Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Comparative Infectivity of Cronartium ribicola Aeciospores and Urediniospores in Genotypes of Ribes nigrum.

Hosts for the fungus Cronartium ribicola, causal agent of white pine blister rust (WPBR), include five-needle pines as aecial hosts, and currants and gooseberries as uredinial/telial hosts. Aeciospores produced on diseased pine, and urediniospores produced on diseased Ribes plants, can infect Ribes foliage. Resistance and susceptibility for both spore types have been reported for Ribes; however, the comparative infectivity of these spore types on clonal Ribes nigrum genotypes is under-described. Immunity, resistance, and susceptibility to WPBR resides at a clonal level in Ribes. Previous studies have emphasized fungal diversity or forestry considerations, rather than horticultural aspects. The objective of this study was to determine if aeciospores and urediniospores were equally infective to specific genotypes of black currant, Ribes nigrum, with differential responses. A family of 51 black currant genotypes from a cross between a known-immune cultivar containing the Cr gene and a susceptible cultivar was examined. Single-leaf softwood cuttings of each of these genotypes were artificially inoculated with a spore solution and incubated in airtight plastic containers within a growth chamber. Inoculations were replicated three times for each spore type. Twenty-two of the F1 genotypes did not develop uredia after artificial inoculation. These may be immune; 22 developed uredia after exposure to both types of inoculum, and were susceptible; whereas seven exhibited differential responses and may have some mechanism for resistance to WPBR other than the Cr gene. The infectivity of aeciospores and urediniospores was not significantly different on specific Ribes genotypes. Either spore type can therefore be considered equally effective as inoculum when screening for WPBR resistance or immunity in horticultural settings.

Identification, detection and transmission of a new vitivirus from Mentha.

Mentha x gracilis 'Variegata' is an ornamental clone with a phenotype caused by virus infection. Several clones were ordered from mail-order nurseries in an attempt to identify a virus consistently associated with symptoms. One of these clones did not exhibit typical 'Variegata' symptoms, and steps were taken to identify any agents causing the 'off-type' symptoms. One of the viruses identified in the atypical 'Variegata' clone is a previously unknown virus, a member of the family Flexiviridae. Sequence and phylogenetic analysis indicate that the virus, designated as mint virus-2, is related to members of the species Grapevine virus A, Grapevine virus B and Heracleum latent virus, placing it in the genus Vitivirus. A detection protocol for the virus has been developed, and the mint aphid (Ovatus crataegarius) was able to transmit the virus in the presence of a helper virus but not from single infected plants.

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States.

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5'-GTTTCCTGTGCTCCTCA-3') and R (5'-GTCACACCGAGGTACT-3') (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Mint virus X: a novel potexvirus associated with symptoms in 'Variegata' mint.

Mentha x gracilis 'Variegata', an ornamental mint clone first described about 200 years ago, exhibits virus-like vein banding symptoms. Double-stranded RNA and virion isolations revealed the presence of three viruses in a 'Variegata' plant. Cloning and sequencing disclosed that one of the viruses was a previously unidentified species with similarities to members of the Flexiviridae family, designated as Mint virus X (MVX). The complete nucleotide sequence of the virus was determined. Phylogenetic analysis divulged the close relationship of the virus with lily virus X and strawberry mild yellow edge virus, members of the Potexvirus genus. A reverse transcription-polymerase chain reaction protocol was developed and used for detection of MVX in other 'Variegata' plants. All clones tested, obtained from nurseries around the United States were infected with MVX, making the virus a possible causal agent of the variegated symptoms.

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America.

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a "variegated" clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. 'Variegata' for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5' CCTCTCCAACCTGCTAGACT 3') and R (5' AAGCGCATGAAGGTGTAACT 3') were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis 'Variegata' from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

First Report of Clover Yellow Edge Phytoplasma in Corylus (Hazelnut).

During investigations into the cause of a stunt syndrome affecting cultivated European hazelnut trees (Corylus avellana L.) in Oregon, the clover yellow edge (CYE) phytoplasma was detected for the first time in this crop. The cause of hazelnut stunt syndrome (HSS) is unknown, but the disease has been transmitted by grafting and apparently has moved within orchards through root grafts (1). Severely affected trees persist for many years, but their nut production is greatly reduced. Previous attempts to detect viruses, bacteria, and other pathogens have been unsuccessful. HSS has been observed only in Oregon and already had been present for more than 10 years when it was first reported in 1970 (1). In June, 1999, leaf samples were collected from two affected and two apparently healthy (symptomless) hazelnut trees in a field plot at Oregon State University, Corvallis, and from a healthy greenhouse-grown tree. Leaf samples were sent to the USDA Beltsville, MD, laboratory, where they were assessed for phytoplasma infection, using nested polymerase chain reactions (PCRs). PCRs were primed by phytoplasma universal primer pairs P1/P7 and F2n/R2 (3) for amplification of phytoplasma 16S ribosomal (r) DNA (16S rRNA gene) sequences according to the procedures of Gunderson and Lee (2). Phytoplasma-characteristic 1.2-kbp DNA sequences were amplified from all field-tree samples. No DNA sequences were amplified from samples of the greenhouse-grown tree. Restriction fragment length polymorphism patterns of rDNA digested with AluI, KpnI, HhaI, HaeIII, HpaII, MseI, RsaI, and Sau3A1 endonucleases indicated that all diseased hazelnut trees as well as symptomless field trees were infected by a phytoplasma classified in group 16SrIII (peach X-disease group), subgroup B (III-B, type strain CYE phytoplasma). No phytoplasmas were detected in samples from the greenhouse-grown tree. Nucleotide sequences were determined for 16Sr DNA fragments amplified from the hazelnut CYE phytoplasma in nested PCRs primed with F2n/R2. The sequences were deposited in GenBank under Accession no. AF189288. Sequence similarity between 16Sr DNAs of the hazelnut CYE strain (CYE-Or) and the Canadian clover yellow edge strain (CYE-C, GenBank Accession no. AF175304) phytoplasma was 99.9%. Decline and yellows disorders of hazelnut in Germany and Italy have been associated with infections by apple proliferation, pear decline, and European stone fruit yellows phytoplasmas (4). These phytoplasmas are classified in 16Sr group X, the apple proliferation group of phytoplasmas. This is the first report of the CYE phytoplasma infecting Corylus. References: (1) H. R. Cameron. Plant Dis. Rep. 54:69, 1970. (2) D. E. Gunderson and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (3) R. Jomantiene et al. HortScience 33:1069, 1998. (4) C. Marcone et al. Plant Pathol. 45:857,1996.

First Report of Clover Proliferation Phytoplasma in Strawberry.

In 1996, diseased plants of Fragaria virginiana Duchesne were collected from a native population in Quebec, Canada, and sent to the National Clonal Germplasm Repository in Corvallis, OR, where grafting onto disease-free plants of F. chiloensis (L.) Duchesne (4) was performed. Plants of both species were sent to Beltsville, MD, for identification of a phytoplasma possibly associated with the disease symptoms of dwarfing and multibranching crowns. A phytoplasma was found in both species and characterized as the strawberry "multicipita" (SM) phytoplasma, which is representative of subgroup 16SrVI-B, a new subgroup of the clover proliferation (CP) group (2). In 1999, we observed commercial strawberry (Fragaria × ananassa Duchesne) plants collected in California and Maryland that were stunted and chlorotic or exhibited these symptoms in addition to small, distorted leaves. Infected F. × ananassa plants, as well as diseased F. virginiana and grafted F. chiloensis plants previously infected by the SM phytoplasma, were assessed for phytoplasma infection by nested polymerase chain reactions primed by phytoplasma universal primer pairs R16mF2/R1 and F2n/R2 (1) or P1/P7 (3) and F2n/R2 for amplification of phytoplasma 16S rDNA (16S rRNA gene) sequences. Phytoplasma-characteristic 1.2-kbp DNA sequences were amplified from all diseased plants. No DNA sequences were amplified from healthy plants. Restriction fragment length polymorphism patterns of rDNA digested with AluI, KpnI, HhaI, HaeIII, HinfI, HpaII, MseI, RsaI, and Sau3A1 endonucleases indicated that all plants were infected by a phytoplasma that belonged to subgroup 16SrVI-A (CP phytoplasma subgroup) and that diseased F. virginiana and grafted F. chiloensis plants were infected by both SM and CP. This is the first report of the CP phytoplasma, subgroup 16SrVI-A, infecting strawberry. This report also indicates that the occurrence of the CP phytoplasma in strawberry may be widespread in North America and that F. chiloensis, F. virginiana, and F. × ananassa plants are susceptible to infection by the CP phytoplasma. References: (1) D. E. Gunderson and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) R. Jomantiene et al. HortScience 33:1069, 1998. (3) R. Jomantiene et al. Int. J. Syst. Bacteriol. 48:269, 1998. (4) J. D. Postman et al. Acta Hortic. 471:25, 1998.

Blueberry Scorch Carlavirus Eliminated from Infected Blueberry (Vaccinium corymbosum) by Heat Therapy and Apical Meristem Culture.

The incidence of aphid-transmitted blueberry scorch carlavirus (BBSCV) has been increasing in recent years through the blueberry production areas of Oregon and Washington (1). Several infected plants were detected by enzyme-linked immunosorbent assay (ELISA) and removed from the blueberry germ plasm collection at the USDA/ARS National Clonal Germplasm Repository (NCGR) in Corvallis, OR. A virus-free replacement was not available from other sources for one of the infected cultivars. Plants of a highbush blueberry cultivar (Vaccinium corymbosum L. 'Gem'), infected with BBSCV, were grown at temperatures alternating every 4 h between 30 and 38°C. After 16 or 58 days of heat therapy, apical shoot tips were removed and meristems ranging in size from 0.2 to 1.0 mm were dissected and grown in vitro. Eight plants were successfully regenerated from these meristems: five from shoots that had been heat treated for 16 days and three from shoots heat treated for 58 days. These eight plants were tested for BBSCV by ELISA during the first growing season, and again after growth resumed following winter dormancy. All eight plants consistently tested negative for the virus and Gem is now among the 400 virus-tested Vaccinium clones available at NCGR Corvallis. This is the first report of the successful elimination of BBSCV from infected blueberry plants. Reference: (1) R. R. Martin and P. R. Bristow. Phytopathology 78:1636, 1988.