An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Dual pH- and ATP-Responsive Antibacterial Nanospray: On-Demand Release of Antibacterial Factors, Imaging Monitoring, and Accelerated Healing of Bacteria-Infected Wounds under NIR Activation.

The prevalence of pathogenic bacterial infections with high morbidity and mortality poses a widespread challenge to the healthcare system. Therefore, it is imperative to develop nanoformulations capable of adaptively releasing antimicrobial factors and demonstrating multimodal synergistic antimicrobial activity. Herein, an NIR-activated multifunctional synergistic antimicrobial nanospray MXene/ZIF-90@ICG was prepared by incorporating ZIF-90@ICG nanoparticles onto MXene-NH2 nanosheets. MXene/ZIF-90@ICG can on-demand release the antimicrobial factors MXenes, ICG, and Zn2+ in response to variations in pH and ATP levels within the bacterial infection microenvironment. Under NIR radiation, the combination of MXenes, Zn2+, and ICG generated a significant amount of ROS and elevated heat, thereby enhancing the antimicrobial efficacy of PDT and PTT. Meanwhile, NIR excitation could accelerate the further release of ICG and Zn2+, realizing the multimodal synergistic antibacterial effect of PDT/PTT/Zn2+. Notably, introducing MXenes improved the dispersion of the synthesized antimicrobial nanoparticles in aqueous solution, rendering MXene/ZIF-90@ICG a candidate for application as a nanospray. Importantly, MXene/ZIF-90@ICG demonstrated antimicrobial activity and accelerated wound healing in the constructed in vivo subcutaneous Staphylococcus aureus infection model with NIR activation, maintaining a favorable biosafety level. Therefore, MXene/ZIF-90@ICG holds promise as an innovative nanospray for adaptive multimodal synergistic and efficient antibacterial applications with NIR activation.

Coordination cages integrated into swelling poly(ionic liquid)s for guest encapsulation and separation.

Coordination cages have been widely reported to bind a variety of guests, which are useful for chemical separation. Although the use of cages in the solid state benefits the recycling, the flexibility, dynamicity, and metal-ligand bond reversibility of solid-state cages are poor, preventing efficient guest encapsulation. Here we report a type of coordination cage-integrated solid materials that can be swelled into gel in water. The material is prepared through incorporation of an anionic FeII4L6 cage as the counterion of a cationic poly(ionic liquid) (MOC@PIL). The immobilized cages within MOC@PILs have been found to greatly affect the swelling ability of MOC@PILs and thus the mechanical properties. Importantly, upon swelling, the uptake of water provides an ideal microenvironment within the gels for the immobilized cages to dynamically move and flex that leads to excellent solution-level guest binding performances. This concept has enabled the use of MOC@PILs as efficient adsorbents for the removal of pollutants from water and for the purification of toluene and cyclohexane. Importantly, MOC@PILs can be regenerated through a deswelling strategy along with the recycling of the extracted guests.

Aptamer-modified paper-based analytical devices for the detection of food hazards: Emerging applications and future perspective.

Food analysis plays a critical role in assessing human health risks and monitoring food quality and safety. Currently, there is a pressing need for a reliable, portable, and quick recognition element for point-of-care testing (POCT) to better serve the demands of on-site food analysis. Aptamer-modified paper-based analytical devices (Apt-PADs) have excellent characteristics of high portability, high sensitivity, high specificity, and on-site detection, which have been widely used and concerned in the field of food safety. The article reviews the basic components and working principles of Apt-PADs, and introduces their representative applications detecting food hazards. Finally, the advantages, challenges, and future directions of Apt-PADs-based sensing performance are discussed, to provide new directions and insights for researchers to select appropriate Apt-PADs according to specific applications.

Ratiometric Fluorescence Aptasensor of Allergen Protein Based on Multivalent Aptamer-Encoded DNA Flowers as Fluorescence Resonance Energy Transfer Platform.

Life-threatening allergic reactions to food allergens, particularly peanut protein Ara h1, are a growing public health concern affecting millions of people worldwide. Thus, accurate and rapid detection is necessary for allergen labeling and dietary guidance and ultimately preventing allergic incidents. Herein, we present a novel ratiometric fluorescence aptasensor based on multivalent aptamer-encoded DNA flowers (Mul-DNFs) for the high-stability and sensitive detection of allergen Ara h1. The flower-shaped Mul-DNFs were spontaneously packaged using ultralong polymeric DNA amplicons driven by a rolling circle amplification reaction, which contains a large number of Ara h1 specific recognition units and has excellent binding properties. Furthermore, dual-color fluorescence-labeled Mul-DNFs probes were developed by hybridizing them with Cy3- and Cy5-labeled complementary DNA (cDNA) to serve as a ratiometric fluorescence aptasensor platform based on fluorescence resonance energy transfer. Benefiting from the combined merits of the extraordinary synergistic multivalent binding ability of Mul-DNFs, the excellent specificity of the aptamer, and the sensitivity of the ratiometric sensor to avoid exogenous interference. The developed ratiometric aptasensor showed excellent linearity (0.05-2000 ng mL-1) with a limit of detection of 0.02 ng mL-1. Additionally, the developed ratiometric fluorescence aptasensor was utilized for quantifying the presence of Ara h1 in milk, infant milk powder, cookies, bread, and chocolate with recoveries of 95.7-106.3%. The proposed ratiometric aptasensor is expected to be a prospective universal aptasensor platform for the rapid, sensitive, and accurate determination of food and environmental hazards.

JS-K Combined with a Melanin-Based Theranostic Agent: A Novel Sequential Delivery Strategy to Enhance the Near-Infrared Fluorescence Imaging of Pancreatic Ductal Adenocarcinoma.

Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy with a 5 year survival rate less than 12%. This malignancy is closely related to the unique tumor microenvironment (TME), which is characterized by a hypovascular and hyperdense extracellular matrix, making it difficult for drugs to permeate the tumor center. Near-infrared fluorescence (NIRF) imaging, which has high sensitivity and resolution, may improve the survival rate of PDAC patients. In this study, we first used JS-K (O2-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl) piperazine-1-yl] diazene-1-ium-1,2-diolate) to specifically dilate blood vessels within the TME of PDAC patients and subsequently injected IR820-PEG-MNPs (IPM NPs) to diagnose and treat orthotopic PDAC. We found that JS-K promoted the accumulation of IPM NPs in orthotopic Pan02 tumor-bearing mice and was able to increase the tumor signal-to-background ratio (SBR) in the orthotopic PDAC area by 41.5%. In addition, surgical navigation in orthotopic Pan02 tumor-bearing mice and complete tumor resection based on fluorescence imaging were achieved with a detection sensitivity of 81.0%. Moreover, we verified the feasibility of the combination of laparoscopy and photothermal ablation (PTA) for the treatment of PDAC. Finally, we demonstrated that IPM NPs had greater affinity for human PDAC tissues than for normal pancreatic tissues ex vivo, preliminarily highlighting the potential for clinical translation of these NPs. In conclusion, we developed and validated a novel sequential delivery strategy that promotes the accumulation of nanoagents in the tumor area and can be used for the diagnosis and treatment of PDAC.

Temporally interfering electric fields brain stimulation in primary motor cortex of mice promotes motor skill through enhancing neuroplasticity.

Temporal interference (TI) electric field brain stimulation is a novel neuromodulation technique that enables the non-invasive modulation of deep brain regions, but few advances about TI stimulation effectiveness and mechanisms have been reported. Conventional transcranial alternating current stimulation (tACS) can enhance motor skills, whether TI stimulation has an effect on motor skills in mice has not been elucidated. In the present study, TI stimulation was proved to stimulating noninvasively primary motor cortex (M1) of mice, and that TI stimulation with an envelope wave frequency of 20 Hz (Δ f = 20 Hz) once a day for 20 min for 7 consecutive days significantly improved the motor skills of mice. The mechanism of action may be related to regulating of neurotransmitter metabolism, increasing the expression of synapse-related proteins, promoting neurotransmitter release, increasing dendritic spine density, enhancing the number of synaptic vesicles and the thickness of postsynaptic dense material, and ultimately enhance neuronal excitability and plasticity. It is the first report about TI stimulation promoting motor skills of mice and describing its mechanisms.

Rational Design of Multinary Metal Chalcogenide Bi0.4Sb1.6Te3 Nanocrystals for Efficient Potassium Storage.

Multinary metal chalcogenides hold considerable promise for high-energy potassium storage due to their numerous redox reactions. However, challenges arise from issues such as volume expansion and sluggish kinetics. Here, a design featuring a layered ternary Bi0.4Sb1.6Te3 anchored on graphene layers as a composite anode, where Bi atoms act as a lattice softening agent on Sb, is presented. Benefiting from the lattice arrangement in Bi0.4Sb1.6Te3 and structure, Bi0.4Sb1.6Te3/graphene exhibits a mitigated expansion of 28% during the potassiation/depotassiation process and demonstrates facile K+ ion transfer kinetics, enabling long-term durability of 500 cycles at various high rates. Operando synchrotron diffraction patterns and spectroscopies including in situ Raman, ex situ adsorption, and X-ray photoelectron reveal multiple conversion and alloying/dealloying reactions for potassium storage at the atomic level. In addition, both theoretical calculations and electrochemical examinations elucidate the K+ migration pathways and indicate a reduction in energy barriers within Bi0.4Sb1.6Te3/graphene, thereby suggesting enhanced diffusion kinetics for K+. These findings provide insight in the design of durable high-energy multinary tellurides for potassium storage.

High-affinity truncated aptamers for detection of Cronobacter spp with magnetic separation-assisted DNAzyme-driven 3D DNA walker.

After optimizing the original aptamer sequence by truncation strategy, a magnetic separation-assisted DNAzyme-driven 3D DNA walker fluorescent aptasensor was developed for detecting the food-borne pathogen Cronobacter species. Iron oxide magnetic nanoparticles (MNPs) modified with a hybrid of truncated aptamer probe and DNAzyme strand (AP-E1) denoted as MNPs@AP-E1, were employed as capture probes. Simultaneously, a DNAzyme-driven 3D-DNA walker was utilized as the signal amplification element. The substrate strand (Sub) was conjugated with the gold nanoparticles (AuNPs), resulting in the formation of AuNPs@Sub, which served as a 3D walking track. In the presence of the target bacteria and Mg2+, E1-DNAzyme was activated and moved along AuNPs@Sub, continuously releasing the signal probe. Under optimized conditions, a strong linear correlation was observed for Cronobacter sakazakii (C. sakazakii) in the concentration range 101 to 106 CFU mL-1, with a low detection limit of 2 CFU mL-1. The fluorescence signal responses for different Cronobacter species exhibited insignificant differences, with a relative standard deviation of 3.6%. Moreover, the aptasensor was successfully applied to determine  C. sakazakii in real samples with recoveries of 92.86%-108.33%. Therefore, the novel method could be a good candidate for ultra-sensitive and selective detection of Cronobacter species without complex manipulation.

Synchronous Triplanar Reconstruction Integrated with Color Doppler Mapping for Precise and Rapid Localization of Thyroid Lesions.

This paper proposes a novel thyroid examination technique based on five-dimensional (5D) synchronous reconstruction of ultrasound data. The raw temporal sequences are reconstructed into 3D volumetric data reflecting anatomical structure. Triplanar visualization from three orthogonal planes is realized to provide a systematic inspection of the entire gland. Color Doppler imaging is integrated into each triplanar slice to map vascularity changes. This multi-modal fusion enables synchronous display of structural, functional, and blood flow information in the reconstructed 5D space. Compared to conventional scanning, this technique offers the benefits of flexible offline diagnosis, reduced dependency on scanning, enhanced intuitive interpretation, and comprehensive multi-aspect evaluation. By minimizing oversight errors, it could improve diagnostic accuracy, especially for novice practitioners. The proposed 5D fusion method allows rapid and precise localization of lesions for early detection. Future work will explore integration with biochemical markers to further improve diagnostic precision. The technique has considerable clinical value for advancing thyroid examination.

Rational design of NIR-II molecule-engineered nanoplatform for preoperative downstaging and imaging-guided surgery of orthotopic hepatic tumor.

Orthotopic advanced hepatic tumor resection without precise location and preoperative downstaging may cause clinical postoperative recurrence and metastasis. Early accurate monitoring and tumor size reduction based on the multifunctional diagnostic-therapeutic integration platform could improve real-time imaging-guided resection efficacy. Here, a Near-Infrared II/Photoacoustic Imaging/Magnetic Resonance Imaging (NIR-II/PAI/MRI) organic nanoplatform IRFEP-FA-DOTA-Gd (IFDG) is developed for integrated diagnosis and treatment of orthotopic hepatic tumor. The IFDG is designed rationally based on the core "S-D-A-D-S" NIR-II probe IRFEP modified with folic acid (FA) for active tumor targeting and Gd-DOTA agent for MR imaging. The IFDG exhibits several advantages, including efficient tumor tissue accumulation, good tumor margin imaging effect, and excellent photothermal conversion effect. Therefore, the IFDG could realize accurate long-term monitoring and photothermal therapy non-invasively of the hepatic tumor to reduce its size. Next, the complete resection of the hepatic tumor in situ lesions could be realized by the intraoperative real-time NIR-II imaging guidance. Notably, the preoperative downstaging strategy is confirmed to lower the postoperative recurrence rate of the liver cancer patients under middle and advanced stage effectively with fewer side effects. Overall, the designed nanoplatform demonstrates great potential as a diagnostic-therapeutic integration platform for precise imaging-guided surgical navigation of orthotopic hepatic tumors with a low recurrence rate after surgery, providing a paradigm for diagnosing and treating the advanced tumors in the future clinical translation application.

Optimisation of stable flight posture of ski jumping based on computational fluid dynamics simulation technology.

The stable flight posture that affects sports performance during flight is usually formed by the multiple angles of the athlete-ski posture. At present, research on the flight phase is mainly based on the single-factor impact analysis based on computational fluid dynamics simulation technology, but studies on the multi-factor coupling relationship of two or more factors is less. This study aims to determine the best optimal-level combination based on the simulation model of this work through comprehensive evaluation from the optimisation perspective of multi-factor coupling. Here, a refined model of the athlete-ski system with the characteristics of ski jumping was established. Reynolds time-averaged method was used for the simulation. A three-factor and five-level simulation test was conducted on the relative inclination between skis, the angle between the body and the ski and the ski V-angle through orthogonal experiment design. Our results show that the optimal-level combination of the relative inclination between skis of 120°, the angle between the body and the ski of 20°, and the ski V-angle of 30° is relatively best in terms of aerodynamic characteristics. Simulation results were similar to the results of the winter field data from video analysis, and the results were effective.

Application of a new multi-element integrated teaching mode based on bite-sized teaching, flipped classroom, and MOOC in clinical teaching of obstetrics and gynaecology.

CONTEXT: Effective clinical medical student education includes attention to teaching approaches. This study assessed the impact of a new multi-element teaching mode that utilizes Bite-Sized Teaching, flipped classroom, and MOOC on learner perception in an Obstetrics and gynaecology clerkship. METHODS: A Two-stage crossover design study was conducted of a multi-element teaching mode compared to traditional teaching mode in an academic year. Participants included Ninety-six medical students practicing obstetrics and gynecology in our hospital, randomly divided into two groups respectively underwent multi-element teaching mode and traditional teaching mode. After each semester, a final test (including theoretical and clinical practical test) was conducted.When an academic year was completed, post intervention survey assessed learner perceptions of the intervention. RESULT: In order to comprehensively test students' performance after study, we take theoretical and practical examinations. The theoretical examination mainly tests students' grasp of basic knowledge points, while the practical examination focuses on the examination of students' diagnosis and treatment of diseases. There were statistically significant differences both in the theoretical and clinical practical scores between the new multi-element integrated teaching mode and the traditional teaching mode, specifically as follows: In the end of first semester, the theoretical scores of the two groups were respective 43.75 ± 3.42 vs. 42.07 ± 2.90, and clinic practical test scores were respective 44.93 ± 2.42 vs. 43.37 ± 2.52; In the end of second semester, the theoretical scores of the two groups were respective 44.30 ± 2.69 vs. 42.25 ± 3.39, and clinic practical test scores were respective 43.79 ± 2.25 vs. 41.93 ± 2.80.(p < 0.05). The results of questionnaires demonstrated that 80.21% of the students showed preference for the new multi-element integrated teaching mode comparing to traditional teaching methods. CONCLUSION: The new multi-element integrated teaching mode is well accepted by the students and can improve the students' mastery of knowledge, and can improve the students' clinical comprehensive ability. The new multi-element integrated teaching mode is shown more preference than traditional teaching mode in the teaching of Obstetrics and Gynaecology. Further long term study is needed carried out to consolidate our conclusion. The new multi-element integrated teaching mode may have positive effects on clinical teaching of Obstetrics and Gynaecology.

Diradicaloid Boron-Doped Molecular Carbons Achieved by Pentagon-Fusion.

Molecular carbons (MCs) are molecular cutouts of carbon materials. Doping with heteroatoms and constructing open-shell structures are two powerful approaches to achieve unexpected and unique properties of MCs. Herein, we disclose a new strategy to design open-shell boron-doped MCs (BMCs), namely by pentagon-fusion of an organoborane π-system. We synthesized two diradicaloid BMC molecules that feature C24 B and C38 B π-skeletons containing a pentagonal ring. A thorough investigation reveals that such pentagon-fusion not only leads to their local antiaromaticity, but also incorporates an internal quinoidal substructure and thereby induces open-shell singlet diradical states. Moreover, their fully fused structures enable efficient π conjugation, which is expanded over the whole frameworks. Consequently, some intriguing physical properties are achieved, such as narrow energy gaps, very broad light absorptions, and superior photothermal capability, along with excellent photostability. Notably, the solid of the C38 B molecule exhibits absorption that covers the range of 300-1200 nm and an efficiency of 93.5 % for solar-driven water evaporation, thus demonstrating the potential of diradicaloid BMCs as high-performance organic photothermal materials.

Fatal motorcycle straddle injury consolidated with traumatic testicular dislocation: A case report.

Straddle injuries are those to the perineum region brought on by straddling or riding over something, such as a horse, vehicle, or other object. The motorcycle fuel tank or handlebars are primarily responsible for the typical injury to the perineum area in motorcycle accidents. Motorcycle straddle injury usually manifest as abrasions to the scrotum or penis, and severe cases can cause pelvic fractures or even testicular dislocation. Because these injuries are usually closed with unclear internal damage, diagnosis presents a significant challenge and can easily lead to misdiagnosis. However, pelvic fractures and the bleeding and nerve damage associated with perineal injury are often fatal, and testicular dislocation can also have serious consequences for patients. Therefore, a clear diagnosis and timely treatment are crucial for patients with this type of injury. This article reports the case of a motorcycle rider who died 4 h after a traffic accident with only minor surface injury visible, showing only bruising in the waist and scrotum. A forensic examination revealed multiple fractures throughout the patient's body, with a slightly more severe pelvic fracture and testicular dislocation on the left side in the left inguinal area. This article analyzes the cause of death and related issues in this case, aiming to provide assistance to clinical physicians and forensic practitioners and to emphasize the importance of handling straddle injury in treatment and related investigations to avoid serious consequences.

Noninvasive Deep Brain Stimulation via Temporal Interference Electric Fields Enhanced Motor Performance of Mice and Its Neuroplasticity Mechanisms.

A noninvasive deep brain stimulation via temporal interference (TI) electric fields is a novel neuromodulation technology, but few advances about TI stimulation effectiveness and mechanisms have been reported. One hundred twenty-six mice were selected for the experiment by power analysis. In the present study, TI stimulation was proved to stimulate noninvasively primary motor cortex (M1) of mice, and 7-day TI stimulation with an envelope frequency of 20 Hz (∆f =20 Hz), instead of an envelope frequency of 10 Hz (∆f =10 Hz), could obviously improve mice motor performance. The mechanism of action may be related to enhancing the strength of synaptic connections, improving synaptic transmission efficiency, increasing dendritic spine density, promoting neurotransmitter release, and increasing the expression and activity of synapse-related proteins, such as brain-derived neurotrophic factor (BDNF), postsynaptic density protein-95 (PSD-95), and glutamate receptor protein. Furthermore, the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway and its upstream BDNF play an important role in the enhancement of locomotor performance in mice by TI stimulation. To our knowledge, it is the first report about TI stimulation promoting multiple motor performances and describing its mechanisms. TI stimulation might serve as a novel promising approach to enhance motor performance and treat dysfunction in deep brain regions.

Advances in mitochondria-centered mechanism behind the roles of androgens and androgen receptor in the regulation of glucose and lipid metabolism.

An increasing number of studies have reported that androgens and androgen receptors (AR) play important roles in the regulation of glucose and lipid metabolism. Impaired glucose and lipid metabolism and the development of obesity-related diseases have been found in either hypogonadal men or male rodents with androgen deficiency. Exogenous androgens supplementation can effectively improve these disorders, but the mechanism by which androgens regulate glucose and lipid metabolism has not been fully elucidated. Mitochondria, as powerhouses within cells, are key organelles influencing glucose and lipid metabolism. Evidence from both pre-clinical and clinical studies has reported that the regulation of glucose and lipid metabolism by androgens/AR is strongly associated with the impact on the content and function of mitochondria, but few studies have systematically reported the regulatory effect and the molecular mechanism. In this paper, we review the effect of androgens/AR on mitochondrial content, morphology, quality control system, and function, with emphases on molecular mechanisms. Additionally, we discuss the sex-dimorphic effect of androgens on mitochondria. This paper provides a theoretical basis for shedding light on the influence and mechanism of androgens on glucose and lipid metabolism and highlights the mitochondria-based explanation for the sex-dimorphic effect of androgens on glucose and lipid metabolism.

Borderline personality disorder and thyroid diseases: a Mendelian randomization study.

Background: Previous studies have shown that there is a correlation between diseases of the thyroid gland and mental illnesses; however, any causal relationship between them remains unclear. This study aimed to evaluate the causal relationship between borderline personality disorder and four thyroid diseases. Methods: The causal relationship was inferred using double-sample Mendelian randomization analysis of appropriate instrumental variables from genome-wide association studies. We calculated the estimated value of the effect using various statistical methods. Results: Borderline personality disorder was a risk factor for non-toxic single thyroid nodules with each increase in standard deviation increasing the risk of a non-toxic single thyroid nodule by 1.13 times (odds ratio = 1.131; 95% confidence interval, 1.006-1.270; P=0.039). There was no evidence of a correlation between borderline personality disorder and hyperthyroidism/thyrotoxicosis, hypothyroidism, and autoimmune thyroiditis. Conclusion: This study showed that there is a positive causal correlation between borderline personality disorder and non-toxic single thyroid nodules but not with other thyroid diseases. This means that thyroid status should be monitored in patients with borderline personality disorder. However, the possibility of a causal relationship between other mental illnesses and thyroid diseases requires further research.

A novel ternary Y-DNA walker amplification strategy designed fluorescence aptasensor based on Au@SiO2@Fe3O4 nanomaterials for ochratoxin A detection.

A novel ternary Y-DNA walker amplification strategy designed fluorescence aptasensor based on Au@SiO2@Fe3O4 nanomaterials for ultrasensitive and specific ochratoxin A detection in food samples is presented. Au@SiO2@Fe3O4 nanomaterials provide the loading platform as well as separation and recovery properties for the ternary Y-DNA walker. The ternary Y-DNA walker is designed to be driven by Nb.BbvCI cleaving a large number of FAM probes to achieve signal amplification. Since Ochratoxin A (OTA) can bind to the constituent aptamer in the ternary Y-DNA walker, adding OTA will destroy the structure of the ternary Y-DNA walker, thereby inhibiting the driving process of the walker. After optimization of various parameters, a standard curve was obtained from 100 to 0.05 ng·mL-1 of OTA with the limit of determination of 0.027 ng·mL-1. The spiked recovery of peanut samples by this method was 82.00-93.30%, and the aptasensor showed excellent specificity and long-term stability. This simple, robust, and scalable oligonucleotide chain-based ternary Y-DNA walker can provide a general signal amplification strategy for trace analysis.

Discovery of a new cryptic Achalinus Peters, 1869 (Serpentes, Xenodermidae) species from Hunan Province, China.

A new species, Achalinusshenisp. nov., from central Hunan Province is described, based on the results of molecular systematics and morphological characters according to five specimens. Our molecular phylogeny inferred from the mitochondrial CO1 gene fragment revealed that this new species is most closely related to A.yunkaiensis, but a considerable amount of genetic divergence exists between them (p-distance ranging from 5.8% to 6.4%) and much distinct genetic divergence exists compared with other known Achalinus species (p-distance ranging from 10.4% to 15.8%), supporting its validity. Morphologically, it can be distinguished from its congeners by: (1) dorsal scales strongly keeled, 23 rows throughout the body, the outmost row smooth and significantly enlarged; (2) tail relatively short, TaL/TL 0.183 ~ 0.224; (3) the suture between internasals subequal to the suture between prefrontals; (4) loreal one, subrectangular, LorH/LorL 0.53 ~ 0.57; (5) ventrals 161-170, anal entire, subcaudals 55-61, not paired; (6) the length of supraocular equal to or longer than the length of upper anterior temporal; and (7) vertebral line inconspicuous and subcaudal streak absent. Currently, 27 species of Achalinus are known in the world, amongst which 20 species are distributed in China. Moreover, a key to species of the genus Achalinus is provided in this study.