Genetic Analysis of the Emerging Citrus Yellow Vein Clearing Virus Reveals a Divergent Virus Population in American Isolates.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.

Coding-complete genome sequence of an isolate of papaya virus E in tomato.

An isolate of papaya virus E was identified in tomato fruits from Mexico. The coding-complete genome sequence was determined using high-throughput sequencing. The coding-complete genome is 13,412 nucleotides and contains 8 open reading frames.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

First report of Passion fruit green spot virus in yellow Passion fruit (Passiflora edulis f. flavicarpa) in Casanare, Colombia.

Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important species in terms of net production and local consumption. Recently two brevipalpus transmitted cileviruses, (i) passion fruit green spot virus (PfGSV) and (ii) hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) were detected in passion fruit in Brazil and Hawaii, respectively (Ramos-González et al., 2020, Olmedo-Velarde et al., 2022). CiLV-C2H infects both citrus and hibiscus in Colombia (Roy et al., 2015, 2018) but there was no report of PfGSV elsewhere apart from Brazil and Paraguay (Costa-Rodrigues et al., 2022). Apart from emerging begomovirus diseases, five major viruses are known to infect passion fruit in Colombia: soybean mosaic virus (SMV), cowpea aphid-borne mosaic virus, passion fruit yellow mosaic virus, cucumber mosaic virus, and a tentative Gulupa bacilliform badnavirus A (Cardona et al., 2022). Current findings of CiLV-C2H in passion fruit and PfGSV in hibiscus motivated us to investigate the possibilities of cilevirus infection in passion fruit in Colombia. During surveys, along with healthy yellow passion fruit leaves, five symptomatic plant samples from Meta and three from Casanare were collected before sent to the Molecular Plant Pathology Laboratory at Beltsville, MD under APHIS permit. Passion fruit samples from Meta showed leaf mottling, rugose mosaic, and leaf distortion, whereas leaf variegation, chlorotic spots, yellowing, green spots in senescent leaves and green vein banding were observed in the Casanare samples (Supp. Fig. 1). Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, USA). To know the potential cilevirus infection in these samples, three PfGSV specific (Ramos-González et al. 2020) and a CiLV-C2 generic primer pairs (Olmedo-Velarde et al. 2021) were used in the RT-PCR assays. All five passion fruit samples from Meta failed to produce either CiLV-C2 or CiLV-C2H or PfGSV amplicon whereas all three Casanare samples successfully amplified 321, 244 and 299 nts of PfGSV-RNA1 and -RNA2 amplicons using C13F/C13R, C6F/C6R and C8F/C8R primers, respectively. Bi-directional amplicon sequencing followed by BlastN analysis revealed ≥99% nt identity with the PfGSV-RNA1 (MK804173) and -RNA2 (MK804174) genome sequences. An optimized ribo-depleted library preparation protocol was utilized to prepare two cDNA libraries using the RNA extracts of a PfGSV suspected positive (Casanare) and a negative (Meta) samples (Chellappan et al., 2022). HTS libraries of Casanare and Meta samples resulted in 22.7 to 29.5 million raw reads, respectively. After adapter trimming and filtering, clean reads were mapped to the Arabidopsis thaliana reference genome and unmapped reads were de novo assembled (Chellappan et al., 2022). BlastN analysis from the assembled contigs identified 1-3 contigs corresponding to PfGSV-RNA1 and -RNA2, respectively, from Casanare sample whereas 3 contigs of SMV were identified in Meta passion fruit sample. No other virus sequence was obtained from either of the libraries. Assembled contigs covered 99.33% of the RNA1 and 94.42% of the RNA2 genome, with read depths of 64,474 and 119,549, respectively. Meta sample contigs (OP564897) covered >99% of the SMV genome, which shared >99% nt identity with the Colombian SMV isolates (KY249378, MW655827). Both RNA-1 (OP564895) and -2 (OP564896) segments of the Casanare isolate shared 99% nt identity with PfGSV isolate (MK804173-74). Our discovery identified PfGSV in Colombia, for the first-time outside Brazil and Paraguay. The findings of PfGSV in yellow passion fruit increases the potential threat and possibility of PfGSV movement via Brevipalpus sp. from passion fruit to other hosts.

Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity.

Tomato is an important vegetable in the United States and around the world. Recently, tomato brown rugose fruit virus (ToBRFV), an emerging tobamovirus, has impacted tomato crops worldwide and can result in fruit loss. ToBRFV causes severe symptoms, such as mosaic, puckering, and necrotic lesions on leaves; other symptoms include brown rugose and marbling on fruits. More importantly, ToBRFV can overcome resistance in tomato cultivars carrying the Tm-22 locus. In this study, we recovered ToBRFV sequences from tomato seeds, leaves, and fruits from the U.S., Mexico, and Peru. Samples were pre-screened using a real-time RT-PCR assay prior to high-throughput sequencing. Virus draft genomes from 22 samples were assembled and analyzed against more than 120 publicly available genomes. Overall, most sequenced isolates were similar to each other and did not form a distinct population. Phylogenetic analysis revealed three clades within the ToBRFV population. Most of the isolates (95%) clustered in clade 3. Genetic analysis revealed differentiation between the three clades indicating minor divergence occurring. Overall, pairwise identity showed limited genetic diversity among the isolates in this study with worldwide isolates, with a pairwise identity ranging from 99.36% and 99.97%. The overall population is undergoing high gene flow and population expansion with strong negative selection pressure at all ToBRFV genes. Based on the results of this study, it is likely that the limited ToBRFV diversity is associated with the rapid movement and eradication of ToBRFV-infected material between countries.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

Smilax auriculata: A new host for Orchid fleck dichorhavirus identified in Florida, USA.

In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.

Complete Genome Sequence of a Tomato Brown Rugose Fruit Virus Isolated in the United States.

The complete genome sequence of a U.S. isolate of a Tomato brown rugose fruit virus (ToBRFV) (CA18-01) was obtained through Illumina and MinION sequencing. The U.S. ToBRFV isolate shared a high nucleic acid sequence identity (>99%) with known ToBRFV isolates. Phylogenetic analysis revealed a tight cluster for ToBRFV isolates throughout the world, suggesting a short evolutionary history.

Global distribution of mating types shows limited opportunities for mating across populations of fungi causing boxwood blight disease.

Boxwood blight is a disease threat to natural and managed landscapes worldwide. To determine mating potential of the fungi responsible for the disease, Calonectria pseudonaviculata and C. henricotiae, we characterized their mating-type (MAT) loci. Genomes of C. henricotiae, C. pseudonaviculata and two other Calonectria species (C. leucothoes, C. naviculata) were sequenced and used to design PCR tests for mating-type from 268 isolates collected from four continents. All four Calonectria species have a MAT locus that is structurally consistent with the organization found in heterothallic ascomycetes, with just one idiomorph per individual isolate. Mating type was subdivided by species: all C. henricotiae isolates possessed the MAT1-1 idiomorph, whereas all C. pseudonaviculata isolates possessed the MAT1-2 idiomorph. To determine the potential for divergence at the MAT1 locus to present a barrier to interspecific hybridization, evolutionary analysis was conducted. Phylogenomic estimates showed that C. henricotiae and C. pseudonaviculata diverged approximately 2.1 Mya. However, syntenic comparisons, phylogenetic analyses, and estimates of nucleotide divergence across the MAT1 locus and proximal genes identified minimal divergence in this region of the genome. These results show that in North America and parts of Europe, where only C. pseudonaviculata resides, mating is constrained by the absence of MAT1-1. In regions of Europe where C. henricotiae and C. pseudonaviculata currently share the same host and geographic range, it remains to be determined whether or not these two recently diverged species are able to overcome species barriers to mate.

Genetic Variation of the Pathogen Causing Impatiens Downy Mildew Predating and Including Twenty-first Century Epidemics on Impatiens walleriana.

Impatiens downy mildew (IDM) of cultivated Impatiens walleriana has had a significant economic impact on the ornamental horticulture industry in the United States and globally. Although recent IDM outbreaks started in 2003, downy mildews on noncultivated Impatiens species have been documented since the 1880s. To understand the relationship between the pathogen causing recent epidemics and the pathogen historically present in the United States, this work characterized genetic variation among a collection of 1,000 samples on 18 plant hosts. Samples included collections during recent IDM epidemics and historical herbarium specimens. Ten major genotypes were identified from cloned rDNA amplicon sequencing and endpoint SNP genotyping. Three genotypes accounted for >95% of the samples, with only one of these three genotypes found on samples predating recent IDM outbreaks. Based on phylogenetic analysis integrating data from three markers and the presence of individual genotypes on multiple Impatiens species, there was some evidence of pathogen-specific infection of I. noli-tangere, but the distinction between genotypes infecting I. walleriana and I. balsamina was not upheld. Overall, this work provides evidence that the majority of rDNA genotypes recovered from recent IDM epidemics are different from historical U.S. genotypes, and that these genotypes can infect Impatiens spp. other than I. walleriana.

Genome analysis of the ubiquitous boxwood pathogen Pseudonectria foliicola.

Boxwood (Buxus spp.) are broad-leaved, evergreen landscape plants valued for their longevity and ornamental qualities. Volutella leaf and stem blight, caused by the ascomycete fungi Pseudonectria foliicola and P. buxi, is one of the major diseases affecting the health and ornamental qualities of boxwood. Although this disease is less severe than boxwood blight caused by Calonectria pseudonaviculata and C. henricotiae, its widespread occurrence and disfiguring symptoms have caused substantial economic losses to the ornamental industry. In this study, we sequenced the genome of P. foliicola isolate ATCC13545 using Illumina technology and compared it to other publicly available fungal pathogen genomes to better understand the biology of this organism. A de novo assembly estimated the genome size of P. foliicola at 28.7 Mb (425 contigs; N50 = 184,987 bp; avg. coverage 188×), with just 9,272 protein-coding genes. To our knowledge, P. foliicola has the smallest known genome within the Nectriaceae. Consistent with the small size of the genome, the secretome, CAzyme and secondary metabolite profiles of this fungus are reduced relative to two other surveyed Nectriaceae fungal genomes: Dactylonectria macrodidyma JAC15-245 and Fusarium graminearum Ph-1. Interestingly, a large cohort of genes associated with reduced virulence and loss of pathogenicity was identified from the P. foliicola dataset. These data are consistent with the latest observations by plant pathologists that P. buxi and most likely P. foliicola, are opportunistic, latent pathogens that prey upon weak and stressed boxwood plants.

Draft Genome Resources for the Phytopathogenic Fungi Monilinia fructicola, M. fructigena, M. polystroma, and M. laxa, the Causal Agents of Brown Rot.

Fungi in the genus Monilinia cause brown rot disease of stone and pome fruits. Here, we report the draft genome assemblies of four important phytopathogenic species: M. fructicola, M. fructigena, M. polystroma, and M. laxa. The draft genome assemblies were 39 Mb (M. fructigena), 42 Mb (M. laxa), 43 Mb (M. fructicola), and 45 Mb (M. polystroma) with as few as 550 contigs (M. laxa). These are the first draft genome resources publicly available for M. laxa, M. fructigena, and M. polystroma.

Newly Emerged Populations of Plasmopara halstedii Infecting Rudbeckia Exhibit Unique Genotypic Profiles and Are Distinct from Sunflower-Infecting Strains.

The oomycete Plasmopara halstedii emerged at the onset of the 21st century as a destructive new pathogen causing downy mildew disease of ornamental Rudbeckia fulgida (rudbeckia) in the United States. The pathogen is also a significant global problem of sunflower (Helianthus annuus) and is widely regarded as the cause of downy mildew affecting 35 Asteraceae genera. To determine whether rudbeckia and sunflower downy mildew are caused by the same genotypes, population genetic and phylogenetic analyses were performed. A draft genome assembly of a P. halstedii isolate from sunflower was generated and used to design 15 polymorphic simple sequence repeat (SSR) markers. SSRs and two sequenced phylogenetic markers measured differentiation between 232 P. halstedii samples collected from 1883 to 2014. Samples clustered into two main groups, corresponding to host origin. Sunflower-derived samples separated into eight admixed subclusters, and rudbeckia-derived samples further separated into three subclusters. Pre-epidemic rudbeckia samples clustered separately from modern strains. Despite the observed genetic distinction based on host origin, P. halstedii from rudbeckia could infect sunflower, and exhibited the virulence phenotype of race 734. These data indicate that the newly emergent pathogen populations infecting commercial rudbeckia are a different species from sunflower-infecting strains, notwithstanding cross-infectivity, and genetically distinct from pre-epidemic populations infecting native rudbeckia hosts.

Polymorphic SSR markers for Plasmopara obducens (Peronosporaceae), the newly emergent downy mildew pathogen of Impatiens (Balsaminaceae).

PREMISE OF THE STUDY: Simple sequence repeat (SSR) markers were developed for Plasmopara obducens, the causal agent of the newly emergent downy mildew disease of Impatiens walleriana. METHODS AND RESULTS: A 202-Mb draft genome assembly was generated from P. obducens using Illumina technology and mined to identify 13,483 SSR motifs. Primers were synthesized for 62 marker candidates, of which 37 generated reliable PCR products. Testing of the 37 markers using 96 P. obducens samples showed 96% of the markers were polymorphic, with 2-6 alleles observed. Observed and expected heterozygosity ranged from 0.000-0.892 and 0.023-0.746, respectively. Just 17 markers were sufficient to identify all multilocus genotypes. CONCLUSIONS: These are the first SSR markers available for this pathogen, and one of the first molecular resources. These markers will be useful in assessing variation in pathogen populations and determining the factors contributing to the emergence of destructive impatiens downy mildew disease.

Little to no genetic structure in the ectomycorrhizal basidiomycete Suillus spraguei (Syn. S. pictus) across parts of the Northeastern USA.

Population genetic studies of ectomycorrhizal fungi at scales larger than 100 km are still relatively rare with highly variable results. In this study, we determined the population genetic structure of the ectomycorrhizal basidiomycete Suillus spraguei over distances up to 600 km in northeastern USA forests. S. spraguei associates exclusively with five-needled pines and only with white pine (Pinus strobus) in the eastern USA. We used six microsatellite loci to assess the genetic structure between eight sites sampled in the Adirondack Park of New York and seven sites sampled in other forests of New York, Pennsylvania, and Massachusetts. Except for one site, little to no genetic differentiation was detected in pairwise comparisons of the sites (F ST = 0 to 0.05). Only one site was moderately differentiated from most other sites (F ST = 0.02 to 0.15). The Mantel test showed no significant correlation between genetic and geographic distances (isolation by distance; R (2) = 0.003, P = 0.3). The STRUCTURE analysis also supported the presence of a single cluster (K = 1).

Analysis of genet size and local gene flow in the ectomycorrhizal basidiomycete Suillus spraguei (synonym S. pictus).

Several recent fine-scale genetic structure studies of ectomycorrhizal fungi have reported significant spatial clustering of genets with similar genotypes, supporting locally restricted gene flow. In this study we used genotype data from microsatellite markers and spatial autocorrelation analysis to examine local gene flow in Suillus spraguei at distances up to 2 km. Previously developed microsatellite markers for S. spraguei from Japan were unsuccessful at amplifying DNA isolated from sporocarps found in New York state, and other research suggested that both are disjunct species. Novel microsatellite markers therefore were developed with New York specimens. We identified nine polymorphic microsatellite loci and developed primer sets to amplify these regions. We tested the efficiency of the primer sets on 50 sporocarps collected from a natural Pinus strobus stand. The majority of the markers were in Hardy-Weinberg and linkage equilibrium. The location of all sampled sporocarps was recorded and used along with multilocus genotype data to create a genet map. The distance between sporocarps with the same multilocus genotype was small (≤ 7.65 m) and the majority of sporocarps collected were genetically unique, suggesting frequent spore establishment and sexual recombination on this site. Spatial autocorrelation analysis did not support clustering of similar genotypes, suggesting few restrictions to gene flow within this local population.