[Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease].

OBJECTIVE: To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD). METHODS: Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family. RESULTS: Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband. CONCLUSION: Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Identification of Five Novel Variants in Chinese Oculocutaneous Albinism by Targeted Next-Generation Sequencing.

BACKGROUND: The diagnosis of oculocutaneous albinism (OCA) is established using clinical signs and symptoms. OCA is, however, a highly genetically heterogeneous disease with mutations identified in at least nineteen unique genes, many of which produce overlapping phenotypic traits. Thus, differentiating genetic OCA subtypes for diagnoses and genetic counseling is challenging, based on clinical presentation alone, and would benefit from a comprehensive molecular diagnostic. AIM: To develop and validate a more comprehensive, targeted, next-generation-sequencing-based diagnostic for the identification of OCA-causing variants. MATERIALS AND METHODS: The genomic DNA samples from 28 OCA probands were analyzed by targeted next-generation sequencing (NGS), and the candidate variants were confirmed through Sanger sequencing. RESULTS: We observed mutations in the TYR, OCA2, and SLC45A2 genes in 25/28 (89%) patients with OCA. We identified 38 pathogenic variants among these three genes, including 5 novel variants: c.1970G>T (p.Gly657Val), c.1669A>C (p.Thr557Pro), c.2339-2A>C, and c.1349C>G (p.Thr450Arg) in OCA2; c.459_470delTTTTGCTGCCGA (p.Ala155_Phe158del) in SLC45A2. CONCLUSION: Our findings expand the mutational spectrum of OCA in the Chinese population, and the assay we developed should be broadly useful as a molecular diagnostic, and as an aid for genetic counseling for OCA patients.

Whole-exome sequencing identifies a novel homozygous frameshift mutation in the PROM1 gene as a causative mutation in two patients with sporadic retinitis pigmentosa.

Retinitis pigmentosa (RP) refers to a heterogeneous group of inherited retinal diseases caused by the loss of photoreceptors. The present study aimed to identify the gene mutations responsible for RP in two patients diagnosed with sporadic RP using next-generation sequencing technology. For this purpose, two patients with sporadic RP and family members (namely parents and siblings) were recruited into this study and underwent a complete ophthalmological assessment. Whole-exome sequencing (WES) was performed on genomic DNA samples isolated from peripheral leukocytes which had been obtained from the two patients diagnosed with sporadic RP. WES data were annotated and filtered against four public databases and one in-house database. Subsequently, Sanger sequencing was performed in order to determine whether any of the candidate variants co-segregated with the disease phenotype in the families. A homozygous frameshift mutation, c.1445dupT (p.F482fs) in exon 12 of the PROM1 gene (MIM: 604365), satisfied a recessive inheritance model and showed complete co-segregation of the mutation with the disease phenotype in the families. The same mutation was not detected in the 200 ethnically-matched control samples by Sanger sequencing. The novel homozygous mutation c.1445dupT (p.F482fs) in the PROM1 gene was identified as a causative mutation for RP. Thus, the identification of this mutation has further expanded the existing spectrum of PROM1 mutations in patients with RP, thereby assisting in the molecular diagnosis of RP and enhancing our understanding of genotype-phenotype correlations in order to provide effective genetic counseling.