ABSTRACT
Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.
Subject(s)
Aptamers, Nucleotide , Biosensing Techniques , Ciprofloxacin , Molecular Docking Simulation , Molecular Dynamics Simulation , Ciprofloxacin/chemistry , Ciprofloxacin/analysis , Aptamers, Nucleotide/chemistry , Biosensing Techniques/methods , Computer SimulationABSTRACT
Aflatoxin B1 (AFB1) is a naturally occurring toxin produced by Aspergillus flavus and Aspergillus parasiticus. The AFB1 is classified as a potent carcinogen and poses significant health risks both to humans and animals. Early detection of the toxin in post-harvest agricultural products will save lives and promote healthy food production. In this study, stratified docking approach was utilized to screen and identify potential aptamers that can bind to AFB1. ssDNA sequences were acquired from the Mendeley dataset, secondary and tertiary structures were predicted through a series of bioinformatics pipelines. Further, the final DNA tertiary structures were minimized and SiteMap algorithm was used to probe and locate binding cavities. According to the final XP docking result, a 34 nt sequence (5'-ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT-3') aptamer with a docking score of -5.959 kcal/mol was considered for 200 ns MD Simulation. Finally, the screened DNA-aptamer was immobilized over the gold surface based on Au-S chemistry and utilized for the detection of AFB1. The fabricated DNA-aptamer electrode demonstrated a good analytical performance including wide linear range (1.0 to 1000 ng L-1), detection limit (1.0 ng L-1), high stability, and reproducibility.Communicated by Ramaswamy H. Sarma.
ABSTRACT
A mesoporous silica-based drug delivery system (MS@PNIPAm-PAAm NPs) was synthesized by conjugating the PNIPAm-PAAm copolymer onto the mesoporous silica (MS) surface as a gatekeeper that responds to temperature and pH changes. The drug delivery studies are carried out in vitro at different pH (7.4, 6.5, and 5.0) and temperatures (such as 25 °C and 42 °C, respectively). The surface conjugated copolymer (PNIPAm-PAAm) acts as a gatekeeper below the lower critical solution temperature (LCST) (<32 °C) and as a collapsed globule structure above LCST (>32 °C), resulting in controlled drug delivery from the MS@PNIPAm-PAAm system. Furthermore, the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and cellular internalization results support the prepared MS@PNIPAm-PAAm NPs being biocompatible and readily taken up by MDA-MB-231 cells. The prepared MS@PNIPAm-PAAm NPs, with their pH-responsive drug release behavior and good biocompatibility, could be used as a drug delivery vehicle where sustained drug release at higher temperatures is required.
ABSTRACT
Hydrogen peroxide (H2O2) is widely used in various industries and biological fields. H2O2 rapidly contaminants with water resources and hence simple detection process is highly wanted in various fields. The present study was focused on the biosensing, antimicrobial and embryotoxicity of bioinspired chitosan nanoparticles (Cs NPs), selenium nanoparticles (Se NPs), chitosan/selenium nanocomposites (Cs/Se NCs), silver nanoparticles (Ag NPs) and chitosan/silver nanocomposites (Cs/Ag NCs) synthesized using the aqueous Cucurbita pepo Linn. leaves extract. The physico-chemical properties of as-synthesized nanomaterials were confirmed by various spectroscopic and microscopic techniques. Further, hydrogen peroxide (H2O2) sensing properties and their sensitivities were confirmed by cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and chronoamperometry (CA) methods, in which Cs/Ag NCs showed pronounced sensing properties. In addition, the mode of antibacterial interaction results clearly demonstrated the effective inhibitory activity of as-prepared Ag NPs and Cs/Ag NCs against Gram negative pathogenic bacteria. The highest embryotoxicity was recorded at 0.19 µg/ml of Ag NPs and 1.56 µg/ml of Se NPs. Intriguingly, the embryo treated with Cs/Se NCs and Cs/Ag NCs significantly reduced the toxicity in the presence of Cs matrix. However, Cs/Se NCs did not show good response in H2O2 sensing than the Cs/Ag NCs, implying the biocompatibility of Cs/Ag NCs. Overall, the obtained results clearly suggest that Cs/Ag NCs could be suitable for dual applications such as for the detection of environmental pollutant biosensors and for biomedical research.
Subject(s)
Chitosan , Metal Nanoparticles , Nanocomposites , Selenium , Anti-Bacterial Agents/chemistry , Chitosan/chemistry , Hydrogen Peroxide , Metal Nanoparticles/chemistry , Metal Nanoparticles/toxicity , Nanocomposites/chemistry , Nanocomposites/toxicity , Selenium/pharmacology , Silver/chemistryABSTRACT
In this work, we prepared network-structured carbon nanofibers using polyacrylonitrile blends (PAN150 and PAN85) with different molecular weights (150,000 and 85,000 g mol-1) as precursors through electrospinning/hot-pressing methods and stabilization/carbonization processes. The obtained PAN150/PAN85 polymer nanofibers (PNFs; PNF-73, PNF-64 and PNF-55) with different weight ratios of 70/30, 60/40 and 50/50 (w/w) provided good mechanical and electrochemical properties due to the formation of physically bonded network structures between the blended PAN nanofibers during the hot-processing/stabilization processes. The resulting carbonized PNFs (cPNFs; cPNF-73, cPNF-64, and cPNF-55) were utilized as anode materials for supercapacitor applications. cPNF-73 exhibited a good specific capacitance of 689 F g-1 at 1 A g-1 in a three-electrode set-up compared to cPNF-64 (588 F g-1 at 1 A g-1) and cPNF-55 (343 F g-1 at 1 A g-1). In addition, an asymmetric hybrid cPNF-73//NiCo2O4 supercapacitor device also showed a good specific capacitance of 428 F g-1 at 1 A g-1 compared to cPNF-64 (400 F g-1 at 1 A g-1) and cPNF-55 (315 F g-1 at 1 A g-1). The cPNF-73-based device showed a good energy density of 1.74 W h kg-1 (0.38 W kg-1) as well as an excellent cyclic stability (83%) even after 2000 continuous charge-discharge cycles at a current density of 2 A g-1.
ABSTRACT
Porous spheres of CuS@SiO2 were obtained by deposition of CuS on silica spheres through a one-step chemical method. Subsequently, polypyrrole (PPy) was deposited on the CuS@SiO2 spheres. The formation of the porous spheres was elucidated by control experiments and physical characterizations. The nanohybrid was placed on a glassy carbon electrode (GCE) surface where it displays good electrocatalytic activity in terms of glucose electrooxidation with an optimum at a working potential of 0.55 V (vs. Ag/AgCl) in 0.1 M NaOH solution. The PPy-CuS@SiO2 achieves an extremely high sensitivity (505.3 µA mM-1 cm-2), wide linear range (10 µM-4.2 mM), low detection limit (1.0 µM), short response time (Ë 0.5 s), high selectivity, long-term durability, and reproducibility. The fabricated electrode based on PPy-CuS@SiO2 was further used for the determination of glucose in blood sample with good recoveries. Graphical abstract Schematic representation of the method for fabrication of polypyrrole-coated porous CuS@SiO2 sphere.
Subject(s)
Blood Glucose/analysis , Copper/chemistry , Electrochemical Techniques/methods , Nanostructures/chemistry , Polymers/chemistry , Pyrroles/chemistry , Silicon Dioxide/chemistry , Blood Glucose/chemistry , Electrochemical Techniques/instrumentation , Electrodes , Humans , Limit of Detection , Oxidation-Reduction , Porosity , Reproducibility of ResultsABSTRACT
Copper sulfide (CuS) nanoparticles have been prepared by a facile sonochemical method using copper nitrate and thiourea as precursors. The X-ray diffraction analysis revealed the formation of hexagonal CuS. The Field-emission scanning electron microscope showed the formation of CuS nanoparticles with size in the range of 50 nm. Moreover, the electrochemical properties of the prepared CuS nanoparticles are examined by the use of cyclic voltammetry and electrochemical impedance spectroscopy. The cyclic voltammetry studies show a maximum specific capacitance of about 62.77 F/g at a 5 mV s(-1) scan rate. The electrochemical impedance studies such as Nyquist and Bode plots suggested that the pseudocapacitive properties of the prepared CuS nanoparticles.