Molecular dynamics study of collective water vibrations in a DNA hydration shell.

The structure of DNA double helix is stabilized by water molecules and metal counterions that form the ion-hydration shell around the macromolecule. Understanding the role of the ion-hydration shell in the physical mechanisms of the biological functioning of DNA requires detailed studies of its structure and dynamics at the atomistic level. In the present work, the study of collective vibrations of water molecules around the DNA double helix was performed within the framework of classical all-atom molecular dynamics methods. Calculating the vibrational density of states, the vibrations of water molecules in the low-frequency spectra ranged from [Formula: see text]30 to [Formula: see text]300 [Formula: see text] were analyzed for the case of different regions of the DNA double helix (minor groove, major groove, and phosphate groups). The analysis revealed significant differences in the collective vibrations behavior of water molecules in the DNA hydration shell, compared to the vibrations of bulk water. All low-frequency modes of the DNA ion-hydration shell are shifted by about 15-20 [Formula: see text] towards higher frequencies, which is more significant for water molecules in the minor groove region of the double helix. The interactions of water molecules with the atoms of the macromolecule induce intensity decrease of the mode of hydrogen-bond symmetrical stretching near 150 [Formula: see text], leading to the disappearance of this mode in the DNA spectra. The obtained results can provide an interpretation of the experimental data for DNA low-frequency spectra and may be important for the understanding of the processes of indirect protein-nucleic recognition.

Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of Spermidine3+ With DNA Double Helices.

Polyamines have important roles in the modulation of the cellular function and are ubiquitous in cells. The polyamines putrescine2+, spermidine3+, and spermine4+ represent the most abundant organic counterions of the negatively charged DNA in the cellular nucleus. These polyamines are known to stabilize the DNA structure and, depending on their concentration and additional salt composition, to induce DNA aggregation, which is often referred to as condensation. However, the modes of interactions of these elongated polycations with DNA and how they promote condensation are still not clear. In the present work, atomistic molecular dynamics (MD) computer simulations of two DNA fragments surrounded by spermidine3+ (Spd3+) cations were performed to study the structuring of Spd3+ "caged" between DNA molecules. Microsecond time scale simulations, in which the parallel DNA fragments were constrained at three different separations, but allowed to rotate axially and move naturally, provided information on the conformations and relative orientations of surrounding Spm3+ cations as a function of DNA-DNA separation. Novel geometric criteria allowed for the classification of DNA-Spd3+ interaction modes, with special attention given to Spd3+ conformational changes in the space between the two DNA molecules (caged Spd3+). This work shows how changes in the accessible space, or confinement, around DNA affect DNA-Spd3+ interactions, information fundamental to understanding the interactions between DNA and its counterions in environments where DNA is compacted, e.g. in the cellular nucleus.

Molecular dynamics study of the competitive binding of hydrogen peroxide and water molecules with DNA phosphate groups.

The interaction of hydrogen peroxide molecules with the DNA double helix is of great interest for understanding the mechanisms of anticancer therapy utilising heavy ion beams. In the present work, a molecular dynamics study of competitive binding of hydrogen peroxide and water molecules with phosphate groups of the DNA double helix backbone was carried out. The system of DNA double helix in a water solution with hydrogen peroxide molecules and Na[Formula: see text] counterions was simulated. The results show that the hydrogen peroxide molecules bind to oxygen atoms of the phosphate groups of the double helix backbone replacing water molecules of its hydration shell. The complexes of hydrogen peroxide molecules with the phosphate groups are stabilized by one or two hydrogen bonds and by Na[Formula: see text] counterions, forming ion-mediated contacts between phosphate groups and hydrogen peroxide molecules. The complex characterized by one H-bond between the hydrogen peroxide molecule and phosphate group is dominant, the other complexes are rare. The hydrogen peroxide molecule bound to the phosphate group of the double helix backbone can inhibit the formation of hydrogen bonds indispensable for the DNA biological functioning.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Hydration of counterions interacting with DNA double helix: a molecular dynamics study.

In the present work, molecular dynamics simulations have been carried out to study the dependence of counterion distribution around the DNA double helix on the character of ion hydration. The simulated systems consisted of DNA fragment d(CGCGAATTCGCG) in water solution with the counterions Na+, K+, Cs+ or Mg2+. The characteristic binding sites of the counterions with DNA and the changes in their hydration shell have been determined. The results show that due to the interaction with DNA at least two hydration shells of the counterions undergo changes. The first hydration shell of Na+, K+, Cs+, and Mg2+ counterions in the bulk consists of six, seven, ten, and six water molecules, respectively, while the second one has several times higher values. The Mg2+ and Na+ counterions, constraining water molecules of the first hydration shell, mostly form with DNA water-mediated contacts. In this case the coordination numbers of the first hydration shell do not change, while the coordination numbers of the second one decrease about twofold. The Cs+ and K+ counterions that do not constrain surrounding water molecules may be easily dehydrated, and when interacting with DNA their first hydration shell may be decreased by three and five water molecules, respectively. Due to the dehydration effect, these counterions can squeeze through the hydration shell of DNA to the bottom of the double helix grooves. The character of ion hydration establishes the correlation between the coordination numbers of the first and the second hydration shells. Graphical Abstract Hydration of counterions interacting with DNA double helix.

Texture formation in DNA films with alkali metal chlorides.

The formation of textures in DNA films with LiCl, NaCl, KCl, RbCl, and CsCl salts has been studied. The films are prepared by evaporation of water solution with highly polymerized calf thymus DNA and excess salt of specific type. For DNA solution with 10 mM concentration of NaCl, KCl, and RbCl the films with dendritic textures have been obtained, whereas in case of CsCl the textures in the films appear only at 30 mM concentration of excess salt in the initial solution. In the solution with LiCl, the textures in DNA films have not been observed within the whole range of concentration of excess salt under consideration. The analysis of parameters of DNA films with different salts has showed that evaporation of solution leads to crystallization of salt ions on DNA macromolecule and formation of DNA-salt complexes. Electrostatic energy of the system of crystalline ordered ions and charges of DNA chains has been estimated to study the stability of DNA-salt complexes. The results obtained for different salts have been showed that the presence of DNA macromolecule enhances crystallization as compared with solution without DNA. The property of excess salt to form the crystalline structures has been found to decrease in the following order: KCl > NaCl > RbCl > CsCl > LiCl. The results of estimation are in good agreement with the experimentally observed dependence of texture formation on excess salt type.