Identification of factors associated with sarcopenic obesity development: Literature review and expert panel voting.

Sarcopenic obesity (SO) is defined as the combination of excess fat mass (obesity) and low skeletal muscle mass and function (sarcopenia). The identification and classification of factors related to SO would favor better prevention and diagnosis. The present article aimed to (i) define a list of factors related with SO based on literature analysis, (ii) identify clinical conditions linked with SO development from literature search and (iii) evaluate their relevance and the potential research gaps by consulting an expert panel. From 4746 articles screened, 240 articles were selected for extraction of the factors associated with SO. Factors were classified according to their frequency in the literature. Clinical conditions were also recorded. Then, they were evaluated by a panel of expert for evaluation of their relevance in SO development. Experts also suggested additional factors. Thirty-nine unique factors were extracted from the papers and additional eleven factors suggested by a panel of experts in the SO field. The frequency in the literature showed insulin resistance, dyslipidemia, lack of exercise training, inflammation and hypertension as the most frequent factors associated with SO whereas experts ranked low spontaneous physical activity, protein and energy intakes, low exercise training and aging as the most important. Although literature and expert panel presented some differences, this first list of associated factors could help to identify patients at risk of SO. Further work is needed to confirm the contribution of factors associated with SO among the population overtime or in randomized controlled trials to demonstrate causality.

Exposure to household air pollution from biomass-burning cookstoves and HbA1c and diabetic status among Honduran women.

Household air pollution from biomass cookstoves is estimated to be responsible for more than two and a half million premature deaths annually, primarily in low and middle-income countries where cardiometabolic disorders, such as Type II Diabetes, are increasing. Growing evidence supports a link between ambient air pollution and diabetes, but evidence for household air pollution is limited. This cross-sectional study of 142 women (72 with traditional stoves and 70 with cleaner-burning Justa stoves) in rural Honduras evaluated the association of exposure to household air pollution (stove type, 24-hour average kitchen and personal fine particulate matter [PM2.5 ] mass and black carbon) with glycated hemoglobin (HbA1c) levels and diabetic status based on HbA1c levels. The prevalence ratio (PR) per interquartile range increase in pollution concentration indicated higher prevalence of prediabetes/diabetes (vs normal HbA1c) for all pollutant measures (eg, PR per 84 µg/m3 increase in personal PM2.5 , 1.49; 95% confidence interval [CI], 1.11-2.01). Results for HbA1c as a continuous variable were generally in the hypothesized direction. These results provide some evidence linking household air pollution with the prevalence of prediabetes/diabetes, and, if confirmed, suggest that the global public health impact of household air pollution may be broader than currently estimated.

Mielopatía por déficit de cobre: la gran simuladora / Myelopathy secondary to copper deficiency: The great imitator

No disponible

Hallazgos en resonancia magnética nuclear craneal tras intoxicación aguda por monóxido de carbono / Magnetic resonance imaging findings after acute carbon monoxide poisoning

No disponible

First Report of Rice yellow mottle virus in Rice in the Central African Republic.

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.

Terapia de movimiento inducido por restricción del lado sano. ¿Alternativa en pacientes post-ictus? / Constraint-induced movement therapy. alternative in stroke patient?

Introducción Partiendo del concepto de neuroplasticidad, Taub et al. introducen el término de terapia de movimiento inducido por restricción del lado sano (CIMT), demostrando su efectividad por primera vez en humanos y estableciendo las bases de una nueva terapia rehabilitadora. Objetivos Analizar la evidencia de la efectividad de CIMT. Material y métodos Se realiza revisión bibliográfica de estudios aleatorizados de CIMT frente a tratamiento rehabilitador convencional en pacientes con ictus y hemiparesia secundaria. Resultados Numerosos trabajos demuestran diferencias significativas en la mejoría de la función motora, pero no definitivos en la disminución de la discapacidad. A pesar de la extensa bibliografía de los últimos 15 años, sigue sin estar establecida la pauta más adecuada en el tiempo de restricción, la intensidad y la duración del programa. Conclusiones Se precisan nuevos estudios controlados con series más amplias para sentar las indicaciones de la aplicación de terapia de movimiento inducido por restricción del lado sano (AU)

Introduction Based on the concept of neuroplasticity Taub et al. introduced the term constraint-induced movement therapy (CIMT). They demonstrated its effectiveness for the first time in humans and established standards for a new rehabilitation therapy. Objectives To analyze the evidence of the effectiveness of CIMT. Material and methods We review CIMT trials in stroke patients with secondary hemiparesis. Results Numerous studies show significant differences in improvement in motor function, but which were not definitive in reducing disability. Despite the extensive literature of the past 15 years, the most adequate treatment regime in proper time constraint, training intensity and program duration has still not been established. Conclusions Further controlled studies with larger series are needed to establish the indications for CIMT (AU)

Abiotic transmission of Rice yellow mottle virus through soil and contact between plants.

The roles of guttation fluid, irrigation water, contact between plants and transplantation into contaminated soil in the transmission of Rice yellow mottle virus (RYMV) were assessed. RYMV presence and infectivity were tested by Enzyme-Linked Immunosorbent Assay (ELISA) and by inoculation to susceptible rice cultivar BG90-2. The virus was readily detected in guttation fluid collected from infected rice plants. Transmission tests from this fluid led to high disease incidence (86.6%). Irrigation water collected at the base of infected plants growing in pots was less infectious, as inoculations led to disease incidences below 40%. No virus was detected and could be transmitted from field-irrigation water. Up to 44% healthy rice plants whose leaves were in contact with those of infected plants became infected but, no transmission occurred through intertwined roots. Transplantation of rice seedling into virus-contaminated soil also led to plant infection. However, virus survival in the soil decrease rapidly and infectivity was completely lost 14 days after soil contamination. Altogether, these results indicated that high planting densities of rice are likely to favour secondary spread of rice yellow mottle disease. Transplantation of rice seedlings not earlier than 2 weeks after soil preparation should prevent soil transmission of the virus. Although guttation fluid is highly infectious its contribution to virus infectivity in irrigation water is negligible as field-irrigation water was not found to be an infectious source for RYMV.

Rice yellow mottle virus, an RNA plant virus, evolves as rapidly as most RNA animal viruses.

The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. Accordingly, the evolution rate of Rice yellow mottle virus (RYMV) was calculated from sequences of the coat protein gene of isolates collected from rice over a 40-year period in different parts of Africa. The evolution rate of RYMV was estimated by pairwise distance linear regression on five phylogeographically defined groups comprising a total of 135 isolates. It was further assessed from 253 isolates collected all over Africa by Bayesian coalescent methods under strict and relaxed molecular clock models and under constant size and skyline population genetic models. Consistent estimates of the evolution rate between 4 x 10(-4) and 8 x 10(-4) nucleotides (nt)/site/year were obtained whatever method and model were applied. The synonymous evolution rate was between 8 x 10(-4) and 11 x 10(-4) nt/site/year. The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. Experimentally, in host change studies, substitutions accumulated at an even higher rate. The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses.

Processes of diversification and dispersion of rice yellow mottle virus inferred from large-scale and high-resolution phylogeographical studies.

Phylogeography of Rice yellow mottle virus (RYMV) was reconstructed from the coat protein gene sequences of a selection of 173 isolates from the 14 countries of mainland Africa where the disease occurred and from the full sequences of 16 representative isolates. Genetic variation was linked to geographical distribution and not to host species as isolates from wild rice always clustered with isolates from cultivated rice of the same region. Genetic variation was not associated to agro-ecology, viral interference and insect vector species. Distinct RYMV lineages occurred in East, Central and West Africa, although the Central African lineage included isolates from Benin, Togo and Niger at the west, adjacent to countries of the West African lineage. Genetic subdivision at finer geographical scales was apparent within lineages of Central and West Africa, although less pronounced than in East Africa. Physical obstacles, but also habitat fragmentation, as exemplified by the small low-lying island of Pemba offshore Tanzania mainland, explained strain localization. Three new highly divergent strains were found in eastern Tanzania. By contrast, intensive surveys in Cote d'Ivoire and Guinea at the west of Africa did not reveal any new variant. Altogether, this supported the view that the Eastern Arc Mountains biodiversity hotspot was the centre of origin of RYMV and that the virus spread subsequently from east to west across Africa. In West Africa, specific strains occurred in the Inner Niger Delta and suggested it was a secondary centre of diversification. Processes for diversification and dispersion of RYMV are proposed.

Molecular epidemiology of the RNA satellite of Rice yellow mottle virus in Africa.

Satellite RNA was sought in 51 isolates of Rice yellow mottle virus (RYMV) representative of the geographical, molecular and pathogenic variability of the virus in Africa. Three-quarters of the isolates from cultivated rice and wild gramineaceous hosts supported a satellite RNA. The prevalence of RYMV isolates that were associated with a satellite differed among regions, being c. 100% in West and Central Africa and c. 36% in East Africa. The RYMV satellite showed a low diversity as only seven of the 220 sequenced positions were variable. One insertion also occurred after serial host passages of the satellite. Two forms of the satellite differed by six substitutions forming three base pairs in one branch of the predicted RNA secondary structure. There was no evidence of intermediates between these two forms, but double-infection occurred. Each form had a specific geographical distribution: one occurred in Central Africa, the other elsewhere in Africa. There was no relation between the occurrence or the forms of the satellite and the phylogeny of the helper virus. The satellite was not involved in symptom modulation or ability to break host-plant resistances to the disease.

Fine genetic mapping of a gene required for Rice yellow mottle virus cell-to-cell movement.

The very high resistance to Rice yellow mottle virus observed in the two rice varieties Gigante ( Oryza sativa) and Tog 5681 ( O. glaberrima) is monogenic and recessive. Bulked segregant analysis was carried out to identify AFLP markers linked to the resistance gene. Mapping of PCR-specific markers, CAPS and microsatellite markers on 429 individuals of an IR64 x Gigante F(2) population pinpointed this resistance gene on the long arm of chromosome 4 in a 3.7-cM interval spanned by PCR markers. These markers also flanked the resistance gene of the O. glaberrima accession Tog 5681 and confirmed previous allelism tests. The rarity of this recessive natural resistance was in line with a resistance mechanism model based on point mutations of a host component required for cell-to-cell movement of the virus. Preliminary data on the genetic divergence between the two cultivated rice species in the vicinity of the resistance locus suggested that two different resistance alleles are present in Gigante and Tog 5681. A large set of recombinants is now available to envisage physical mapping and cloning of the gene.

Comparison of molecular and immunological typing of isolates of Rice yellow mottle virus.

Isolates of Rice yellow mottle virus (RYMV) were typed at the molecular level through the sequences of the open reading frame (ORF) 4 (coding for the coat protein) and ORF1 (coding for the movement protein), and serologically by means of polyclonal and monoclonal antibodies. The overall patterns of diversity shown by molecular and serological analyses were similar: East-African isolates differed from West-African ones, and the West-African isolates from forest differed from the savannah ones. Each major strain had a different serological profile. However, molecular typing was more discriminating than immunological typing since several sequence variants belonged to the same serotype. In rare instances, there were explainable discrepancies between molecular and serological typing. Two amino acids at positions 115 (alanine vs threonine) and 191 (valine vs threonine) consistently discriminated between the major serotypes. These positions were located in antigenic sites as revealed by Spot-scan method and were recognised by discriminating monoclonal antibodies. One shared epitope, lying within a conserved region, may be responsible for the cross-reactivity between RYMV isolates. A rationale for the correlation between molecular and immunological typing of RYMV and other sobemoviruses is proposed.

Distribution, Pathogenicity, and Interactions of Two Strains of Rice yellow mottle virus in Forested and Savanna Zones of West Africa.

In Côte d'Ivoire, the S2 strain of Rice yellow mottle virus (RYMV) predominated in the forested zones, including the "rice belt" to the west, in each of the cropping systems where rice was grown. The S1 strain occurred more frequently in the northern Guinean savanna, and only S1 isolates were found further north in the Sahelo-Soudanian zones. In mixed infection, S2 dominated over S1 both in viral capsid and RNA contents under temperature regimes encompassing those observed in savanna and forested zones of Côte d'Ivoire. There was no evidence of interactions in virus accumulation between the West African strains S1 or S2 with the more distantly related East African strain S4. Field trials emphasized the impact of RYMV, which induced yield losses of 40 to 60% in several widely grown cultivars of Oryza sativa indica and O. sativa japonica. We report the high resistance of the O. indica cv. Gigante under field conditions which was apparent with all the S1 and S2 isolates tested. Responses to RYMV infection of several cultivars were isolate dependent. With most differential cultivars, responses were not strain specific, with the exception of the O. japonica cv. Idsa6, in which the S2 isolates always induced higher yield losses than the S1 isolates.

First Report and Characterization of Rice yellow mottle virus in Central Africa.

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is the main virus infecting rice (Oryza sativa) in Africa. First reported in Kenya (East Africa), RYMV was later found in most countries of East and West Africa where rice is grown, and in Madagascar in the Indian Ocean. In Central Africa however, the disease had never been reported in rice fields. Ninety-eight field samples with typical yellow mottle symptoms from cultivated rice and two wild rice species (Oryza longistaminata and O. barthii) were collected in the Soudano-Sahelian zones, in the north of Cameroon and the south of Chad (Central Africa) in September 2000. RYMV was detected by ELISA with polyclonal antisera (1) in all samples. All virus isolates were also mechanically transmitted to rice cv. BG 90-2, which is highly susceptible to RYMV. Tests with monoclonal antibodies showed that most isolates from Central Africa were of the SI serotype, which is widespread in the Soudano-Sahelian zones of West Africa (1). The coat protein gene of 7 isolates was amplified by RT-PCR and the expected 720 bp fragment was obtained. Resulting sequences (AJ306735, AJ317949, AJ317950, AJ317951, AJ317952, AJ317953, AJ317954) shared over 95% sequence identity. They were compared to a set of sequences of RYMV isolates from cultivated rice of different geographical origins (2). Phylogenetic analyses by maximum parsimony (PAUP 4) showed that isolates from Central Africa belonged to a monophyletic group, a sister group of West African isolates from the Soudano-Sahelian zones, further supporting the geographic basis of RYMV diversity (2). RYMV incidence was generally less than 10% but reached 20% in some irrigated plots in the two countries. References: (1) G. Konaté et al. Arch Virol. 142:1117, 1997. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.

Molecular variability of geographically distinct isolates of Rice yellow mottle virus in Africa.

The coat protein gene (ORF4) and the 3' untranslated region of a sample of 40 isolates of Rice yellow mottle virus (RYMV), 32 from West Africa and 8 from East Africa, have been sequenced. Five major strains were differentiated, three from West Africa (S1, S2, S3) and two from East Africa (S4, S5), with a spatial overlap of the strains within each of these two regions. Nucleotide and amino-acid divergence between strains was up to 11%. Although more isolates from West African were sequenced, variability was twofold lower than among East African isolates. Variability in ORF4 and in ORF2 coincided. Within strain and within isolate variations in nucleotide sequences were low. Bipartite nuclear targeting motif, Ca2+ binding sites and at least two stretches of amino-acids were conserved among the 40 RYMV isolates and the other sobemoviruses. Variants associating sequence motifs characteristic of different strains have been found, possibly resulting from recombination events. Differences in pathogenicity among isolates were associated with changes of amino-acids in the bipartite nuclear targeting motif of the R domain of the capsid protein, and around conserved positions 151-154 of the S domain. We hypothesise that the observed pattern of variation of RYMV reflects the effect of spatial isolation between East and West Africa coupled with adaptive changes associated to the original virus reservoirs of the different strains.