Analysis of the biological and molecular variability of the Polish isolates of Tomato black ring virus (TBRV).

Tomato black ring virus (TBRV) is an important pathogen infecting many plant species worldwide. The biological and molecular variability of the Polish isolates of TBRV was analyzed. The analysis was performed based on the symptoms induced by various isolates on test plant species as well as on phylogenetic relationships between isolates. Isolates differed in their host range and symptomatology. In addition, genetic variation among isolates was characterized by restriction fragment length polymorphism analysis and confirmed by sequencing. The phylogenetic analysis revealed that the Polish isolates differ from each other and do not form a monophyletic cluster. Finally, we identified and analyzed sequences of defective RNA forms arising from the TBRV genome.

First Report of 'Candidatus Phytoplasma asteris' Associated with Oilseed Rape Phyllody in Poland.

Winter oilseed rape (Brassica napus L.) is widely grown in Poland to produce vegetable oil for industrial processing of human and animal feed. In recent years, according to European Union directives on the use of biofuels (Directive 2003/30/EC), the area under oilseed rape cultivation in Poland has dramatically increased to 810,000 ha in 2009 and is still increasing. Morphological deformations of winter oilseed rape indicative of phytoplasma infection have been observed sporadically in Poland since 2000 (3). Plants exhibiting floral virescence, phyllody, as well as auxiliary bud proliferation, reduced leaves, and malformation of siliques were identified during surveys of research fields in Wielkopolska during May and June of 2009 and 2010. To confirm phytoplasma infection of these plants, inflorescence and leaf tissues were collected from nine diseased and three symptomless plants from three different field locations with 1 to 16% disease incidence. Total DNA was extracted from each plant tissue sample with a modified cetyltrimethylammoniumbromide method (2). Samples were analyzed for phytoplasma DNA with a nested PCR assay employing phytoplasma universal rRNA operon primer pair P1/P7 followed by R16F2n/R16R2, using previously described conditions (1). PCR products of 1.8 and 1.2 kb were obtained from all diseased plants only following PCRs with P1/P7 and nested primer pair R16F2n/R16R2, respectively. PCR products were not obtained from symptomless plants. Eight 1.2-kb amplicons were sequenced (GenBank Accession Nos. JN193475 to JN193482). Comparative analysis of the R16F2n/R16R2 rDNA sequences confirmed the phytoplasma origin of the rDNA sequences that shared 100 to 99% identity with Maize bushy stunt phytoplasma (GenBank Accession No. HQ530152), Alfalfa stunt phytoplasma (GenBank Accession No. GU289675), Primula green yellows phytoplasma (GenBank Accession No. HM590623), and other aster yellows group phytoplasmas. A 1.8-kb amplicon of isolate designated RzW14 was sequenced (GenBank Accession No. HM561990) and had 99% identity with Aster yellow group phytoplasmas from Lithuania (GenBank Accession Nos.GU223208 and AY744071). A virtual restriction fragment length polymorphism analysis of the 16S rDNA sequences from the R16F2n/R16R2 amplicons was performed with iPhyClassifier (4). Restriction profile comparisons identified all aster yellows group phytoplasmas as subgroup 16SrI-B strains. To our knowledge, this is the first report of a 'Candidatus Phytoplasma asteris'-related strain infecting oilseed rape in Poland. References: (1) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) A. C. Padovan et al. Aust. J. Grape Wine Res. 1:25, 1995. (3) M. Starzycki and E. Starzycka. Oilseed Crops 21:399, 2000. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

La France disease of the cultivated mushroom Agaricus bisporus in Poland.

Presence of the virus associated with La France disease was confirmed in the mushrooms collected from different farms located in Western Poland. Double-stranded RNA (dsRNA) was isolated from the mushrooms exhibiting a wide range of the disease symptoms including premature veil opening, brown-colored mushrooms, and loss of crop yield. The presence of dsRNA molecules (M1, M2, and L3) was confirmed by RT-PCR and sequencing. Furthermore, La France isometric virus (LFIV)-like particles were observed in the mushrooms extracts in electron microscopy. The LFIV infection was found in 120 of 200 mushroom samples tested. The amount of the infected samples indicated the high occurrence of La France disease that could be a threat to the mushroom industry in Poland.

First Report of Potato mop-top virus on Potato in Poland.

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Lódz County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

First Report of Papaya ringspot virus Infecting Zucchini Plants in Poland.

Papaya ringspot virus (PRSV), a member of the aphid-transmitted genus Potyvirus, is the cause of a destructive disease and a major limiting factor for papaya and cucurbit cultivation worldwide. The virus occurs in China, France, Germany, India, Italy, Mexico, Taiwan, and the United States. Its P biotype is a devastating pathogen of papaya crops and its W biotype is a pathogen of cucurbits (4). In 2009, zucchini plants with leaf mosaic and marbled fruit were collected from the Kujawsko-Pomorskie Region of Poland. Samples came from the same region where Zucchini yellow mosaic virus (ZYMV) (3) and Watermelon mosaic virus (WMV) (1) have been found previously. Forty leaf and ten fruit samples of zucchini (Cucurbita pepo cv. giromontina) were tested by double-antibody sandwich (DAS)-ELISA with commercial antisera against WMV, ZYMV, and PRSV (DSMZ, Braunschweig, Germany). PRSV was found in two samples tested. Leaf extracts from infected plants were mechanically inoculated onto Carborundum-dusted leaves of the following indicator plants: Cucumis sativus, Chenopodium quinoa, Cucurbita pepo, Nicotiana benthamiana, and N. tabacum cv. Xanthi. After 2 weeks, symptoms of leaf chlorosis on cucumber and chlorotic lesions on zucchini were observed. Total RNA was extracted from infected leaves with a phenol-chloroform based extraction procedure. The presence of PRSV was confirmed by reverse transcription (RT)-PCR reaction using primers 04-02 and 04-04, which amplify the coat protein gene (2). Amplified DNA was gel purified with a Qiaex Kit (Qiagen, Valencia, CA) and cloned into pGEM-T easy (Promega, Madison, WI). Overlapping sequences were obtained using universal M13F and M13R primers. BioEdit software ( http://www.mbio.ncsu.edu/BioEdit/bioedit.html ) was used to assemble the nucleotide consensus sequence. The obtained sequence (861 bp encoding 287 amino acids) was deposited in the GenBank database under Accession No. GQ927328. The comparison with PRSV sequences retrieved from the GenBank database were carried out to investigate the genetic diversity between Polish PRSV isolates and establish their molecular relationships to the previously characterized PRSV isolates from different parts of the world. The sequences of PRSV Polish isolates obtained from two infected plant samples were identical. Comparisons revealed that the Polish isolate designated PRSV-BON shared the highest identity (97%) with three Australian isolates (U14739, U14740, and U14744). To our knowledge, this is the first report of PRSV infecting zucchini plants in Poland. The occurrence of subtropic viruses like PRSV in Poland indicated the introduction of new pathogens that likely affect cucurbit production in this country and beyond. References: (1) N. Borodynko et al. Plant Pathol. 58:783, 2009. (2) M. Chin et al. Arch. Virol. 152:2101, 2007. (3) H. Pospieszny et al. Plant Dis. 91:639, 2007. (4) D. J. Purcifull et al. CMI/AAB Descriptions of Plant Viruses. No. 292, 1984.

First Report of Cucumber mosaic virus on Lavandula angustifolia in Poland.

Lavandula angustifolia Mill. (synonym Lavandula officinalis Chaix), belonging to the Lamiaceae family, is a plant that is widespread in Mediterranean countries. The species is widely grown as an ornamental crop in Poland. Currently, only Alfalfa mosaic virus (AMV) is known to infect L. latifolia × L. officinalis in Italy (3). In the spring of 2005, we observed yellow mottling, leaf deformation, and growth reduction of L. angustifolia plants from the Agricultural Academy of Kraków collection of medicinal herbs and spices. Mechanical inoculation of a range of indicator plant species, Chenopodium quinoa, Cucumis sativus, Datura strammonium, Nicotiana glutinosa, N. tabacum cv. Xanthi, Lycopersicon esculentum, and Spinacia oleracea, with sap from symptomatic L. angustifolia plants resulted in symptoms typical of Cucumber mosaic virus (CMV). Chlorotic local lesions and systemic mosaic were observed after a few days on the tested plant species. However, local lesions did not develop on inoculated C. sativus cotyledons. A lack of systemic infection on Chenopodium quinoa excluded infection by AMV. The sap from symptomatic N. tabacum cv. Xanthi leaves contained spherical virus particles of 29 nm in diameter when examined with electron microscopy. Symptomatic N. tabacum cv. Xanthi leaves were positive for CMV in a double-antibody-ELISA using commercial CMV antiserum (Loewe Biochemica GmbH, Sauerlach, Germany). Total RNA was extracted from infected N. tabacum cv. Xanthi plants by the phenolchloroform method. Reverse transcription-PCR was carried out using specific primers CMVF 5'-CCCACAGGTAGAATCAAAT-3' and CMVR 5'-ATGGACAAATCTGAATCAAC-3' (1). The 367-bp amplicon representing a portion of the coat protein gene located in RNA3 was cloned into pGEM-T Easy Vector (Promega, Madison, WI) and two clones were sequenced. The fragment sequence (Accession No. EU303304) was compared with homologous sequences of CMV isolates from the GenBank database. Multiple sequence alignment was performed by using Mega 4 (Center for Evolutionary Functional Genomics, Tempe, AZ) (4) and revealed 99% nucleotide and amino acid identity between the Polish isolate of CMV-PL and the RT67 (subgroup II) isolate from the Netherlands (2) To our knowledge, this is the first report on the occurrence of CMV on Lavandula angustifolia Mill. in Poland or worldwide. References: (1) N. Borodynko et al. Prog. Plant Protect. 44:604, 2004. (2) Z. Deyong et al. J Virol. Methods 123:101, 2005. (3) L. Giunchedi et al. Phytopathol. Mediterr. 11:74, 1972. (4) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007.

First Report of a Phytoplasma Affecting Tomato in Poland.

During 2006, two tomato plants exhibiting dwarfing, twisting of shoots and leaves, and virescence and phyllody of flowers were observed in a greenhouse in western Poland. Total genomic DNA was extracted from approximately 3.5 g of leaf midribs and petioles using the modified cetyltrimethylammoniumbromide (CTAB) buffer method (3). Direct PCR was done with universal phytoplasma primers P1/P7 for amplification of ribosomal 16S rDNA. The PCR product (1.8 kb) was diluted 1:30 with sterile distilled water and used as DNA template for nested PCR with primers R16F2n/R16R2 (1). The final product was an expected 1.2-kb rDNA fragment amplified from infected tomato tissues. The DNA extracted from a Vinca sp. infected with phytoplasma of 16SrI-B subgroup and from a healthy tomato plant were used as positive and negative assay controls, respectively. Restriction fragment length polymorphism analysis of the final PCR product (1.2 kb) using enzymes MseI, KpnI, AluI, HhaI, HpaII, RsaI, TaqI, and TruI (1) indicated that phytoplasma from the tomato belonged to the subgroup 16SrI-C (1,2). The sequence obtained from the final PCR product (746 bp) was deposited in the GenBank database under accession number EF164961. Multiple sequence alignments with sequences of phytoplasma available from GenBank were performed using ClustalW software. The analysis revealed that the Polish isolate was co-identical (100%) to two phytoplasma sequences (GenBank Accession Nos. AY839617 and DQ078304) that belong to 16SrI-C subgroup. To our knowledge, this is the first report of a phytoplasma affecting tomato plant in Poland. References: (1) I.-M. Lee et al. Inst. J. Syst. Bacteriol. 48:1153, 1998. (2) I.-M. Lee et al. Cell-wall free bacteria. Page 283 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et a.l, eds. The American Phytopathology Society, 2001. (3) A. C. Padovan et al. Austral. J. Grape Wine Res. 1:25, 1995.

The First Report of Tomato torrado virus in Poland.

In 2003 and 2004, unusual disease symptoms, including severe stunting, malformation, and necrosis of the leaves on tomato cv. Grace, were observed in the Wielkopolska Region of Poland. The disease appeared to be associated with the presence of the greenhouse whitefly Trialeurodes vaporariorium. An electron microscopic examination of a negatively stained leaf-dip preparation from an infected plant showed the presence of spherical virus particles approximately 25 to 28 nm in diameter. The virus (designated Wal'03) was shown to be vectored efficiently (100%) by T. vaporariorium and poorly (50 to 70%) by mechanical transmission to tomato. Mechanical inoculation or whitefly transmission caused systemic infection on Nicotiana tabacum (cvs. Xanthi nc, Samsun, and White Burley), N. benthamiana, N. clevelandii, N. debneyi, N. affinis, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, Capsicum annuum, Nicandra physaloides, Physalis floridana, and Solanum tuberosum. The virus did not infect Phaseolus vulgaris, Pisum sativum, Cucumis sativus, Chenopodium quinoa, or Beta vulgaris. Partially purified virus preparations from N. bethamiana or N. tabacum cv. Xanthi centrifuged in a sucrose density gradient sedimented as two separated zones. Viral RNA was extracted from the purified viral preparations with phenol-chloroform, and analysis by denaturing agarose gel electrophoresis revealed RNA 1 (approximately 7,800 bp) and RNA 2 (approximately 5,400 bp). The biological properties and the genomic RNA composition showed significant similarities to that of Tomato necrotic dwarf virus (ToNDV) described from California (1) and the newly identified Tomato torrado virus (ToTV) in Spain (2). Immuno-specific electron microscopy (ISEM) showed Wal'03 virus particles reacted with ToNDV antiserum (provided by W. Wintermantel, Salinas, CA). The genomic sequence of ToTV (GenBank Accession Nos. DQ388879 and DQ388880) was used to design specific primers for analysis by reverse transcription (RT)-PCR: TR1F (5' CAATGTGCCAAAGATGAGCG 3'), TR1R (5' ACTCCCGTGTCTATGTTTTC 3'), TR2F (5' GAAGGACGAAGAGCGACTG 3'), and TR2R (5' AAGGTAGGTATGCGTTTGC 3'), which amplified products of 573 and 892 bp for RNA 1 and RNA 2, respectively. These RT-PCR fragments from Wal'03 were sequenced (GenBank Accession Nos. EF635007 and EF635008) and comparisons with ToTV showed 99 and 98% nucleotide identity for RNA1 and RNA2, respectively. Immunocapture-RT-PCR with leaf tissue from N. benthamiana infected by Wal'03, antiserum against ToNDV, and ToTV-specific primers TR2F and TR2R produced a fragment of the expected size. Sequence of this product showed 100% identity with previously obtained RT-PCR fragments. The similarity of the symptoms on tomato plants, the morphology of virus particles, genome composition and nucleotide sequence identities suggest that Wal'03 and ToTV are the same. References: (1) R. C. Larsen et al. Phytopathology 74:795, 1984. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007.

A Polish Isolate of Zucchini yellow mosaic virus from Zucchini is Distinct from Other European Isolates.

Zucchini yellow mosaic virus (ZYMV) is a member of the Potyvirus genus in the Potyviridae family, the largest group of plant viruses. Different isolates of this virus have been found in infected cucurbits throughout the world, including localities in Europe, America, Australia, and Asia. In August 2005, mosaic and yellowing of leaves, as well as yellow spots on green fruits, were observed on zucchini (Cucurbita pepo cv. giromontiina) growing in commercial fields in the Kujawsko-Pomorskie Region of Poland. Flexuous virus particles (~750 nm long), typical of potyviruses, were observed in leaf-dip preparations from symptomatic zucchini plants. The virus in the sap from symptomatic plants was mechanically transmitted and systemic infections were produced on Citrullus lanatus, Cucumis melo, Cucumis sativus, C. pepo cvs. giromontiina and patissoniana, C. maxima, and Nicotiana benthamiana. Severe symptoms such as severe malformation of leaves and stunting of plants were observed on zucchini plants (cv. giromontiina) infected mechanically with the virus and grown in the greenhouse. Double-antibody sandwich (DAS)-ELISA using an anti-ZYMV polyclonal antiserum (AS-0234; DSMZ, Braunschweig, Germany) identified the presence of ZYMV in mechanically infected C. pepo cv. giromontiina and N. benthamiana plants. Subsequently, a reverse transcription (RT)-PCR using a universal primer, Sprimer, designed from the consensus sequences that code for the conserved sequence GNNSGQP in the NIb region of Potyviridae family members and the M4 primer was performed (1). The 1740-bp PCR fragments were cloned into the pGEM-T vector (Promega, Madison, WI) and three randomly selected clones were sequenced on an ABI automatic sequencer. An 837-bp sequence representing the full length coat protein gene (GenBank Accession No. EF178505) was compared with homologous sequences from other ZYMV isolates using BioEdit and Mega 3.1 softwares. Genetic distances were calculated by Kimura's two-parameter method (2). Surprisingly, the Polish ZYMV isolate (ZYMV-Zug) was more closely related to ZYMV isolates from Asia than those from Europe. Pairwise comparisons of ZYMV-Zug with several other European ZYMV isolates (GenBank Accession Nos. DQ645729, AJ420020, AJ459956, AJ420014, AJ420019, DQ124239, and AJ420018) indicated an 81 to 82% nucleotide and 91 to 92% amino acid identity, while there was a 94% nucleotide and 99% amino acid identity with the Shanxi (GenBank Accession No. AY074808) and Shandong isolates (GenBank Accession No. AF513552) from China. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) S. Kumar et al. Brie. Bioinform. 5:150, 2004.

New Polish Isolate of Pepino mosaic virus Highly Distinct from European Tomato, Peruvian, and US2 Strains.

Pepino mosaic virus (PepMV, genus Potexvirus) was first described on pepino (Solanum muricatum) in Peru during 1980. Since 1999, the virus was reported in several European countries and in North and South America as an agent of viral disease of tomato crops. In Poland in 2002, the PepMV-SW isolate that was genetically similar to European isolates (approximately 99% identity) was identified (3). In November 2005, in the western part of the Wielkopolska Region, a virus with flexuous filamentous particles approximately 500 nm long was isolated from tomato fruits exhibiting symptoms of discoloration. Crude sap from Nicotiana benthamiana leaves was used for mechanical inoculation of indicator plants. The virus caused symptoms on N. benthamiana, N. clevelandii, Datura inoxia, and Lycopersicon esculentum. Symptomless infection on N. tabacum cv. Xanthi nc, N. tabacum cv. White Burley, and N. debneyi was confirmed by back-inoculation on N. benthamiana. The virus did not infect N. glutinosa, Physalis floridana, Petunia hybrida, Capsicum annuum, Chenopodium quinoa, Cucumis sativus, or Phaseolus vulgaris. The virus was initially identified using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with polyclonal antiserum against PepMV (DSMZ, Braunschweig, Germany). Positive serological reactions were obtained with sap from inoculated N. benthamiana, L. esculentum, and N. clevelandii plants. The serological identification was confirmed using a reverse transcription-polymerase chain reaction (RT-PCR) with primers generated from a sequence of the RNA polymerase region of an isolate of PepMV reported in the United Kingdom (1). Sequence information obtained from the amplified fragment of the virus designated PepMV-PK (GenBank Accession No. DQ387870), showed only 81% nt identity and 89% amino acid identity with PepMV-SW (GenBank Accession No. DQ387869). PepMV isolates can be divided into three strains including European tomato, Peruvian, and US2 based on their genetic diversity (2). The PepMV-PK isolate resulted in nucleotide identities ranging from 79 to 81% with isolates of the European tomato strain (GenBank Accession Nos. AJ438767, AF340024, AF484251, AJ271991, AJ606359, and AJ290424), 81% with the Peruvian strain (GenBank Accession Nos. AM109896 and AJ606361), and 78% identity with each of the U.S. isolates US1 (GenBank Accession No. AY509926) and US2 (GenBank Accession No. AY509927). These results show that the new Polish isolate is distinct from all other PepMV isolates reported to date. References: (1) C. J. French et al. Plant Dis. 85:1121, 2001. (2) L. Pagan et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Phytopathol. Pol. 26:91, 2002.

First Report of Beet soilborne virus in Poland.

Beet necrotic yellow vein virus (BNYVV), the casual agent of rhizomania disease, was identified in sugar beet plants from several fields in the Wielkopolska Region of Poland (1). In greenhouse studies, sugar beets were grown in the soil from one of these fields to bait soilborne viruses. Of 200 sugar beet plants, three developed symptoms of vein clearing, vein banding, and mosaic. Crude sap from symptomatic plants was used for mechanical inoculation of various plants species. In Chenopodium quinoa, C. amaranticolor, and Tetragonia expansa only local lesions were observed. Electron microscope examination of negatively stained leaf-dip preparations from symptomatic sugar beet plants showed a mixture of rod-shape particles from 70 to 400 nm long. Using double-antibody sandwich enzyme-linked immunosorbent assay tests, two symptomatic sugar beet plants gave positive reactions with antiserum against BNYVV (Bio-Rad, Hercules, CA) and a third plant gave a positive reaction with antisera against BNYVV and Beet soilborne virus (BSBV). Total RNA was extracted from roots and leaves of the symptomatic plants and used in a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) assay. Specific primers were designed to amplify a fragment of the RNA1 for BSBV and RNA2 for BNYVV and Beet virus Q (BVQ) (2). Two mRT-PCR products amplified with the primers specific to BNYVV and BSBV were obtained and sequenced. A 274-nt amplicon sequence (GenBank Accession No. DQ012156) had 98% nucleotide sequence identity with the German BNYVV isolate F75 (GenBank Accession No. AF19754) and a 376-nt amplicon sequence (GenBank Accession No. AY999690) had 98% nucleotide and 98% amino acid sequence identity with the German BSBV isolate (GenBank Accession No. Z97873). The Polish BSBV isolate had 88% nucleotide and 62% amino acid sequence identity with BVQ, another pomovirus (GenBank Accession No. AJ 223596 formerly known as serotype Wierthe of BSBV (2). In 2005, mRT-PCR was used on samples collected from two fields of the Wielkopolska Region. Of 15 tested sugar beet plants, 12 gave positive reactions with primers specific for BSBV and nine with primers specific to BNYVV. To our knowledge, this is first report of BSBV in Poland. In Europe, BSBV was previously reported in England, the Netherlands, Belgium, Sweden, Germany, France, and Finland (2,3). References: (1) M. Jezewska and J. Piszczek. Phytopathol. Polonica, 21:165, 2001. (2) A. Maunier et al. Appl. Environ. Microbiol. 69:2356, 2003. (3) C. M. Rush and G. B. Heidel. Plant Dis. 79:868, 1995.

Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

First Report of Cucumber leaf spot virus in Poland.

During April 2003, four young cucumber plants with slight stunting and delay of flowering were found in two commercial greenhouses in the Wielkopolska Region in Poland. Sporadically, chlorotic spots, sometimes with necrotic centers, were observed on the leaves of plants. Later, symptoms were less recognizable or they disappeared completely. Crude sap from symptomatic leaves of Cucumis sativus was used for mechanical inoculation of various plant species. The virus caused local and systemic infections on Cucumis sativus, Nicotiana benthamiana, and N. clevelandii and induced local necrotic lesions only on Chenopodium quinoa, C. amaranticolor, C. ficifolium, C. murale, Petunia hybrida, Cucurbita melo, Zinnia elegans, and Spinacia oleracea. No symptoms were seen in inoculated N. tabacum, N. glutinosa, Lycopersicon esculentum, Capsicum annuum, Physalis floridana, Phaseolus vulgaris, and Cucurbita pepo. Symptoms and host range were similar to those described for infection by Cucumber leaf spot virus (CLSV) (1). Electron microscopic examination of negatively stained leaf-dip preparation from infected plants showed spherical virus particles (approximately 30 nm). Total RNA extracted from symptomatic C.sativus and N. benthamiana plants, and RNA extracted from purified virus preparations were tested using reverse transcription-polymerase chain reaction (RT-PCR) with specific primers designed to amplify a fragment of the RNA-dependent RNA polymerase gene (4). RT-PCR products were sequenced with CEQ DTCS dye terminator cycle sequencing kit and the CEQ 2000 DNA Analysis System (Beckman Coulter, Inc., Fullerton, CA). The 664-nt amplicon sequence (GenBank Accession No. AY571334) had 95% nucleotide and 98% amino acid sequence identity with the Spanish CLSV isolate (GenBank Accession No. AY038365) (4) and 98 and 99% identity, respectively, with another CLSV isolate (3). The nucleic acid sequence of the Polish CLSV isolate was 81 to 84% identical to the equivalent region of two isolates of Pothos latent virus, another aureusvirus (GenBank Accession No AJ243370 and X87115) and had 86% identity with the amino acid sequence of both isolates. To our knowledge, this is the first report of CLSV in Poland. The virus was previously reported in Germany, Great Britain, Jordan, Greece, Saudi Arabia, Spain, and Bulgaria (1,2,4). CLSV is a member of the genus Aureusvirus, formerly Carmovirus (family Tombusviridae). In the first half of 2004, no cucumber plants testing positive for CLSV were found. This incidental occurrence of CLSV indicates that the virus is not a significant threat to cucumber in Poland at this time. References: (1) A. Brunt et al. Cucumber leaf spot virus. Viruses of Plants.Descriptions and Lists from the VIDE Database. CAB International, 1996. (2) D.Kostova et al. J. Plant Pathol. 83:147, 2001. (3) J. S. Miller et al. Virus Res. 52:51, 1997. (4) E. Segundo et al. Plant Dis. 85:1123, 2001.

First Report of Zucchini yellow mosaic virus in Cucumber in Poland.

In June 2002, mosaic and interveinal chlorosis were observed on two cucumber plants (Cucumis sativus) grown in one commercial greenhouse in the western region of Poland. Electron microscopic examination of leaf-dip preparations from infected plants showed flexuous filamentous virus particles typical of potyviruses (720 to 750 nm long). Chenopodium amaranticolor, Chenopodium quinoa, Citrullus lanatus, C. melo, C. sativus, Cucurbita maxima, Cucurbita pepo, Cucurbita pepo cv. Giromontiina, Cucurbita pepo cv. Patissoniana, Nicotiana benthamiana, and N. tabacum were mechanically inoculated with sap from symptomatic cucumber leaves. The virus caused local chlorotic lesions on Chenopodium amaranticolor and Chenopodium quinoa and systemic infection in all tested cucurbits but it did not infect tobacco plants. Reverse transcription-polymerase chain reaction (RT-PCR) amplification of the 3' end of the genomic RNA was done by using P9502 as a downstream primer and degenerate CPUP as an upstream primer to amplify a highly conserved region of the potyviral coat protein (1). The PCR products were directly sequenced with the CEQ DTCS dye terminator cycle sequencing kit (Beckman Coulter, Inc., Fullerton, CA), and the analysis of dideoxy terminated fragments was conducted by capillary electrophoresis using a CEQ 2000 DNA Analysis System (Beckman Coulter, Inc.). The obtained 684 nt sequence (GenBank Accession No. AY347476) was almost identical with sequences of Zucchini yellow mosaic virus (ZYMV) isolates from Austria (GenBank Accession Nos. AJ420012-AJ420019 and AJ420027) and Hungary (GenBank Accession Nos. AJ459954 and AJ459955). The above suggested that the Polish isolate of ZYMV belonged to the Central European branch of the phylogenetic tree (2). To our knowledge, this is the first report of ZYMV in Poland. References: (1) R. A. A. van der Vlugt et al. Phytopathology 89:148, 1999. (2) I. Tobias and L. Palkovics. Pest Manage. Sci. 59:493, 2003.