First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States.

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States.

Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans 'Alba' with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3' region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three 'Alba' in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of 'Alba' by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.

First Report of Freesia sneak virus in Freesia sp. in Virginia.

In the spring of 2008, freesia, cvs. Honeymoon and Santana, with striking virus-like symptoms similar to freesia leaf necrosis disease were received by the Virginia Tech Plant Disease Clinic from a cut-flower nursery in Gloucester, VA and forwarded for analysis to the USDA-ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Approximately 25% of the plants had coalescing, interveinal, chlorotic, whitish, necrotic or dark brown-to-purple necrotic spots on leaves. Symptomatic plants were scattered within the planting. Fifteen symptomatic plants were collected between March and May of 2008, and nucleic acid extracts were analyzed for ophiovirus infection by reverse transcription (RT)-PCR with ophiovirus-specific degenerate primers (2). The diagnostic 136-bp ophiovirus product from the RdRp gene was amplified from 14 of 15 freesia plants tested. A partially purified virus preparation was analyzed by transmission electron microscopy and potyvirus- and ophiovirus-like particles were detected. The potyviruses, Freesia mosaic virus (FreMV) and Bean yellow mosaic virus (BYMV), each cause mosaic symptoms (3), although BYMV may induce necrosis late in the season. RT-PCR performed on the same nucleic acid samples using potyvirus coat protein (CP)-specific degenerate primers D335 and U335 (1) amplified the diagnostic 335-bp fragment from 2 of 15 plants. Cloned sequence from these plants was identified as FreMV. The ophiovirus CP gene was amplified by RT-PCR and cloned from two symptomatic freesia plants using primers FreSVf-CP-XhoI 5'-GACTCGAGAAATGTCTGGAAAATACTCTGTTC-3' and FreSVf-CP-BamHI 5'-CCAGGATCCTTAGATAGTGAATCCATAAGCTG-3', based on the sequence of Freesia sneak virus (FreSV) isolates from freesia (GenBank No. DQ885455) and lachenalia (4). The approximate 1.3-kb amplicon was cloned and sequences of two cDNA clones were identical (GenBank No. FJ807730). The deduced amino acid sequence showed 99% identity with the Italian FreSV CP sequence (GenBank No. DQ885455), confirming FreSV in the symptomatic freesia plants. To our knowledge, this is the first report of FreSV in Virginia and the United States. Soilborne freesia leaf necrosis disease has been reported in Europe since the 1970s (3); several viral causal agents have been hypothesized but recent findings correlate best with the ophiovirus. In Virginia, the presence of FreSV, but not FreMV, was strongly correlated with the leaf necrosis syndrome. FreSV, likely soilborne through Olpidium brassicae, may pose a new soilborne threat for bulbous ornamentals, since it has been recently detected also in Lachenalia spp. (Hyacinthaceae) from South Africa (4). Although specific testing of O. brassicae was not performed, the disease may potentially persist in the soil for years in O. brassicae resting spores and development of symptoms may be affected by environmental conditions (3). References: (1) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) A. M. Vaira et al. Arch.Virol. 148:1037, 2003. (3) A. M. Vaira et al. Acta Hortic. 722:191, 2006. (4) A. M. Vaira et al. Plant Dis. 91:770, 2007.

Identification and full sequence of an isolate of Alternanthera mosaic potexvirus infecting Phlox stolonifera.

A potexvirus was isolated from creeping phlox (Phlox stolonifera) plants from a commercial nursery in Pennsylvania. The virus was serologically related to clover yellow mosaic virus, plantain virus X, potato virus X, and potato aucuba mosaic virus, and was most closely related to papaya mosaic virus (PapMV). The sequence of a PCR fragment obtained with potexvirus group-specific primers was distinct from that of PapMV; the coat protein (CP) gene and 3' untranslated region (UTR) were closely related to Alternanthera mosaic virus (AltMV), previously reported only from Australia. The host range was similar to that of the Australian isolate (AltMV-Au), and the phlox isolate reacted strongly with antiserum to AltMV-Au. The full sequence of the phlox isolate was more closely related to PapMV throughout the genome than to any potexvirus other than AltMV-Au, for which only the CP and 3'UTR sequences are available. The phlox isolate was therefore named AltMV-PA (for Pennsylvania), and the full 6607 nt sequence is presented(1). Additional AltMV isolates from creeping phlox (AltMV-BR and AltMV-SP) and trailing portulaca (Portulaca grandiflora; AltMV-Po) were also isolated, suggesting that AltMV may be widespread, and may have been mis-diagnosed in the past as PapMV. AltMV has the potential to spread to other ornamental crops.

X-ray photoelectron spectroscopy surface analysis of aluminum ion stress in barley roots.

X-ray photoelectron spectroscopy (XPS) has been used to analyze root surface changes when Dayton barley (Hordeum vulgare) (Al tolerant) and Kearney barley (Al sensitive) seedlings were grown in nutrient solution in the presence and absence of 37.0 micromolar Al. The electron spectra from root surfaces contained strong lines in order of decreasing intensity from organic forms of carbon, oxygen, and nitrogen and weak lines due to inorganic elements in the form of anions and cations on the surface. The surface composition of root tips from Kearney was C, 65.6%; 0, 26.8%; N, 4.4% and tips from Dayton was C, 72.7%; O, 23.6%; N, 1.9%, grown in the absence of aluminum. Electron lines characteristic of nitrate, potassium, chloride, phosphate were also present in the spectra from those roots. Dayton roots grown in the presence of 37.0 micromolar aluminum contained 2.1% aluminum while Kearney contained 1.3% aluminum. The ratio of aluminum to phosphate was close to 1.0. Dayton roots usually contained twice as much aluminum phosphate in the surface region as Kearney. Dayton may be less susceptible to Al toxic effects by accumulation of aluminum phosphate on the root surface which then acts as a barrier to the transport of aluminum into the interior of the roots.