localized in the basement membrane zones and extracellular matrices of various tissues. CONCLUSION: These data added to our understandings about the tissue, age and species specific functions of the Smoc-1. It also enabled us to demonstrate varying expression of the two transcript variants of Smoc-1 amongst different somatic tissues/gonads and ages, in spite of their identical coding frames. Pursuance of these variants for their roles in various disease phenotypes such as hepatocellular carcinoma and angiogenesis is envisaged to establish broader biological significance of this gene.

Effect of 5-year enalapril therapy on progression of microalbuminuria and glomerular structural changes in type 1 diabetic subjects.

A 5-year randomized, double blind, placebo-controlled study was carried out to determine the effect of the angiotensin-converting enzyme (ACE) inhibitor enalapril (E) on the progress of renal function and histology in subjects with type 1 diabetes and microalbuminuria. Seventy three type 1 diabetic patients with BP <140/90 and with persistent albuminuria (AER 20-200 microg/min) and normal renal function were randomly assigned to receive E (n=37) or placebo (n=36). A percutaneous renal biopsy was successfully performed in 69 patients and repeated in 59 patients after 5 years. The mean glomerular volume (MGV), mesangial volume (Vv mes) and glomerular basement membrane thickness (GBMT) were measured histomorphometrically. Before treatment, both groups had similar clinical characteristics, blood pressure, HbA(1c), albumin excretion rate (AER), glomerular filtration rate (GFR), serum creatinine and renal structural damage. Blood pressure was well controlled in both groups. In the patients treated with E, albuminuria decreased significantly (P<0.05) and only 8.1% (3/37) of subjects progressed to clinical albuminuria (AER >300 mg/24 h) compared with 30.5% (11/36) in the placebo group. The E treatment resulted in absolute risk reduction of 22.4 percentage points for the development of clinical albuminuria over a 5-year period (P<0.01). After 5 years of treatment, GBM thickness showed a consistent, though statistically insignificant, increase in the placebo group, whereas it remained stable in the E group. A significant increase in MGV and Vv mes was also observed in the placebo group on completion of the study. The present study indicates that long term therapy with E may decrease or delay the progression of structural glomerular damage in microalbuminuric diabetic subjects without marked hypertension (BP <140/90).