IL-1ß Promotes Expansion of IL-33+ Lung Epithelial Stem Cells after Respiratory Syncytial Virus Infection during Infancy.

Respiratory syncytial virus (RSV)-induced immunopathogenesis and disease severity in neonatal mice and human infants have been related to elevated pulmonary IL-33. Thus, targeting IL-33 has been suggested as a potential therapy for respiratory viral infections. Yet, the regulatory mechanisms on IL-33 during early life remain unclear. Here, using a neonatal mouse model of RSV, we demonstrate that IL-1ß positively regulates but is not required for RSV-induced expression of pulmonary IL-33 in neonatal mice early after the initial infection. Exogenous IL-1ß upregulates RSV-induced IL-33 expression by promoting the proliferation of IL-33+ lung epithelial stem/progenitor cells. These cells are exclusively detected in RSV-infected neonatal rather than adult mice, partially explaining the IL-1ß-independent IL-33 expression in RSV-infected adult mice. Furthermore, IL-1ß aggravates IL-33-mediated T-helper cell type 2-biased immunopathogenesis upon reinfection. Collectively, our study demonstrates that IL-1ß exacerbates IL-33-mediated RSV immunopathogenesis by promoting the proliferation of IL-33+ epithelial stem/progenitor cells in early life.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Randomized controlled trial of mechanical bowel preparation for laparoscopy-assisted colectomy.

INTRODUCTION: The benefit of mechanical bowel preparation (MBP) before open colon surgery has been debated over the last decade. The aim of this randomized controlled trial was to evaluate the effect of MBP on the outcome of patients who underwent elective laparoscopic colectomy. METHODS: Patients who were scheduled to undergo elective laparoscopic colon resection with primary anastomosis were randomly allocated to a preoperative MBP group (either two bottles of sodium phosphate or 2-L polyethylene glycol) or a no-MBP group. Anastomotic leakage and other complications such as surgical-site infection and extra-abdominal complications were recorded postoperatively. RESULTS: In this study, 122 patients were recruited and randomly allocated to the MBP group (n = 62) or the no-MBP group (n = 60). Demographic and clinical characteristics were not significantly different between the two groups. The rate of abdominal complications, including anastomotic leak and surgical-site infection, was 16.2% in the MBP group and 18.3% in the no-MBP group (P = 0.747). Anastomotic leakage occurred in four patients (6.5%) in the MBP group and in two patients (3.3%) in no-MBP group (P = 0.680). About 29% of patients in the MBP group still had either liquid or solid content in the bowel. No significant difference was found between the length of hospital stay in the MBP group and the no-MBP group (9.0 ± 2.9 vs 8.4 ± 1.9 days, P = 0.180). CONCLUSIONS: Elective laparoscopic colectomy without MBP is safe and offers acceptable postoperative morbidity.