Identifying discriminative features of brain network for prediction of Alzheimer's disease using graph theory and machine learning.

Alzheimer's disease (AD) is a challenging neurodegenerative condition, necessitating early diagnosis and intervention. This research leverages machine learning (ML) and graph theory metrics, derived from resting-state functional magnetic resonance imaging (rs-fMRI) data to predict AD. Using Southwest University Adult Lifespan Dataset (SALD, age 21-76 years) and the Open Access Series of Imaging Studies (OASIS, age 64-95 years) dataset, containing 112 participants, various ML models were developed for the purpose of AD prediction. The study identifies key features for a comprehensive understanding of brain network topology and functional connectivity in AD. Through a 5-fold cross-validation, all models demonstrate substantial predictive capabilities (accuracy in 82-92% range), with the support vector machine model standing out as the best having an accuracy of 92%. Present study suggests that top 13 regions, identified based on most important discriminating features, have lost significant connections with thalamus. The functional connection strengths were consistently declined for substantia nigra, pars reticulata, substantia nigra, pars compacta, and nucleus accumbens among AD subjects as compared to healthy adults and aging individuals. The present finding corroborate with the earlier studies, employing various neuroimagining techniques. This research signifies the translational potential of a comprehensive approach integrating ML, graph theory and rs-fMRI analysis in AD prediction, offering potential biomarker for more accurate diagnostics and early prediction of AD.

Disallowed spots in protein structures.

Ramachandran (ϕ, ψ) steric map was introduced in 1963 to describe available conformation space for protein structures. Subsequently, residues were observed in high-energy disallowed regions of the map. To unequivocally identify the locations of disallowed conformations of residues, we got 36 noise-free protein structures (resolution ≤1 Å, Rwork/Rfree ≤ 0.10). These stringent criteria were applied to rule out data or model errors or any crystallographic disorders. No disallowed conformation was found in the dataset. Further, we also examined disallowed conformations in a larger dataset (resolution ≤1.5 Å, devoid of any model errors, or disorders). The observed locations of disallowed residues are referred as disallowed spots. These spots include short loops of 3-5 residues, and locations where residues participate in disulfide bonding or intramolecular interactions or inter-molecular interactions with neighboring water, metals or ligands. Conformational sampling revealed that short loops in between secondary structures hardly have any opportunity to relieve from conformational strain. Residues involved in interactions, which provide energetic compensation for high-energy conformational states, were relieved from strain once the causative interaction was removed. The present study aims to identify disallowed spots in the native state of proteins, wherein residues are forced to be trapped in high-energy disallowed conformations. Moreover, it was also observed that pre-Pro, Ser, Asp, trans-Pro, Val, Asn & Gly have higher tendency to occur in disallowed conformation, which could be attributed to factors such as conformational restrictions, residue propensity of secondary structures and compensating sidechain and mainchain interactions, stabilizing turn-mimics.

Categorization of hotspots into three types - weak, moderate and strong to distinguish protein-protein versus protein-peptide interactions.

Protein-protein and protein-peptide interactions (PPI and PPepI) belong to a similar category of interactions, yet seemingly subtle differences exist among them. To characterize differences between protein-protein (PP) and protein-peptide (PPep) interactions, we have focussed on two important classes of residues-hotspot and anchor residues. Using implicit solvation-based free energy calculations, a very large-scale alanine scanning has been performed on benchmark datasets, consisting of over 5700 interface residues. The differences in the two categories are more pronounced, if the data were divided into three distinct types, namely - weak hotspots (having binding free energy loss upon Ala mutation, ΔΔG, ∼2-10 kcal/mol), moderate hotspots (ΔΔG, ∼10-20 kcal/mol) and strong hotspots (ΔΔG ≥ ∼20 kcal/mol). The analysis suggests that for PPI, weak hotspots are predominantly populated by polar and hydrophobic residues. The distribution shifts towards charged and polar residues for moderate hotspot and charged residues (principally Arg) are overwhelmingly present in the strong hotspot. On the other hand, in the PPepI dataset, the distribution shifts from predominantly hydrophobic and polar (in the weak type) to almost similar preference for polar, hydrophobic and charged residues (in moderate type) and finally the charged residue (Arg) and Trp are mostly occupied in the strong type. The preferred anchor residues in both categories are Arg, Tyr and Leu, possessing bulky side chain and which also strike a delicate balance between side chain flexibility and rigidity. The present knowledge should aid in effective design of biologics, by augmentation or disruption of PPIs with peptides or peptidomimetics.Communicated by Ramaswamy H. Sarma.

Phenylbenzopyrone of Flavonoids as a Potential Scaffold to Prevent SARSCoV-2 Replication by Inhibiting its MPRO Main Protease.

BACKGROUND: In December 2019, an outbreak of a pneumonia-like illness, Corona virus disease 2019 (COVID-19), originating from Wuhan, China, was linked to novel coronavirus, now termed SARS-CoV-2. Unfortunately, no effective drugs or vaccines have been reported yet. The main protease (MPRO) remains the most validated pharmacological target for the design and discovery of inhibitors. OBJECTIVE: The purpose of the study was to find a prospective natural scaffold as an inhibitor for MPRO main protease in SARS-CoV-2 and compare it with repurposed antiviral drugs lopinavir and nelfinavir. METHODS: Natural compound libraries were screened for potential scaffold against MPRO main protease. Molecular dynamics simulation, MM-GBSA and principal component analyses of enzyme- ligand complexes were carried out with the top-ranking hits and compared with the repurposed antiviral drugs lopinavir and nelfinavir. RESULTS: The structure-based virtual screening indicated phenylbenzopyrone of flavonoids as one of the top-ranking scaffolds that have the potential to inhibit the main protease with the Oglycosidic form, performing better than the corresponding aglyconic form. Simulation studies indicated that glycosidic form of flavonoid is a more suitable inhibitor with compounds rutin, procyanidin B6, baicalin and galloylquercetin, demonstrating high affinity and stability, and rutin, emerging as one of the best candidate compounds. Interestingly, rutin was reported to have inhibitory activity against similar protease (3Cprotease of enterovirus A71) and implicated in lung fibrosis. CONCLUSION: The present study on flavonoids, possessing a potential scaffold for inhibiting main protease activity for all betacoronavirus is an attempt to provide new and safe drug leads within a reasonably short period.

Performance Evaluation of Docking Programs- Glide, GOLD, AutoDock & SurflexDock, Using Free Energy Perturbation Reference Data: A Case Study of Fructose-1, 6-bisphosphatase-AMP Analogs.

BACKGROUND: The accurate ranking of analogs of lead molecules with respect to their estimated binding free energies to drug targets remains highly challenging in molecular docking due to small relative differences in their free energy values. METHODS: Free energy perturbation (FEP) method, which provides the most accurate relative binding free energy values were earlier used to calculate free energies of many ligands for several important drug targets including Fructose-1,6-BisphosPhatase (FBPase). The availability of abundant structural and experimental binding affinity data for FBPase inhibitors provided an ideal system to evaluate four widely used docking programs, AutoDock, Glide, GOLD and SurflexDock, distinct from earlier comparative evaluation studies. RESULTS: The analyses suggested that, considering various parameters such as docking pose, scoring and ranking accuracy, sensitivity analysis and newly introduced relative ranking score, Glide provided reasonably consistent results in all respects for the system studied in the present work. Whereas GOLD and AutoDock also demonstrated better performance, AutoDock results were found to be significantly superior in terms of scoring accuracy compared to the rest. CONCLUSION: Present analysis serves as a useful guide for researchers working in the field of lead optimization and for developers in upgradation of the docking programs.

In silico screening for identification of novel ß-1,3-glucan synthase inhibitors using pharmacophore and 3D-QSAR methodologies.

The enzyme ß-1,3-glucan synthase, which catalyzes the synthesis of ß-1,3-glucan, an essential and unique structural component of the fungal cell wall, has been considered as a promising target for the development of less toxic anti-fungal agents. In this study, a robust pharmacophore model was developed and structure activity relationship analysis of 42 pyridazinone derivatives as ß-1,3-glucan synthase inhibitors were carried out. A five-point pharmacophore model, consisting of two aromatic rings (R) and three hydrogen bond acceptors (A) was generated. Pharmacophore based 3D-QSAR model was developed for the same reported data sets. The generated 3D-QSAR model yielded a significant correlation coefficient value (R (2) = 0.954) along with good predictive power confirmed by the high value of cross-validated correlation coefficient (Q (2) = 0.827). Further, the pharmacophore model was employed as a 3D search query to screen small molecules database retrieved from ZINC to select new scaffolds. Finally, ADME studies revealed the pharmacokinetic efficiency of these compounds.

Modeling of babesipain-1 and identification of natural and synthetic leads for bovine babesiosis drug development.

Babesiosis is a tick-borne, zoonotic disease caused by species of the intraerythrocytic protozoan Babesia. It is distributed all around the world and affects various domestic and wild animals, mainly cattle. Recently, the cysteine protease enzyme, babesipain-1 from Babesia bigemina has been identified as a potential target for designing new anti-babesiosis drugs. In the present study, a three-dimensional structural model of babesipain-1 was developed. An active site with three pockets (S1, S2, and S3), which is congruent with its homolog, falcipain-3, was also identified. Moreover, the conservation of active site residues was consistent with the cysteine protease family. In order to identify potential inhibitors, a virtual screening workflow was employed with a chemical library containing natural and synthetic compounds. Potential inhibitors interacting with all the three subsites were identified. Further, molecular dynamic simulations were carried out to assess the interactions and stability of the inhibitors. The informatics approach, and the findings presented in this study will assist researchers in further development of potential anti-babesiosis molecules.

Free energy calculations to estimate ligand-binding affinities in structure-based drug design.

Post-genomic era has led to the discovery of several new targets posing challenges for structure-based drug design efforts to identify lead compounds. Multiple computational methodologies exist to predict the high ranking hit/lead compounds. Among them, free energy methods provide the most accurate estimate of predicted binding affinity. Pathway-based Free Energy Perturbation (FEP), Thermodynamic Integration (TI) and Slow Growth (SG) as well as less rigorous end-point methods such as Linear interaction energy (LIE), Molecular Mechanics-Poisson Boltzmann./Generalized Born Surface Area (MM-PBSA/GBSA) and λ-dynamics have been applied to a variety of biologically relevant problems. The recent advances in free energy methods and their applications including the prediction of protein-ligand binding affinity for some of the important drug targets have been elaborated. Results using a recently developed Quantum Mechanics (QM)/Molecular Mechanics (MM) based Free Energy Perturbation (FEP) method, which has the potential to provide a very accurate estimation of binding affinities to date has been discussed. A case study for the optimization of inhibitors for the fructose 1,6- bisphosphatase inhibitors has been described.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

HIV-1 associated Topoisomerase IIß kinase: a potential pharmacological target for viral replication.

Viruses have been found to exhibit protein kinase activity associated with their purified viral particles. HIV-1 virus particles possess a novel 72 kD protein, Topoisomerase II beta kinase (Topo IIßKHIV) activity. The enzyme, isolated and purified from PEGprecipitated HIV-1 particles, is insensitive against a diverse set of known kinase inhibitors. The pyridine derivatives were found to be active against both Topo IIßKHIV activity and HIV-1 replication. For both kinase antagonism and anti-HIV-1 activity the Comparative Molecular Field Analysis (CoMFA) models were proposed. The CoMFA model was also evaluated independently with a set of test molecules for their anti-viral activity. The kinase inhibition and anti-viral activities for these inhibitors, tested in an in vitro kinase agree with the CoMFA model (cross-validated r2 (q2) value of 0.642 with six principal components), lower acceptable results are obtained with anti- HIV-1 activity (cross-validated r2 (q2) value of 0.358 with four principal components) and also correlate with relative solvation free energy calculations. The predictive power of the models was evaluated with 2 test molecules each and tends to lie within 1 log unit. An in cell validation of the model with a representative inhibitor, 2-methoxypyridine shows its ability to inhibit Topo IIß phosphorylation during acute HIV-1 infection. Close correlation of molecular fields of inhibitory domains of kinase and HIV-1 inhibitors suggests specificity of action of pyridine derivatives in affecting HIV-1 replication through inhibition of Kinase activity. These investigations suggest that Topo IIßKHIV is a potential target for an effective control of HIV-1 replication that would help in developing new anti-retroviral molecules.

Advances in binding free energies calculations: QM/MM-based free energy perturbation method for drug design.

Multiple approaches have been devised and evaluated to computationally estimate binding free energies. Results using a recently developed Quantum Mechanics (QM)/Molecular Mechanics (MM) based Free Energy Perturbation (FEP) method suggest that this method has the potential to provide the most accurate estimation of binding affinities to date. The method treats ligands/inhibitors using QM while using MM for the rest of the system. The method has been applied and validated for a structurally diverse set of fructose 1,6- bisphosphatase (FBPase) inhibitors suggesting that the approach has the potential to be used as an integral part of drug discovery for both lead identification lead optimization, where there is a structure available. In addition, this QM/MM-based FEP method was shown to accurately replicate the anomalous hydration behavior exhibited by simple amines and amides suggesting that the method may also prove useful in predicting physical properties of molecules. While the method is about 5-fold more computationally demanding than conventional FEP, it has the potential to be less demanding on the end user since it avoids development of MM force field parameters for novel ligands and thereby eliminates this time-consuming step that often contributes significantly to the inaccuracy of binding affinity predictions using conventional FEP methods. The QM/MM-based FEP method has been extensively tested with respect to important considerations such as the length of the simulation required to obtain satisfactory convergence in the calculated relative solvation and binding free energies for both small and large structural changes between ligands. Future automation of the method and parallelization of the code is expected to enhance the speed and increase its use for drug design and lead optimization.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

1,1'-[(2-Bromo-phen-yl)-methyl-ene]-dipyrrolidin-2-one.

In the title compound, C(15)H(17)BrN(2)O(2), both pyrrolidinone rings adopt envelope conformations. The crystal packing is characterized by short C-Br⋯O=C inter-actions [Br⋯O = 3.1730 (13) Å], leading to supra-molecular dimers. Inter-molecular C-H⋯O and C-H⋯π inter-actions are also observed.

1-Meth-oxy-4-({[(4-meth-oxy-phen-yl)-sulfan-yl](phen-yl)meth-yl}sulfan-yl)benzene.

The title compound, C(21)H(20)O(2)S(2), forms a propeller-shaped structure with the tetra-hedral C atom as the central hub and meth-oxy-benzene and phenyl residues as radiating blades. Short C-H⋯π contacts are observed.

4-(4-Chloro-phen-yl)-N-[(E)-4-(dimethyl-amino)-benzyl-idene]-1,3-thia-zol-2-amine.

The title compound, C(18)H(16)ClN(3)S, adopts an extended mol-ecular structure. The thia-zole ring is inclined by 9.2 (1) and 15.3 (1)° with respect to the chloro-phenyl and 4-(dimethyl-amino)-phenyl rings, respectively, while the benzene ring planes make an angle of 19.0 (1)°. A weak inter-molecular C-H⋯π contact is observed in the crystal structure.

3-Ethyl-4-methyl-1H-pyrazol-2-ium-5-olate.

The title compound, C(6)H(10)N(2)O, is a zwitterionic pyrazole derivative. The crystal packing is predominantly governed by a three-center iminium-amine N(+)-H⋯O(-)⋯H-N inter-action, leading to an undulating sheet-like structure lying parallel to (100).

Bis(acetyl-acetonato-κO,O')(pyridine-κN)zinc(II).

In the title compound, [Zn(C(5)H(7)O(2))(2)(C(5)H(5)N)], the metal atom has square-pyramidal coordination geometry with the basal plane defined by the four O atoms of the chelating acetyl-acetonate ligands and with the axial position occupied by the pyridine N atom. The crystal packing is characterized by a C-H⋯O hydrogen-bonded ribbon structure approximately parallel to [10[Formula: see text]].

Minimum MD simulation length required to achieve reliable results in free energy perturbation calculations: case study of relative binding free energies of fructose-1,6-bisphosphatase inhibitors.

In an attempt to establish the criteria for the length of simulation to achieve the desired convergence of free energy calculations, two studies were carried out on chosen complexes of FBPase-AMP mimics. Calculations were performed for varied length of simulations and for different starting configurations using both conventional- and QM/MM-FEP methods. The results demonstrate that for small perturbations, 1248 ps simulation time could be regarded a reasonable yardstick to achieve convergence of the results. As the simulation time is extended, the errors associated with free energy calculations also gradually tapers off. Moreover, when starting the simulation from different initial configurations of the systems, the results are not changed significantly, when performed for 1248 ps. This study carried on FBPase-AMP mimics corroborates well with our previous successful demonstration of requirement of simulation time for solvation studies, both by conventional and ab initio FEP. The establishment of aforementioned criteria of simulation length serves a useful benchmark in drug design efforts using FEP methodologies, to draw a meaningful and unequivocal conclusion.

Prevalence of Arcobacter spp. in humans, animals and foods of animal origin including sea food from India.

The present study reports the prevalence of Arcobacter, an emerging pathogen in human, animals and foods of animal origin in India. A total of 600 samples from various sources, viz. diarrhoeal stools of humans and dogs, faecal swabs of animals (pig, poultry), preputial washings of breeding bulls and food samples (chicken, pork, fish) were examined for presence of Arcobacter spp. Using cultural methods, a total of 63 Arcobacter spp. were isolated of 600 (10.50%) samples with highest isolation rate were from pig faeces (21.33%) followed by sea foods (17.33%), poultry faeces (14.67%), pork (16.00%), chicken meat (12.00%) and human stools (2.67%). The isolates were confirmed as arcobacters by genus-based PCR. PCR screening of all the enriched samples revealed the overall prevalence of Arcobacter spp. to be 12.00% with highest in pig (25.33%), followed by sea food (21.33%), poultry (17.33%), pork (16%), chicken meat (12%) and human stools (4.00%). No Arcobacter spp. was isolated or detected from diarrhoeal faecal samples of dogs and preputial washings. With multiplex PCR, three different species were detected (A. butzleri, A. cryaerophilus and A. skirrowii) with most of the samples showing mixed infections. There are only two recent reports from India; one with cultural isolation and another with PCR detection of Arcobacter spp. in stool samples of humans with clinical diarrhoea. In this context, our present report is the first report of isolation and detection of Arcobacter spp. from various sources of animals and foods including diarrhoeic human stool samples, utilizing both cultural and molecular tools identifying arcobacters at genus and species level. These results support the importance of arcobacters as an emerging food-borne pathogen, possessing zoonotic potential.

Comparative analysis of cultural isolation and PCR based assay for detection of Campylobacter jejuni in food and faecal samples

In the present study, the efficacy of polymerase chain reaction (PCR) based on mapA gene of C. jejuni was tested for detection of Campylobacter jejuni in naturally infected as well as spiked faecal and food samples of human and animal origin. Simultaneously, all the samples were subjected to the cultural isolation of organism and biochemical characterization. The positive samples resulted in the amplification of a DNA fragment of size ~589 bp in PCR assay whereas the absence of such amplicon in DNA extracted from E. coli, Listeria, Salmonella and Staphylococcus confirmed the specificity of the primers. Of randomly collected 143 faecal samples comprising human diarrheic stools (43), cattle diarrheic faeces (48) and poultry faecal swabs (52) only 4, 3 and 8, respectively, could be detected by isolation whereas 6, 3 and 10, respectively, were found positive by PCR. However, among food samples viz. beef (30), milk (35), cheese (30), only one beef sample was detected both by culture as well as PCR. Additionally, PCR was found to be more sensitive for C. jejuni detection in spiked faecal and food samples (96.1 percent each) as relative to culture isolation which could detect the organism in 86.7 percent and 80 percent samples, respectively. The results depicted the superior efficacy of PCR for rapid screening of samples owing to its high sensitivity, specificity and automation potential.