First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar.

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Comparing patterns and scales of plant virus phylogeography: Rice yellow mottle virus in Madagascar and in continental Africa.

Rice yellow mottle virus (RYMV) in Madagascar Island provides an opportunity to study the spread of a plant virus disease after a relatively recent introduction in a large and isolated country with a heterogeneous host landscape ecology. Here, we take advantage of field survey data on the occurrence of RYMV disease throughout Madagascar dating back to the 1970s, and of virus genetic data from ninety-four isolates collected since 1989 in most regions of the country to reconstruct the epidemic history. We find that the Malagasy isolates belong to a unique recombinant strain that most likely entered Madagascar through a long-distance introduction from the most eastern part of mainland Africa. We infer the spread of RYMV as a continuous process using a Bayesian statistical framework. In order to calibrate the time scale in calendar time units in this analysis, we pool the information about the RYMV evolutionary rate from several geographical partitions. Whereas the field surveys and the phylogeographic reconstructions both point to a rapid southward invasion across hundreds of kilometers throughout Madagascar within three to four decades, they differ on the inferred origin location and time of the epidemic. The phylogeographic reconstructions suggest a lineage displacement and unveil a re-invasion of the northern regions that may have remained unnoticed otherwise. Despite ecological differences that could affect the transmission potential of RYMV in Madagascar and in mainland Africa, we estimate similar invasion and dispersal rates. We could not identify environmental factors that have a relevant impact on the lineage dispersal velocity of RYMV in Madagascar. This study highlights the value and complementarity of (historical) nongenetic and (more contemporaneous) genetic surveillance data for reconstructing the history of spread of plant viruses.

Complete Genome Sequences of Rice Yellow Mottle Virus Isolates from the Federal Democratic Republic of Ethiopia.

The full-length genomes of two isolates of Rice yellow mottle virus from Ethiopia were sequenced. A comparison with 28 sequences from East Africa showed that they clustered within a new strain named S4et, related to the S4mg and S4ug strains found in the Lake Victoria Basin and Madagascar, respectively.

Emergence of rice yellow mottle virus in eastern Uganda: Recent and singular interplay between strains in East Africa and in Madagascar.

Epidemics of rice yellow mottle virus (RYMV) have developed recently in eastern Uganda, close to Lake Victoria in East Africa. Unexpectedly, all isolates from the affected area belonged to a single strain (named S4ug), a strain that is different from the S4lv strain that has been prevalent in the Lake Victoria basin for the past five decades. Interestingly, the S4ug strain is most closely related at the genomic level (except ORF1) to the strain present in Madagascar (S4mg), 2000km away. The minor parent of the S4mg recombinant strain could not be detected. Molecular clock dating analysis indicated that the singular sequence of events - that associated the emergence of a new strain (S4ug), a modular recombination between closely related strains (S4mg and S4ug) and a long distance transmission (S4mg) - occurred recently, within the past few decades. This finding is at variance with the process of gradual strain dispersal and diversification over two centuries throughout Africa that was previously established.

Rice yellow mottle virus in Madagascar and in the Zanzibar Archipelago; island systems and evolutionary time scale to study virus emergence.

Rice yellow mottle virus (RYMV), of the genus Sobemovirus, is a major threat to rice cultivation in Africa. Long range transmission of RYMV, difficult to study experimentally, is inferred from a detailed analysis of the molecular diversity of the virus in Madagascar and in the Zanzibar Archipelago (Zanzibar and Pemba Islands; Tanzania) compared with that found elsewhere in Africa. A unique successful introduction of RYMV to Madagascar, which is ca. 400 km from mainland Africa, contrasted with recurrent introductions of the virus to the Zanzibar Archipelago, ca. 40 km from the East African coast. Accordingly, RYMV dispersal over distances of hundreds of kilometers is rare whereas spread of the virus over distances of tens of kilometers is relatively frequent. The dates of introduction of RYMV to Madagascar and to Pemba Island were estimated from three sets of ORF4 sequences of virus isolates collected between 1966 and 2011. They were compared with the dates of the first field detection in Madagascar (1989) and in Pemba Island (1990). The estimates did not depend substantially on the data set used or on the evolutionary model applied and their credible intervals were narrow. The estimated dates are recent - 1978 (1969-1986) and 1985 (1977-1993) in Madagascar and in Pemba Island, respectively - compared to the early diversification of RYMV in East Africa ca. 200 years ago. They predated by 5-10 years the first field detections in these islands. The interplay between virus sources, rice cultivation and long range dispersal which led to RYMV emergence and spread is enlightened.

Theme and variations in the evolutionary pathways to virulence of an RNA plant virus species.

The diversity of a highly variable RNA plant virus was considered to determine the range of virulence substitutions, the evolutionary pathways to virulence, and whether intraspecific diversity modulates virulence pathways and propensity. In all, 114 isolates representative of the genetic and geographic diversity of Rice yellow mottle virus (RYMV) in Africa were inoculated to several cultivars with eIF(iso)4G-mediated Rymv1-2 resistance. Altogether, 41 virulent variants generated from ten wild isolates were analyzed. Nonconservative amino acid replacements at five positions located within a stretch of 15 codons in the central region of the 79-aa-long protein VPg were associated with virulence. Virulence substitutions were fixed predominantly at codon 48 in most strains, whatever the host genetic background or the experimental conditions. There were one major and two isolate-specific mutational pathways conferring virulence at codon 48. In the prevalent mutational pathway I, arginine (AGA) was successively displaced by glycine (GGA) and glutamic acid (GAA). Substitutions in the other virulence codons were displaced when E48 was fixed. In the isolate-specific mutational pathway II, isoleucine (ATA) emerged and often later coexisted with valine (GTA). In mutational pathway III, arginine, with the specific S2/S3 strain codon usage AGG, was displaced by tryptophane (TGG). Mutational pathway I never arose in the widely spread West African S2/S3 strain because G48 was not infectious in the S2/S3 genetic context. Strain S2/S3 least frequently overcame resistance, whereas two geographically localized variants of the strain S4 had a high propensity to virulence. Codons 49 and 26 of the VPg, under diversifying selection, are candidate positions in modulating the genetic barriers to virulence. The theme and variations in the evolutionary pathways to virulence of RYMV illustrates the extent of parallel evolution within a highly variable RNA plant virus species.