Blueberry red ringspot virus genomes from Florida inferred through analysis of blueberry root transcriptomes.

A growing number of metagenomics-based approaches have been used for the discovery of viruses in insects, cultivated plants, and water in agricultural production systems. In this study, sixteen blueberry root transcriptomes from eight clonally propagated blueberry plants of cultivar 'Emerald' (interspecific hybrid of Vaccinium corymbosum and V. darrowi) generated as part of a separate study on varietal tolerance to soil salinity were analyzed for plant viral sequences. The objective was to determine if the asymptomatic plants harbored the latent blueberry red ringspot virus (BRRV) in their roots. The only currently known mechanism of transmission of BRRV is through vegetative propagation; however, the virus can remain latent for years with some plants of 'Emerald' never developing red ringspot symptoms. Bioinformatic analyses of 'Emerald' transcriptomes using de novo assembly and reference-based mapping approaches yielded eight complete viral genomes of BRRV (genus Soymovirus, family Caulimoviridae). Validation in vitro by PCR confirmed the presence of BRRV in 100% of the 'Emerald' root samples. Sequence and phylogenetic analyses showed 94% to 97% nucleotide identity between BRRV genomes from Florida and sequences from Czech Republic, Japan, Poland, Slovenia, and the United States. Taken together, this study documented the first detection of a complete BRRV genome from roots of asymptomatic blueberry plants and in Florida through in silico analysis of plant transcriptomes.

Complete Genome Sequence of a New Strain of Sida Golden Mosaic Buckup Virus from Florida, USA.

The complete genome sequence of a bipartite begomovirus found in a Sida sp. plant growing in Bradenton, FL, was determined. The virus is a new strain of Sida golden mosaic Buckup virus (family Geminiviridae, genus Begomovirus). This is the first report of this virus in the United States and the first report outside Jamaica.

Characterization of sida golden mottle virus isolated from Sida santaremensis Monteiro in Florida.

The genome of sida golden mottle virus (SiGMoV) (GU997691 and GU997692) isolated from Sida santaremensis Monteiro in Manatee County, Florida, was sequenced and characterized. SiGMoV was determined to be a bipartite virus belonging to the genus Begomovirus with a genome organization typical of the New World viruses in the genus. SiGMoV DNA-A had the highest identity scores (89%) and showed the closest evolutionary relationships to sida golden mosaic Buckup virus (SiGMBuV) (JX162591 and HQ008338). However, SiGMoV DNA-B had the highest identity scores (93%) and showed the closest evolutionary relationship to corchorus yellow spot virus (DQ875869), SiGMBuV (JX162592) and sida golden mosaic Florida virus (SiGMFlV) (HE806443). There was extensive recombination in the SiGMoV DNA-A and much less in DNA-B. Full-length clones of SiGMoV were infectious and were able to infect and cause symptoms in several plant species.

Comparison of genus-specific primers in RT-PCR for the broad-spectrum detection of viruses in the genus Potyvirus by plant diagnostic laboratories.

The Potyvirus genus is one of the largest genera of plant viruses and encompasses many economically important pathogens. While a number of degenerate primers for use in broad spectrum RT-PCR assays have been published, it is not clear which of these primers would be the most useful for use by plant diagnostic laboratories. Twelve sets of primers were tested for their ability to detect nine potyviruses in a two-step RT-PCR. Viruses were extracted from different host backgrounds and were selected to represent eight clades plus one species between clades (sensu Gibbs and Ohshima, 2010). Results of this study indicated that the primers CIFor/CIRev produced easily detectable amplicons from all nine potyviruses without non-specific amplification, false positives, or false negatives. CIFor/CIRev produced single amplicons from potyvirus-infected tissues which could be sequenced directly without gel purification to identify the virus to species.

Genome Sequence of Euphorbia mosaic virus from Passionfruit and Euphorbia heterophylla in Florida.

Euphorbia mosaic virus (EuMV) was found in a symptomatic passionfruit (Passiflora edulis) plant from Homestead, Florida, USA, as well as in the symptomatic weed Euphorbia heterophylla This is the first identification of EuMV in Florida and the United States and the first report of a natural infection of passionfruit by EuMV.

The complete genome sequence of New World jatropha mosaic virus.

Full-length sequences of a bipartite begomovirus were obtained from a plant of Jatropha multifida in Florida showing symptoms of foliar mosaic, distortion and necrosis. Sequences of four clones each of a DNA-A and DNA-B were obtained, which showed very low sequence diversity among themselves. The clones were infectious when biolistically inoculated to J. multifida, Phaseolus vulgaris and Nicotiana tabacum, but not to J. curcas. The DNA-A sequences had less than 89 % pairwise identity scores with the DNA-A of other begomoviruses. The DNA-A appeared to be a recombinant in that 18 % of the DNA-A (470 nt) had a pairwise identity score of 91.98 % with RhRGMV, indicating that this portion most likely originated from a virus closely related to RhRGMV. The remaining 82 % of the DNA-A had lower identity scores with TbMoLCV (87.84 %) and RhRGMV (87.46 %), which suggests that this part of the component originated from an undescribed virus. There was no evidence for recombination in the DNA-B. Equivalent sequences of the DNA-A had the highest identity score (94.18 %) with a 533-nt sequence obtained from J. multifida from Puerto Rico in 2001 (GenBank accession no. AF058025). Pairwise comparison, recombination and phylogenetic analysis, and biology suggest that these clones are those of jatropha mosaic virus first reported from Puerto Rico. This is the first report of the complete genome sequence of jatropha mosaic virus.

A variant of blueberry necrotic ring blotch virus associated with red lesions in blueberry.

The complete genome of a variant of the multi-segmented (+) RNA virus blueberry necrotic ring blotch virus (BNRBV), which has not been assigned to a genus, was obtained from foliar red lesions on southern highbush blueberries grown in Alachua Co., Florida. The genome organization of this variant, BNRBV-RL, is the same as that of BNRBV: four genomic segments and seven ORFs (one ORF on each of RNA 1, RNA 2, and RNA 4 and as many as four ORFs on RNA 3). BLAST analysis revealed nucleic acid sequence identities of 89 %, 90 %, 90 % and 86 % to BNRBV RNA 1, RNA 2, RNA 3 and RNA 4, respectively. Phylogenetic analysis of the amino acid sequence of the putative RdRp domain indicated that BNRBV-RL was closely related to BNRBV and less related to citrus leprosis virus type C and three other mite-transmitted viruses. The nucleotide and amino acid sequence differences between BNRBV-RL and BNRBV combined with differences in symptom expression in blueberry would suggest that BNRBV-RL is a strain of BNRBV.

Characterization and distribution of tomato yellow margin leaf curl virus, a begomovirus from Venezuela.

A begomovirus causing mottling and leaf deformation in tomato from the State of Mérida was cloned and sequenced. The virus has a bipartite genome comprised of a DNA-A (2,572 nucleotides) and a DNA-B (2,543 nucleotides) with a genome organization typical of New World begomoviruses. Both components share a common region of 115 nucleotides with 98 % sequence identity. Phylogenetic analysis indicated that while no virus sequences were closely related, the A component was distantly related to those of two other tomato-infecting viruses, tomato leaf deformation virus and Merremia mosaic virus; and the DNA-B, to those of pepper huasteco yellow vein virus and Rhynchosia golden mosaic Yucatan virus. The DNA-A and DNA-B sequences were submitted to GenBank (accession no. AY508993 and AY508994, respectively) and later accepted by the International Committee on Taxonomy of Viruses as the genome of a member of a unique virus species with the name Tomato yellow margin leaf curl virus (TYMLCV). Tomato (Solanum lycopersicum L. 'Fl. Lanai') plants inoculated with cloned TYMLCV DNA-A and DNA-B became systemically infected and showed chlorotic margins and leaf curling. The distribution of TYMLCV in tomato-producing states in Venezuela was determined by nucleic acid spot hybridization analysis of 334 tomato leaf samples collected from ten states using a TYMLCV-specific probe and confirmed by PCR and sequencing of the PCR fragment. TYMLCV was detected in samples from the states of Aragua, Guárico, and Mérida, suggesting that TYMLCV is widely distributed in Venezuela.

18-Methoxycoronaridine blocks context-induced reinstatement following cocaine self-administration in rats.

Numerous studies utilizing drug self-administration have shown the importance of conditioned cues in maintaining and reinstating addictive behaviors. However, most used simple cues that fail to replicate the complexity of cues present in human craving and addiction. We have recently shown that music can induce behavioral and neurochemical changes in rats following classical conditioning with psychostimulants. However, such effects have yet to be characterized utilizing operant self-administration procedures, particularly with regard to craving and relapse. The goal of the present study was to validate the effectiveness of music as a contextual conditioned stimulus using cocaine in an operant reinstatement model of relapse. Rats were trained to lever press for cocaine with a musical cue, and were subsequently tested during reinstatement sessions to determine how musical conditioning affected drug seeking behavior. Additionally, in vivo microdialysis was used to determine basolateral amygdala involvement during reinstatement. Lastly, tests were conducted to determine whether the putative anti-addictive agent 18-methoxycoronaridine (18-MC) could attenuate cue-induced drug seeking behavior. Our results show that music-conditioned animals exhibited increased drug seeking behaviors when compared to controls during reinstatement test sessions. Furthermore, music-conditioned subjects exhibited increased extracellular dopamine in the basolateral amygdala during reinstatement sessions. Perhaps most importantly, 18-MC blocked musical cue-induced reinstatement. Thus,music can be a powerful contextual conditioned cue in rats, capable of inducing changes in both brain neurochemistry and drug seeking behavior during abstinence. The fact that 18-MC blocked cue-induced reinstatement suggests that α3ß4 nicotinic receptors may be involved in the mechanism of craving, and that 18-MC may help prevent relapse to drug addiction in humans.

Music-induced context preference following cocaine conditioning in rats.

Traditional models of drug-seeking behavior have shown that exposure to associated environmental cues can trigger relapse. These learned associations take place during repeated drug administration, resulting in conditioned reinforcement. Although considerable investigation has occurred regarding simple conditioned stimuli, less is known about complex environmental cues, particularly those that may be salient in human addiction. Recent studies indicate that music can serve as a contextual conditioned stimulus in rats and influence drug-seeking behavior during abstinence. The purpose of the present study was to further assess the effectiveness of music as a conditioned stimulus in rats, to determine rats' preferences for two contrasting pieces of music, and to determine rats' preferences for music versus silence. To this end, we created an apparatus that gave instrumental control of musical choice (Miles Davis vs. Beethoven) to the rats themselves. After determining baseline musical preference, animals were conditioned with cocaine (10 mg/kg) to the music they initially preferred least, with alternating conditioning sessions pairing saline with the music preferred most. The animals were subsequently tested in a drug-free state to determine what effect this conditioning had on musical preference. The results indicate that music serves as an effective contextual conditioned stimulus, significantly increasing both musical preference and locomotor activity after repeated cocaine conditioning. Furthermore, we found that rats initially favor silence over music, but that this preference can be altered as a result of cocaine-paired conditioning. These findings demonstrate that, after repeated association with reward (cocaine), music can engender a conditioned context preference in rats; these findings are consistent with other evidence showing that musical contextual cues can reinstate drug-seeking behavior in rats.

Music and methamphetamine: conditioned cue-induced increases in locomotor activity and dopamine release in rats.

Associations between drugs of abuse and cues facilitate the acquisition and maintenance of addictive behaviors. Although significant research has been done to elucidate the role that simple discriminative or discrete conditioned stimuli (e.g., a tone or a light) play in addiction, less is known about complex environmental cues. The purpose of the present study was to examine the role of a musical conditioned stimulus by assessing locomotor activity and in vivo microdialysis. Two groups of rats were given non-contingent injections of methamphetamine (1.0 mg/kg) or vehicle and placed in standard conditioning chambers. During these conditioning sessions both groups were exposed to a continuous conditioned stimulus, in the form of a musical selection ("Four" by Miles Davis) played repeatedly for 90 min. After seven consecutive conditioning days subjects were given one day of rest, and subsequently tested for locomotor activity or dopamine release in the absence of drugs while the musical conditioned stimulus was continually present. The brain regions examined included the basolateral amygdala, nucleus accumbens, and prefrontal cortex. The results show that music is an effective contextual conditioned stimulus, significantly increasing locomotor activity after repeated association with methamphetamine. Furthermore, this musical conditioned stimulus significantly increased extracellular dopamine levels in the basolateral amygdala and nucleus accumbens. These findings support other evidence showing the importance of these brain regions in conditioned learning paradigms, and demonstrate that music is an effective conditioned stimulus warranting further investigation.

Fern Distortion Syndrome of Leatherleaf Fern in Costa Rica: Symptoms, Incidence, and Severity.

A syndrome has been recognized on leatherleaf fern (Rumohra adiantiformis) in Costa Rica for many years that causes widespread damage but has not been described in the literature. A full description of the syndrome, termed fern distortion syndrome (FDS), is reported here, along with evidence that FDS is a new disease and that it is associated with endophytic fluorescent pseudomonads but not with any other major groups of pathogens or pests. The main aboveground symptoms of FDS are twisting and distortions of fronds, which make the fronds unmarketable. In advanced cases of FDS, fronds are often thickened, new frond growth ceases or slows dramatically, and uneven sporulation is apparent on the underside of fronds. Symptoms of FDS belowground are reduced diameter of rhizomes and reduced overall root mass. The incidence of FDS in Costa Rica was typically over 80%, and severity typically ranged from 1.26 to 2.48 using a 0 to 3 rating scale in fields propagated vegetatively with rhizomes from fields with FDS. In contrast, in three fields planted 1.5 to 4 years previously with rhizomes derived from tissue culture, incidence and severity were markedly lower: 23 to 34% and 0.24 to 0.36, respectively. Paired sampling of symptomatic and asymptomatic plants revealed significantly greater populations of fluorescent pseudomonads inside rhizomes of symptomatic plants.

Laboratory evaluation of products to reduce settling of sweetpotato whitefly adults.

The impact of trademarked and commercial products on settling of adults of the sweetpotato whitefly, Bemisia tabaci (Gennadius), was studied in the laboratory. A no-choice bioassay using leaf disks of tomato, Solanum esculentum L., was developed to evaluate the impact of concentration series of products on settling of B. tabaci adults. The concentration of each product that would reduce settling by 50% (SC50) was estimated for each product using standard probit analyses, and the values were compared with that of Ultra-Fine Oil, a paraffinic oil product that is known to reduce settling of whitefly adults. Twenty-two trademarked products and 42 other products were evaluated in the laboratory bioassay. Based upon comparisons of fiducial limits of the respective SC50 values, Dawn detergent and E-RASE jojoba oil were the only trademarked products that were as effective as Ultra-Fine Oil in reducing settling of B. tabaci adults. Of the nontrademarked products, 25 were similar to Ultra-Fine Oil, although cedar, geranium, ginger, Hamlin (citrus), patchouli, olive and wintergreen oils, as well as citronellal and limonene, had ratios of respective SC50 values with that of Ultra-Fine Oil of approximately 1.5 or less. Combinations of limonene and citronellal with either olive oil or Ultra-Fine Oil were 15 and 30 times, respectively, more effective than Ultra-Fine Oil alone. Candidate products and combinations of products were further evaluated on tomato seedlings in no-choice screenhouse trials for effects on oviposition and on transmission of Tomato yellow leaf curl virus (family Geminiviridae, genus Begomovirus, TYLCV) by B. tabaci. Ultra-Fine Oil and olive oil reduced oviposition and transmission of TYLCV in the screenhouse trials. Ginger oil and limonene reduced oviposition in at least one screenhouse trial but did reduce transmission of TYLCV. The laboratory bioassay provided a rapid and relatively easy method to compare products for reducing settling of B. tabaci adults. Even though the reduced settling indicated in the laboratory bioassays was not always reflected in reduced oviposition or TYLCV transmission in the screenhouse trials, the bioassay was useful in rapidly identifying products that reduce settling and that could be investigated further.

Rapid host adaptation by extensive recombination.

Experimental investigations into virus recombination can provide valuable insights into the biochemical mechanisms and the evolutionary value of this fundamental biological process. Here, we describe an experimental scheme for studying recombination that should be applicable to any recombinogenic viruses amenable to the production of synthetic infectious genomes. Our approach is based on differences in fitness that generally exist between synthetic chimaeric genomes and the wild-type viruses from which they are constructed. In mixed infections of defective reciprocal chimaeras, selection strongly favours recombinant progeny genomes that recover a portion of wild-type fitness. Characterizing these evolved progeny viruses can highlight both important genetic fitness determinants and the contribution that recombination makes to the evolution of their natural relatives. Moreover, these experiments supply precise information about the frequency and distribution of recombination breakpoints, which can shed light on the mechanistic processes underlying recombination. We demonstrate the value of this approach using the small single-stranded DNA geminivirus, maize streak virus (MSV). Our results show that adaptive recombination in this virus is extremely efficient and can yield complex progeny genomes comprising up to 18 recombination breakpoints. The patterns of recombination that we observe strongly imply that the mechanistic processes underlying rolling circle replication are the prime determinants of recombination breakpoint distributions found in MSV genomes sampled from nature.

Cucurbit leaf crumple virus Identified in Common Bean in Florida.

Virus-like symptoms of leaf deformation and rugosity, especially of younger leaves, and a mild mosaic were observed on fresh market common (green) bean (Phaseolus vulgaris L.) plants in Hendry County in southwest Florida in December of 2007 and again in February of 2008. All bean fields were adjacent to watermelon fields in which Cucurbit leaf crumple virus (CuLCrV), Squash vein yellowing virus (SqVYV), and Papaya ringspot virus type W (PRSV-W) infections had previously been confirmed (fall of 2007) by PCR, reverse transcription (RT)-PCR, and/or ELISA. Whiteflies, Bemisia tabaci, were observed on both bean and watermelon plants in December and February. Fifteen samples (eleven with symptoms) were collected in December and two (both with symptoms) in February. Initial ELISA assays using commercially available antisera for potyviruses or Cucumber mosaic virus (Agdia, Elkhart, IN) were negative. Total nucleic acids were extracted and used for PCR testing. All samples tested negative by RT-PCR using specific primers for SqVYV, PRSV-W, and Cucurbit yellow stunting disorder virus, and degenerate primers for potyviruses. Ten of fifteen December samples (ten of eleven symptomatic samples) and both February samples yielded PCR products of the expected size with the degenerate begomovirus primers, PAR1c496/PAL1v1978, which amplify a portion of the begomovirus A component (3). PCR products from three December and both February samples were cloned and sequenced. The 1,159-nt PCR products shared 99% identity with each other and 96% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF256200 and AF224760, respectively). Additional degenerate begomovirus primers PBL1v2040/PCRc154, which amplify a 381-nt portion of the hypervariable region of the begomovirus B component (3), and AC1048/AV494, which amplify a 533-nt portion of a conserved region of the coat protein gene (4), were used to confirm the identity of CuLCrV in the three December samples. The PBL1v2040/PCRc154 PCR products shared 98 to 99% identity with each other and 94 to 95% identity with the corresponding region of B component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF327559 and AF224761, respectively), whereas the AC1048/AV494 PCR products shared 99% identity with each other and 97% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates. Nucleic acid dot-blot hybridization assays of sap from homogenized leaves of the three December samples (from which the PCR product clones were obtained) with a digoxigenin-labeled CuLCrV cDNA probe also confirmed the presence of CuLCrV. Although CuLCrV has been reported to experimentally infect common bean and tobacco (2), to our knowledge, this is the first report of CuLCrV infecting any noncucurbit host in Florida. This finding suggests that CuLCrV may be more widely distributed than previously known in Florida (1) and that common bean (and potentially other legumes) are potential reservoirs for CuLCrV. References: (1) F. Akad et al. Plant Dis. 92:648, 2008. (2) J. K. Brown et al. Phytopathology 92:734, 2002. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

First Report of Cucurbit yellow stunting disorder virus in Cucurbits in Florida.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5' TTTGGAAAAGAACCTGACGAG 3'; CysCP5600R 5' TTCATCAACAGATTGGCTGC 3') and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production. References: (1) F. Akad et al. Plant Dis.92:648, 2008. (2) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Detection of Cucurbit leaf crumple virus in Florida Cucurbits.

In October of 2006, yellow straightneck and zucchini squash plants (Cucurbita pepo L.) with crumpled, curled, thickened leaves were found in St. Johns and Marion counties in central Florida, respectively. Both locations had high populations of the whitefly, Bemisia tabaci. Incidences of symptomatic plants were greater than 95% in three squash fields (33 ha total) in St. Johns County and 35% in an experimental plot in Marion County. Twenty-three samples were collected from symptomatic plants (two from St. Johns County and 21 from Marion County). DNA was extracted for PCR and tested for the presence of begomoviruses using the following pairs of degenerate primers: AC1048/AV494, which amplifies a conserved region of the coat protein gene (2), PAR1c496/PAL1v1978, which amplifies a region of the begomovirus A component, and PBL1v2040/PCRc154, which amplifies a hypervariable region of the begomovirus B component (1). All squash samples yielded amplicons of sizes expected for a bipartite begomovirus: 1,159 nt with PAR1c496/PAL1v1978, 550 nt with AC1048/AV494, and 493 nt with PBL1v2040/PCRc154. The 1,159- and 493-nt amplicons obtained from two squash plants were cloned and sequenced. The 1,159 nt sequences from both plants shared 98% sequence identity with each other and 97% identity with equivalent regions of the A component of Cucurbit leaf crumple virus (CuLCrV) from Arizona and California (GenBank Accession Nos. AF256200 and AF224760, respectively). The 493-nt sequences amplified with PBL1v2040/PCRc154 were identical and shared a 96% identity with CuLCrV sequence (GenBank Accession No. AF327559) from Arizona and 97% identity with CuLCrV B component sequence (GenBank Accession No. AF224761) from California. Leaves were collected from eight symptomatic squash plants from Citra, FL and used for whitefly transmission assays. Approximately 100 adults of Bemisia tabaci biotype B were released onto each caged leaf and given a 24-h acquisition access period, after which a healthy squash seedling was introduced. Symptoms developed within 10 days on all test plants, and the presence of CuLCrV was confirmed by PCR assays, (primer pairs PAR1c496/PAL1v1978 and PBL1v2040/PCRc154) followed by sequencing. In 2007, similar symptoms were seen in several locations around the state. The same assays confirmed the presence of CuLCrV in watermelon (Citrullus lanatus L.) and squash in the following counties: Collier and Hendry in southwest Florida and Hillsborough, Manatee, and Sarasota in west-central Florida. To our knowledge, this is the first report of CuLCrV, and the first report of any begomovirus in cucurbits in Florida. References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Identification of Tomato yellow leaf curl virus and Tomato mottle virus in Two Counties in Alabama.

During July 2005, approximately 23% of tomato plants (Solanum lycopersicum L. 'Sebring') in a commercial field in St. Clair County, Alabama showed symptoms of stunting, leaf deformation, mottling, and reduced leaf size, which resembled symptoms of Tomato yellow leaf curl virus (TYLCV). A high population of whiteflies (Bemisia tabaci) was observed in this field, and as the season progressed, 100% of the plants became symptomatic. During October 2006, similar symptoms in tomato were observed at low incidences (less than 10%) in a commercial greenhouse in Jefferson County. Two samples from St. Clair County and six from Jefferson County were collected and tested for the presence of a begomovirus by PCR using three pairs of primers, PAR1c496 and PAL1v1978, a degenerate primer pair designed to amplify regions of the begomovirus A component, PBL1v2040 and PCRc154, a degenerate primer pair that amplifies a hypervariable region of the begomovirus B component (3), and C473 and PTYC1v2406, which are specific to TYLCV (1,2). Primer pair PAR1c496 and PAL1v1978 produced two amplicons (1,360 and 1,159 bp) in all samples tested, which suggests the presence of a monopartite and bipartite begomovirus. Primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that would be consistent with the presence of a bipartite begomovirus. Primer pair C473 and PTYC1v2406 produced an 850-bp amplicon that would be consistent with the presence of TYLCV. Sequence analysis revealed that the 1,360-bp amplicon had 98% sequence identity to isolates of TYLCV from Cuba (GenBank Accession No. AJ223505), the Dominican Republic (GenBank Accession No. (AF04715), Florida (GenBank Accession Nos. AF260331 and AY530931), Egypt (GenBank Accession No. AY594174), and Almeria (GenBank Accession No. AJ489258). The 1,159-bp amplicon had a 97 to 99% sequence identity to the A component of Tomato mottle virus (ToMoV) Florida (GenBank Accession Nos. L14460, EF028241, and M90495) and Puerto Rico (GenBank Accession No. AY965900). Each of the eight tomato samples were shown to be infected with TYLCV and ToMoV. Symptoms of plants infected with both viruses resembled those of TYLCV because the milder symptoms of ToMoV are masked in the field by the more severe symptoms of TYLCV. To our knowledge, this is the first report of ToMoV and TYLCV in the state of Alabama. Reference: (1) M. Ghanim et al. Virology 240:295, 1998. (2) M. K. Nakhla et al. Phytopathol. Mediterr. 32:163, 1993. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California.

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5'-GGATCCACTTCTAAATGAATTTCCTG-3' and TYBamHI2c: 5'-GGATCCCACATAGTGCAAGACAAAC-3'), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

Capsicum Species: Symptomless Hosts and Reservoirs of Tomato yellow leaf curl virus.

ABSTRACT Five Capsicum species were tested for susceptibility to Tomato yellow leaf curl virus (TYLCV) and the mild strain of TYLCV (TYLCV-Mld). TYLCV was able to infect 30 of 55 genotypes of C. annuum, one of six genotypes of C. chinense, one of two genotypes of C. baccatum, and the only genotype of C. frutescens tested but was unable to infect the one genotype of C. pubescens tested. This is the first evidence for the susceptibility of C. baccatum, C. chinense, and C. frutescens to TYLCV. Unlike TYLCV isolates, TYLCV-Mld was unable to infect C. chinense. No host differences were observed between the Israeli and Florida isolates of TYLCV. None of the Capsicum species showed symptoms after infection with TYLCV or TYLCV-Mld. TYLCV was detected in fruits of C. annuum, but whiteflies were unable to transmit virus from fruits to plants. White-flies were able to transmit both TYLCV and TYLCV-Mld from infected pepper plants to tomato plants. Pepper plants in research plots were found infected with TYLCV at rates as much as 100%. These data demonstrate the ability of some genotypes of pepper to serve as reservoirs for the acquisition and transmission of TYLCV and TYLCV-Mld.