Longitudinal Distribution of the Functional Feeding Groups of Aquatic Insects in Streams of the Brazilian Cerrado Savanna.

We demonstrate that the distribution of the functional feeding groups of aquatic insects is related to hierarchical patch dynamics. Patches are sites with unique environmental and functional characteristics that are discontinuously distributed in time and space within a lotic system. This distribution predicts that the occurrence of species will be based predominantly on their environmental requirements. We sampled three streams within the same drainage basin in the Brazilian Cerrado savanna, focusing on waterfalls and associated habitats (upstream, downstream), representing different functional zones. We collected 2,636 specimens representing six functional feeding groups (FFGs): brushers, collector-gatherers, collector-filterers, shredders, predators, and scrapers. The frequency of occurrence of these groups varied significantly among environments. This variation appeared to be related to the distinct characteristics of the different habitat patches, which led us to infer that the hierarchical patch dynamics model can best explain the distribution of functional feeding groups in minor lotic environments, such as waterfalls.

First Report of Garlic virus X in Garlic Plants in Brazil.

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Genome Sequence of the Melanin-Producing Extremophile Aeromonas salmonicida subsp. pectinolytica Strain 34melT.

The genome of Aeromonas salmonicida subsp. pectinolytica strain 34mel(T), isolated from a heavily polluted river, contains several genomic islands and putative virulence genes. The identification of genes involved in resistance to different kinds of stress sheds light on the mechanisms used by this strain to thrive in an extreme environment.

Identification of Corynebacterium pseudotuberculosis from sheep by PCR-restriction analysis using the RNA polymerase ß-subunit gene (rpoB).

Caseous lymphadenitis, caused by Corynebacterium pseudotuberculosis, has a high prevalence in many regions of the world, including Argentina and Brazil. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method for the identification of this microorganism was designed based on the hypervariable region of the polymorphic RNA polymerase ß-subunit gene (rpoB). All available CorynebacteriumrpoB sequences were analyzed by computer-assisted restriction analysis. The rpoB PCR-RFLP pattern predicted by using endonucleases MseI and StuI clearly differentiated C. pseudotuberculosis from sixty-one other Corynebacterium species. This method was successfully applied to identify twelve wild C. pseudotuberculosis ovine isolates and one caprine isolate. It was also used to differentiate C. pseudotuberculosis from Arcanobacterium pyogenes, an ovine pathogen with similar clinical characteristics. These results indicate that this new molecular method can be used for the reliable identification of the pathogen, essential for the timely detection of infected animals and for epidemiological studies.

Central hypothyroidism in patients with chronic hepatitis C and relation with interferon-alpha treatment.

OBJECTIVE: Since some authors referred to panhypopituitarism or central hypothyroidism during the treatment of chronic hepatitis C virus (HCV) infection using interferon-α, it is intended to evaluate the prevalence of central hypothyroidism (CH) in HCV patients before and during interferon-α therapy. PATIENTS AND METHODS: We evaluated 308 HCV patients treated with standard interferon-α (IFN) and/or pegylated-interferon-α (PEG-IFN) associated with ribavirin. Free thyroxine (FT4) and thyrotropin (TSH) levels were measured before, during and after treatment. CH was diagnosed when the level of FT4 was lower than normal values with concomitant normal or lower TSH as verified at least in two consecutive measures. RESULTS: Before treatment, 18 (5.8 %) patients presented CH Twelve patients maintained laboratory changes during the treatment and 17 new patients developed central hypothyroidism. Among the 29 patients (9.4 %) with CH, 11 used IFN, six used PEG-IFN and 12 patients used two or more therapeutic schedules. The differences in gender, age, cirrhosis, viral genotype, duration of treatment and the type of interferon used were not statistically significant. The absence of sustained virologic response was associated with central hypothyroidism (OR=3.83). CONCLUSION: HCV patients may develop CH due to viral infection or during the interferon treatment. These patients presented 3.83 times more chance of not obtaining sustained virologic response.

The association of cryoglobulinaemia with sustained virological response in patients with chronic hepatitis C.

Previous reports suggest cryoglobulinemia might influence the hepatitis C virus (HCV) infection clinical course and treatment response but this association has not been thoroughly evaluated. We aimed to assess the relationship between cryoglobulinemia and sustained viral response (SVR) in patients treated for HCV infection. We included patients with HCV infection treated from January 2003 through December 2006. Biochemical analyses, detection cryoglobulinemia, and liver biopsies were performed prior to treatment. Genotype 1 or 4 infections received Peg-interferon (IFN) alpha-2a or -2b for 48 weeks; genotypes 2 or 3 received IFN alpha for 24 weeks. All patients also received ribavirin. Of 329 enrolled patients, 242 (73%) were male and the median age was 43 years. Cryoglobulinemia was detected in 196 (59.6%) patients; liver biopsy was performed in 301. Multivariate analysis showed an association of cryoglobulinemia with severe active necroinflammation (A3) (adjusted odds ratio [AOR] = 9.48; 95% confidence interval [CI]: 1.50-59.92) and rheumatoid factor (RF) level (AOR = 1.01; 95% CI: 1.00-1.02). Variables associated with advanced fibrosis were age, aspartate aminotransferase and alkaline phosphatase levels, alcohol use, and presence of diabetes. Variables independently associated with SVR were cryoglobulinemia (AOR = 2.33, 95% CI: 1.26-4.32), absence of cirrhosis (AOR = 4.5, 95% CI: 1.4-14.80), and RF level (AOR = 1.008, 95% CI: 1.001-1.014). Our findings suggest cryoglobulinemia is associated with severe necroinflammatory activity in HCV-infected patients. We also provide the first evidence for an association between cryoglobulinemia and higher SVR rates, highlighting its potential role as a prognostic factor for treatment response.

First Report of Shallot latent virus in Garlic in Brazil.

Garlic (Allium sativum L.) can be infected by several viruses of the genera Allexivirus, Carlavirus, and Potyvirus (3). Garlic common latent virus (GarCLV) and Shallot latent virus (SLV) are the most important Carlavirus species infecting garlic, but only GarCLV has been described on garlic in Brazil. Seven hundred thirty-one samples of garlic showing mosaic symptoms and chlorotic streaking were collected from the states of São Paulo (São Manuel), Minas Gerais (Santa Juliana and São Gotardo), Goiás (Campo Alegre and Ipameri), and Paraná (Guarapuava and Piraquara) from April 2008 to July 2009 and analyzed by double-antibody sandwich (DAS)-ELISA for the presence of GarCLV and SLV using specific antiserum for SLV and GarCLV according to the manufacturer's protocol (Agdia Inc., Elkhart, IN). Cultivars sampled were Caçador, Chonan, Ito, Jonas, Quitéria, and Tropical. Fifty-five samples (7.5% of 731) tested positive for GarCLV, and none of the samples tested positive for SLV. Total RNA was extracted (2) from 15 samples that represented different states of production and used with primers SLV 7044 (5'-CTTTTGGTTCACTTTAGG-3') and SLV 8004 (5'-GCACGCAATAGTCTACGG-3'), designed in this study, to detect SLV in a one-step reverse transcription (RT)-PCR assay. Only 3 of the 15 samples, two from São Paulo and one from Paraná State, produced a 960-bp fragment covering the putative coat protein gene (ORF 5) (1) of SLV. The amplicons of the three isolates were sequenced. A nucleotide sequence identity of 91 to 92% was detected in comparison with two strains of SLV (GenBank Accession Nos. AB004567 and DQ520093), indicating the presence of two isolates of SLV in São Manuel (São Paulo State) and one in Piraquara, Paraná State (submitted to GenBank as Accession Nos. GU120176, HQ128602, and GU120175, respectively). To confirm identity of the virus, another pair of primers was constructed and tested (SLV 6737: 5'-YCCSGCCARGAAYTTCCC-3', and SLV 7060: 5'-TTAGAGCGCTGTWAACC-3'), from which a 340-bp fragment covering a portion of TGB2 (ORF 3) and TGB3 (ORF 4) (1) was amplified using the two isolates from São Paulo (GenBank Accession Nos. HQ123181 and HQ123182, respectively). The amplicon sequences shared 87% identity with that of an SLV isolate (Accession No. AJ292226), which confirmed the presence of SLV. The low titer of SLV in garlic might account for the false negative results by DAS-ELISA. The source of cultivated garlic bulbs in these regions of Brazil is unknown. Garlic cloves have been cultivated in São Manuel for approximately 15 years, indicating that SLV may have been present in Brazil for many years. To our knowledge, this is the first report of SLV in Brazil. References: (1) M. J. Adams et al. Virus Taxonomy: 8th Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, 2005. (2) Y. D. Bertheau et al. Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolff, eds. Scottish Crop Research Institute, Dundee, U.K., 1998. (3) T. V. M. Fajardo et al. Fitopatol. Bras. 26:619, 2001.

The haemodynamic, renal excretory and hormonal changes induced by resting in the left lateral position in normal pregnant women during late gestation.

OBJECTIVE: To characterise the haemodynamic, renal-electrolyte and hormonal parameters in normal near-term pregnancy. DESIGN: Observational prospective case-series study. SETTING AND POPULATION: Eleven women with normal pregnancies at 35-39 weeks gestation. METHODS: Following baseline laboratory assessments and placement of a right-atrial catheter, serial measurements were obtained for 2 hours in the supine position (SP) followed by a change to the (LLP) and subsequent observations for 2 hours. MAIN OUTCOME MEASURES: Blood pressure (BP), central venous pressure (CVP), atrial natriuretic peptide (ANP), plasma renin activity (PRA), plasma aldosterone (ALDO), diuresis, creatinine clearance, sodium and potassium excretion. RESULTS: In the SP, the subjects' BP remained stable while their CVP decreased. In the LLP, the subjects' systolic and diastolic BP consistently decreased by about 15 mmHg and their CVP increased within the first 60 minutes. ANP levels doubled in the subjects while they rested in the LLP, whereas the subjects' PRA and ALDO levels decreased by half compared with when they rested in the SP. In the LLP, the subjects' creatinine clearance significantly increased by 12% and their sodium excretion and diuresis increased by 38% and 59% respectively. CONCLUSION: Rest in the LLP induces systemic and intra-renal haemodynamic and hormonal changes that may play a central physiological role in the renal excretory response to restore excessive sodium/water retention in late pregnancy.

First Report of Tomato chlorotic spot virus Infecting Spilanthes oleracea in Brazil.

Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum 'TNN' and 'Turkish'. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum 'Havana 425', N. clevelandii, Physalis floridana, Capsicum annum 'Magda', and Solanum lycopersicum 'Santa Clara'. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3') (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.

Treatment of human papillomavirus with peg-interferon alfa-2b and ribavirin.

We reported one case of human immunodeficiency virus and hepatitis C virus co-infected patient who presented a significant improvement of human papillomavirus (HPV) lesions during the treatment of chronic hepatitis using peg-interferon alfa-2b and ribavirin.

[Molecular study of Argentine strains of Bacillus anthracis]. / Estudio molecular de cepas argentinas de Bacillus anthracis.

Bacillus anthracis is one of the most monomorphic bacteria known and epidemiological studies of this microorganism have been hampered by the lack of molecular markers. For the genotyping of fourteen Argentine field strains and the vaccine strain Steme 34F2 the presence or absence of the virulence plasmids as well as vrrA locus containing a variable-number tandem repeat (VNTR) and presenting a polymorphism involving five variants, were analyzed. Strains were isolated from cows, sheep and pigs during outbreaks occurred in Buenos Aires, Entre Ríos, Santa Fe and La Pampa in the past fifty years. All of the field strains presented plasmids pXO1 and pXO2, except for a strain isolated from pig that only presented plasmid pXO2. All the strains and the vaccine strain belonged to the same VNTR variant that was defined by sequencing the vrrA locus from three of the isolates and the strain 34F2. These sequences were completely identical and corresponded to the variant VNTR4. Thus, the fourteen Argentine B. anthracis strains studied showed great uniformity at molecular level even though they had been isolated from different mammal species within a wide time period and covering an extensive geographical area.

A multiplex PCR assay that separates Rhodnius prolixus from members of the Rhodnius robustus cryptic species complex (Hemiptera: Reduviidae).

Rhodnius prolixus is one of the most important primary vectors of human Chagas disease in Latin America. Its morphology is, however, identical to that of the members of the Rhodnius robustus cryptic species complex, which includes secondary vectors. The correct identification of these taxa with differential vector competence is, therefore, of great epidemiological relevance. We used the alignment of 26 mitochondrial cytochrome b haplotypes (663 bp) to select for PCR-amplifiable species-specific regions. We designed one forward primer on a region conserved across all haplotypes, and three reverse primers that anneal to species-specific regions and amplify fragments of different lengths for R. prolixus (285 bp) and for members of the two major R. robustus lineages: group I (349 bp) and groups II-IV (239 bp). These fragments were easily identifiable on regular 1.5% agarose gels. This multiplex PCR assay was successfully tested on 81 specimens from six Latin American countries, and used to determine the phylogeographic boundaries for each species. It is a simple, objective, and cost-effective assay. Its PCR-based nature makes it applicable to any insect developmental stage, as well as to dried specimens, and insect remains. It should be particularly useful in areas where representatives of these Rhodnius species occur in sympatry.

Treatment of human papillomavirus with peg-interferon alfa-2b and ribavirin

We reported one case of human immunodeficiency virus and hepatitis C virus co-infected patient who presented a significant improvement of human papillomavirus (HPV) lesions during the treatment of chronic hepatitis using peg-interferon alfa-2b and ribavirin.

HBV vaccination of HCV-infected patients with occult HBV infection and anti-HBc-positive blood donors.

Anti-HBc positivity is a frequent cause of donation rejection at blood banks. Hepatitis B virus (HBV) infection may also occur in HBsAg-negative patients, a situation denoted occult infection. Similarly, very low levels of HBV-DNA have also been found in the sera of patients with chronic hepatitis C virus (HCV) infection, even in the absence of serum HBsAg. Initially we searched for HBV-DNA in serum of 100 blood donors and 50 HCV-infected patients who were HBsAg negative/anti-HBc positive by nested-PCR and by an HBV monitor commercial test for HBV-DNA. Anti-HBs seroconversion rates were measured in 100 blood donors and in 22 patients with chronic HCV infection after HBV vaccination to determine if the HBV vaccination could eliminate an occult HBV infection in these individuals. Occult HBV infection was detected in proportionally fewer blood donors (6/100 = 6%) than chronic hepatitis C patients (12/50 = 24%) (P < 0.05). We noted seroconversion in 6/6 (100%) HBV-DNA(+) and in 84/94 (89.4%) HBV-DNA(-) blood donors (P > 0.05). All subjects who were HBV-DNA(+) before the first dose of HBV vaccine (D1), became HBV-DNA(-) after D1, D2, and D3. Among 22 HCV-positive patients, 10 HBV-DNA(+) and 12 HBV-DNA(-), seroconversion was observed in 9/10 (90%) HBV-DNA(+) and in 9/12 (75%) HBV-DNA(-) subjects (P > 0.05). The disappearance of HBV-DNA in the majority of vaccinated patients suggests that residual HBV can be eliminated in patients with occult infection.

HBV vaccination of HCV-infected patients with occult HBV infection and anti-HBc-positive blood donors

Anti-HBc positivity is a frequent cause of donation rejection at blood banks. Hepatitis B virus (HBV) infection may also occur in HBsAg-negative patients, a situation denoted occult infection. Similarly, very low levels of HBV-DNA have also been found in the sera of patients with chronic hepatitis C virus (HCV) infection, even in the absence of serum HBsAg. Initially we searched for HBV-DNA in serum of 100 blood donors and 50 HCV-infected patients who were HBsAg negative/anti-HBc positive by nested-PCR and by an HBV monitor commercial test for HBV-DNA. Anti-HBs seroconversion rates were measured in 100 blood donors and in 22 patients with chronic HCV infection after HBV vaccination to determine if the HBV vaccination could eliminate an occult HBV infection in these individuals. Occult HBV infection was detected in proportionally fewer blood donors (6/100 = 6 percent) than chronic hepatitis C patients (12/50 = 24 percent) (P < 0.05). We noted seroconversion in 6/6 (100 percent) HBV-DNA(+) and in 84/94 (89.4 percent) HBV-DNA(-) blood donors (P > 0.05). All subjects who were HBV-DNA(+) before the first dose of HBV vaccine (D1), became HBV-DNA(-) after D1, D2, and D3. Among 22 HCV-positive patients, 10 HBV-DNA(+) and 12 HBV-DNA(-), seroconversion was observed in 9/10 (90 percent) HBV-DNA(+) and in 9/12 (75 percent) HBV-DNA(-) subjects (P > 0.05). The disappearance of HBV-DNA in the majority of vaccinated patients suggests that residual HBV can be eliminated in patients with occult infection.

[Molecular characterization of Brucella abortus strain 19 and its application for controlling biologics]. / Tipificación molecular de Brucella abortus cepa 19 y su aplicación al control de biológicos.

Brucella abortus is the etiological agent of bovine brucellosis. The strain 19 used in vaccine elaboration can be identified through a deletion in the eri region associated with its susceptibility to erythritol. We optimized a PCR assay for specific characterization of this strain. The method described here is a rapid procedure that enables identification of B. abortus, and simultaneous differentiation of the strain 19 from other B. abortus biovar 1 strains. We applied the assay to detect the strain 19 in vaccines against B. abortus produced in Argentina. Thq results show this method could be used to follow vaccine seed cultures of this strain. The methodology could also contribute to reduce the risk of a laboratory-acquired infection and could be of great help as a routine test for confirmation of B. abortus in non related vaccines.

Hepatitis C virus infection, cryoglobulinemia, and peripheral neuropathy: a case report

Hepatitis C virus (HCV) is essentially hepatotropic but its manifestations can extend beyond the liver. It can be associated with autoimmune diseases, such as mixed cryoglobulinemia, membranoproliferative glomerulonephritis, autoimmune thyroiditis, and lymphoproliferative disorders. The mechanisms that trigger these manifestations are not completely understood. We describe a 48-year-old man with chronic HCV infection (circulating HCV RNA and moderate hepatitis as indicated by liver biopsy), cryoglobulinemia, and sensory and motor peripheral neuropathy. The diagnosis of multineuropathy was confirmed by clinical examination and electromyographic tests. A nerve biopsy revealed an inflammatory infiltrate in the perineurial space and signs of demyelination and axonal degeneration. The patient had no improvement of neurological symptoms with the use of analgesics and neuro-modulators. He was then treated with interferon-alpha (3 million units subcutaneously, 3 times per week) and ribavirin (500 mg orally, twice a day) for 48 weeks. Six months after the end of therapy, the patient had sustained viral response (negative HCV RNA) and remission of neurological symptoms, but cryoglobulins remained positive. A review of the literature on the pathogenesis and treatment of neurological manifestations associated with HCV infection is presented. This report underscores the need for a thorough evaluation of HCV-infected patients because of the possibility of extrahepatic manifestations. Antiviral treatment with interferon and ribavirin can be effective and should be considered in patients with neurological complications associated with HCV infection.

Hepatitis C virus infection, cryoglobulinemia, and peripheral neuropathy: a case report.

Hepatitis C virus (HCV) is essentially hepatotropic but its manifestations can extend beyond the liver. It can be associated with autoimmune diseases, such as mixed cryoglobulinemia, membranoproliferative glomerulonephritis, autoimmune thyroiditis, and lymphoproliferative disorders. The mechanisms that trigger these manifestations are not completely understood. We describe a 48-year-old man with chronic HCV infection (circulating HCV RNA and moderate hepatitis as indicated by liver biopsy), cryoglobulinemia, and sensory and motor peripheral neuropathy. The diagnosis of multineuropathy was confirmed by clinical examination and electromyographic tests. A nerve biopsy revealed an inflammatory infiltrate in the perineurial space and signs of demyelination and axonal degeneration. The patient had no improvement of neurological symptoms with the use of analgesics and neuro-modulators. He was then treated with interferon-alpha (3 million units subcutaneously, 3 times per week) and ribavirin (500 mg orally, twice a day) for 48 weeks. Six months after the end of therapy, the patient had sustained viral response (negative HCV RNA) and remission of neurological symptoms, but cryoglobulins remained positive. A review of the literature on the pathogenesis and treatment of neurological manifestations associated with HCV infection is presented. This report underscores the need for a thorough evaluation of HCV-infected patients because of the possibility of extrahepatic manifestations. Antiviral treatment with interferon and ribavirin can be effective and should be considered in patients with neurological complications associated with HCV infection.