Mechanics and physics of a glass/particles photonic sponge.

A glass containing mechanoluminescent crystalline particles behaves as a photonic sponge: that is to say it fills up with trapped electrons when exposed to UV light, and it emits light when submitted to a mechanical loading, similar to a sponge soaked with water that is wringed under mechanical action! A major finding of the present study is that the elasto-mechanoluminescence effect showing up on unloading is governed by the deviatoric part of the applied stress (no effect under hydrostatic pressure). Furthermore, the structural source for this phenomenon was elucidated by a detailed density functional theory analysis of the e- energetics at the possible oxygen vacancy sites within the crystalline phase. Both the e- trapping and detrapping processes under load could be explained. An analogy with hydraulic circuits and the rheology of viscoelastic media was successfully introduced to pave the way to a constitutive law for the mechano-optical coupling phenomenon.

Author Correction: Poisson's ratio and modern materials.

In the version of this Review Article originally published, parentheses were misplaced and the longitudinal and transverse speeds were inverted in two expressions for Poisson's ratio in Box 2; the expressions should have read, respectively, ν = (3B/G - 2)/(6B/G + 2) and ν = [½(Vl/Vt)2 - 1]/[(Vl/Vt)2 - 1].

Unusual evolutionary mechanisms to escape effector-triggered immunity in the fungal phytopathogen Leptosphaeria maculans.

Leptosphaeria maculans is the fungus responsible for the stem canker disease of oilseed rape (Brassica napus). AvrLm3 and AvrLm4-7, two avirulence effector genes of L. maculans, are involved in an unusual relationship: AvrLm4-7 suppresses the Rlm3-mediated resistance. Here, we assessed AvrLm3 polymorphism in a collection of 235 L. maculans isolates. No field isolates exhibited deletion or inactivating mutations in AvrLm3, as observed for other L. maculans avirulence genes. Eleven isoforms of the AvrLm3 protein were found. In isolates virulent towards both Rlm3 and Rlm7 (a3a7), the loss of the Rlm3-mediated resistance response was due to two distinct mechanisms. First, when AvrLm4-7 was inactivated (deletion or inactivating mutations), amino acid substitutions in AvrLm3 generated virulent isoforms of the protein. Second, when only point mutations were observed in AvrLm4-7, a3a7 isolates still contained an avirulent allele of AvrLm3. Directed mutagenesis confirmed that some point mutations in AvrLm4-7 were sufficient for the fungus to escape Rlm7-mediated resistance while maintaining the suppression of the AvrLm3 phenotype. Signatures of positive selection were also identified in AvrLm3. The complex evolutionary mechanisms enabling L. maculans to escape Rlm3-mediated resistance while preserving AvrLm3 integrity, along with observed reduced aggressiveness of isolates silenced for AvrLm3, serves to emphasize the importance of this effector in pathogenicity towards B. napus. While the common response to resistance gene pressure is local selection of isolates depleted in the cognate avirulence gene, this example contributes to complexify the gene-for-gene concept of plant-pathogen evolution with a 'camouflaged' model allowing retention of nondispensable avirulence effectors.

Transition and post-transition metal ions in borate glasses: Borate ligand speciation, cluster formation, and their effect on glass transition and mechanical properties.

A series of transition and post-transition metal ion (Mn, Cu, Zn, Pb, Bi) binary borate glasses was studied with special consideration of the cations impact on the borate structure, the cations cross-linking capacity, and more generally, structure-property correlations. Infrared (IR) and Raman spectroscopies were used for the structural characterization. These complementary techniques are sensitive to the short-range order as in the differentiation of tetrahedral and trigonal borate units or regarding the number of non-bridging oxygen ions per unit. Moreover, vibrational spectroscopy is also sensitive to the intermediate-range order and to the presence of superstructural units, such as rings and chains, or the combination of rings. In order to clarify band assignments for the various borate entities, examples are given from pure vitreous B2O3 to meta-, pyro-, ortho-, and even overmodified borate glass compositions. For binary metaborate glasses, the impact of the modifier cation on the borate speciation is shown. High field strength cations such as Zn2+ enhance the disproportionation of metaborate to polyborate and pyroborate units. Pb2+ and Bi3+ induce cluster formation, resulting in PbOn- and BiOn-pseudophases. Both lead and bismuth borate glasses show also a tendency to stabilize very large superstructural units in the form of diborate polyanions. Far-IR spectra reflect on the bonding states of modifier cations in glasses. The frequency of the measured cation-site vibration band was used to obtain the average force constant for the metal-oxygen bonding, FM-O. A linear correlation between glass transition temperature (Tg) and FM-O was shown for the metaborate glass series. The mechanical properties of the glasses also correlate with the force constant FM-O, though for cations of similar force constant the fraction of tetrahedral borate units (N4) strongly affects the thermal and mechanical properties. For paramagnetic Cu- and Mn-borate glasses, N4 was determined from the IR spectra after deducing the relative absorption coefficient of boron tetrahedral versus boron trigonal units, α = α4/α3, using NMR literature data of the diamagnetic glasses.

Migration patterns and changes in population biology associated with the worldwide spread of the oilseed rape pathogen Leptosphaeria maculans.

Pathogen introductions into novel areas can lead to the emergence of new fungal diseases of plants. Understanding the origin, introduction pathways, possible changes in reproductive system and population size of fungal pathogens is essential in devising an integrated strategy for the control of these diseases. We used minisatellite markers to infer the worldwide invasion history of the fungal plant pathogen Leptosphaeria maculans, which causes stem canker (blackleg) of oilseed and vegetable brassicas. Clustering analyses partitioned genotypes into distinct populations corresponding to major geographic regions, along with two differentiated populations in Western Canada. Comparison of invasion scenarios using Approximate Bayesian Computation suggested an origin of the pathogen in the USA, the region where epidemics were first recorded, and independent introductions from there over the last few decades into Eastern Canada (Ontario), Europe and Australia. The population in Western Canada appeared to be founded from a source in Ontario and the population in Chile resulted from an admixture between multiple sources. A bottleneck was inferred for the introduction into Western Canada but not into Europe, Ontario or Australia. Clonality appeared high in Western Canada, possibly because environmental conditions there were less conducive to sexual reproduction. Leptosphaeria maculans is a model invasive pathogen with contrasting features in different regions: shallow population structure, high genetic variability and regular sexual recombination in some regions, by comparison with reduced genetic variability, high rates of asexual multiplication, strong population structure or admixture in others.

Thermodynamics of viscous flow and elasticity of glass forming liquids in the glass transition range.

The elastic moduli of glasses from different chemical systems, including oxide, chalcogenide, oxynitride, and metallic, were investigated through the glass transition (T(g)), typically from 0.4 to 1.3 T(g). These data were used to interpret the temperature sensitivity of the shear viscosity coefficient obtained on the same materials. The relevant Gibbs free activation energy was estimated from the apparent heat of flow by means of the temperature dependence of the shear elastic modulus. The activation entropy associated with the viscous flow was also derived and was found to correlate with the fragile versus strong character of the glass forming liquids. Finally, the physicochemistry of the flow process was described on the basis of the glass network de-structuration which shows up through the temperature dependence of Poisson's ratio, and an expression for the shear viscosity coefficient is proposed which is chiefly based on the high temperature elastic behavior.

Poisson's ratio and modern materials.

In comparing a material's resistance to distort under mechanical load rather than to alter in volume, Poisson's ratio offers the fundamental metric by which to compare the performance of any material when strained elastically. The numerical limits are set by ½ and -1, between which all stable isotropic materials are found. With new experiments, computational methods and routes to materials synthesis, we assess what Poisson's ratio means in the contemporary understanding of the mechanical characteristics of modern materials. Central to these recent advances, we emphasize the significance of relationships outside the elastic limit between Poisson's ratio and densification, connectivity, ductility and the toughness of solids; and their association with the dynamic properties of the liquids from which they were condensed and into which they melt.

First Report of Leptosphaeria biglobosa (Blackleg) on Brassica oleracea (Cabbage) in Mexico.

Broccoli (Brassica oleracea var. italica), cauliflower (B. oleracea var. botrytis), and cabbage (B. oleracea var. capitata) have been grown in central Mexico since 1970, with 21,000 ha cropped in 2001. In contrast, areas grown with oilseed rape (B. napus) are very limited in Mexico (<8,000 ha). Blackleg, a destructive disease of B. napus in most parts of the world, was first observed in Mexico in Zacatecas and Aguascalientes in 1988 on B. oleracea, causing as much as 70% yield loss. A species complex of two closely related Dothideomycete species, Leptosphaeria maculans and L. biglobosa, is associated with this disease of crucifers (1), but leaf symptoms on susceptible plants are different, with L. maculans typically causing >15-mm pale gray lesions with numerous pycnidia, whereas L. biglobosa causes dark and smaller lesions only containing a few pycnidia. Having a similar epidemiology, both species can be present on the same plants at the same time, and symptom confusion can occur as a function of the physiological condition of the plant or expression of plant resistance responses. A total of 209 isolates from symptomatic B. oleracea leaves were collected from three fields in central states of Mexico (58 to 71 isolates per location). All leaves showed similar symptoms, including a 10- to 15-mm tissue collapse with an occasional dark margin. Cotyledons of seven B. napus differentials were inoculated with conidia of all the isolates as described by Dilmaghani et al. (1). Two hundred isolates caused tissue collapse typical of L. maculans. However, nine obtained from white cabbage in a single location in Aguascalientes caused <5-mm dark lesions. When inoculated onto cotyledons of three B. oleracea genotypes commonly grown in Mexico (cvs. Domador, Monaco, and Iron Man), the nine isolates caused a range of symptoms characterized by tissue collapse (maximum 10 to 15 mm), showing the presence of patches of black necrotic spots within the collapse. The occasional presence of a few pycnidia allowed us to reisolate the fungus for molecular identification. ITS1-5.8S-ITS2, (internal transcribed spacers and 5.8S rDNA), actin, and ß-tubulin sequences were obtained as described previously (4). Multiple gene genealogies based on these sequence data showed two subclades of L. biglobosa: L. biglobosa 'occiaustralensis' (one isolate; ITS [AM410082], actin [AM410084], and ß-tubulin [AM410083]) and L. biglobosa 'canadensis' (eight isolates; ITS [AJ550868], actin [AY748956], and ß-tubulin [AY749004]) (3,4), which were previously described on B. napus in the United States, Canada, and Chile. To our knowledge, this is the first report of L. biglobosa in Mexico. Previously, this species has only been reported once on B. oleracea without discrimination into subclades (2). In the Aguascalientes sampling, 24% of the isolates were L. biglobosa, similar to Canadian locations where this species is still common as compared with L. maculans (1). The large proportion of sampled L. biglobosa 'canadensis', highlights the prevalence of this subclade throughout the American continent (1). References: (1) A. Dilmaghani et al. Plant Pathol. 58:1044, 2009. (2) E. Koch et al. Mol. Plant-Microbe Interact. 4:341, 1991. (3) E. Mendes-Pereira et al. Mycol Res. 107:1287, 2003. (4) L. Vincenot et al. Phytopathology 98:321, 2008.

A key enzyme of the Leloir pathway is involved in pathogenicity of Leptosphaeria maculans toward oilseed rape.

Agrobacterium tumefaciens-mediated random insertional mutagenesis was used to investigate pathogenicity determinants in Leptosphaeria maculans. One tagged nonpathogenic mutant, termed m186, is analyzed in detail here. Microscopic analyses of infected plant tissues revealed that m186 is specifically blocked at the invasive growth phase after an unaffected initial penetration stage and is unable to switch to the necrotrophic lifestyle. In addition, m186 exhibits an altered cell wall and seems to be affected in its ability to produce cell-wall-degrading enzymes. The T-DNA insertion occurs in the intergenic region between two head-to-tail genes, leading to a constitutive upregulation of their expression. Complementation experiments showed that only one of these two genes, Lmepi, fully accounts for the mutant phenotype. Bioinformatics and expression analyses along with functional studies suggested that the Lmepi gene encodes for the highly conserved UDP-glucose-4-epimerase, a key enzyme of the Leloir pathway involved in galactose metabolism. For the third time, this study highlights the intimate connection between primary metabolism and pathogenicity in L. maculans. This finding, along with similar data obtained from the related species Stagonospora nodorum, indicates the importance of in planta nutrition for the success of infection of plants by fungi belonging to class Dothideomycete.

Occurrence of a new subclade of Leptosphaeria biglobosa in Western Australia.

Stem canker of crucifers is caused by an ascomycete species complex comprising of two main species, Leptosphaeria maculans and L. biglobosa. These are composed of at least seven distinct subclades based on biochemical data or on sequences of internal transcribed spacer (ITS), the mating type MAT1-2 or fragments of actin or beta-tubulin genes. In the course of a wide-scale characterization of the race structure of L. maculans from Western Australia, a few isolates from two locations failed to amplify specific sequences of L. maculans, i.e., the mating-type or minisatellite alleles. Based on both pathogenicity tests and ITS size, these isolates were classified as belonging to the L. biglobosa species. Parsimony and distance analyses performed on ITS, actin and beta-tubulin sequences revealed that these isolates formed a new L. biglobosa subclade, more related to the Canadian L. biglobosa 'canadensis' subclade than to the L. biglobosa 'australensis' isolates previously described in Australia (Victoria). They are termed here as L. biglobosa 'occiaustralensis'. These isolates were mainly recovered from resistant oilseed rape cultivars that included the Brassica rapa sp. sylvestris-derived resistance source, but not from the susceptible cv. Westar. The pathogenicity of L. biglobosa 'occiaustralensis' to cotyledons of most oilseed rape genotypes was higher than that of L. biglobosa 'canadensis' or L. biglobosa 'australensis' isolates.

Poisson's ratio and the densification of glass under high pressure.

Because of a relatively low atomic packing density, (Cg) glasses experience significant densification under high hydrostatic pressure. Poisson's ratio (nu) is correlated to Cg and typically varies from 0.15 for glasses with low Cg such as amorphous silica to 0.38 for close-packed atomic networks such as in bulk metallic glasses. Pressure experiments were conducted up to 25 GPa at 293 K on silica, soda-lime-silica, chalcogenide, and bulk metallic glasses. We show from these high-pressure data that there is a direct correlation between nu and the maximum post-decompression density change.

Heterochromatin-like regions as ecological niches for avirulence genes in the Leptosphaeria maculans genome: map-based cloning of AvrLm6.

Map-based cloning of avirulence genes of the AvrLml-2-6 cluster was recently undertaken in Leptosphaeria maculans and led to the identification of AvrLm1. The ensuing chromosome walk toward AvrLm6 resulted in the delineation of a 562-kb bacterial artificial chromosome (BAC) clone contig in an avirulent isolate. Following sequencing of the contig and sequence comparison with a virulent isolate, four AvrLm6 candidate genes were identified. Complementation of the virulent isolate with the four candidates was performed and one gene was found to fully restore the avirulent phenotype on Rlm6 oilseed rape genotypes. AvrLm6 was found to be located in the same genome context as AvrLml, because it is a solo gene surrounded by 85 and 48 kb of degenerated repeats on its 5' and 3' sides, respectively. AvrLm6 is an orphan gene encoding a small, potentially secreted, cysteine-rich protein. Comparison of AvrLm1 and AvrLm6 expressions by quantitative reverse-transcription polymerase chain reaction revealed that both genes are highly overexpressed during primary leaf infection. Using RNA interference, decreasing expression of AvrLm6 was shown to result in virulence toward Rlm6 genotypes whenever the expression was reduced by more than 60% compared with the wild-type isolate.

Analysis of Leptosphaeria maculans Race Structure in a Worldwide Collection of Isolates.

ABSTRACT Leptosphaeria maculans, the causal agent of stem canker of oilseed rape, develops gene-for-gene interactions with its hosts. To date, eight L. maculans avirulence (Avr) genes, AvrLm1 to AvrLm8, have been genetically characterized. An additional Avr gene, AvrLm9, that interacts with the resistance gene Rlm9, was genetically characterized here following in vitro crosses of the pathogen. A worldwide collection of 63 isolates, including the International Blackleg of Crucifers Network collection, was genotyped at these nine Avr loci. In a first step, isolates were classified into pathogenicity groups (PGs) using two published differential sets. This analysis revealed geographical disparities as regards the proportion of each PG. Genotyping of isolates at all Avr loci confirmed the disparities between continents, in terms of Avr allele frequencies, particularly for AvrLm2, AvrLm3, AvrLm7, AvrLm8, and AvrLm9, or in terms of race structure, diversity, and complexity. Twenty-six distinct races were identified in the collection. A larger number of races (n = 18) was found in Australia than in Europe (n = 8). Mean number of virulence alleles per isolate was also higher in Australia (5.11 virulence alleles) than in Europe (4.33) and Canada (3.46). Due to the diversity of populations of L. maculans evidenced here at the race level, a new, open terminology is proposed for L. maculans race designation, indicating all Avr loci for which the isolate is avirulent.

The stem canker (blackleg) fungus, Leptosphaeria maculans, enters the genomic era.

UNLABELLED: SUMMARY Leptosphaeria maculans is the most ubiquitous pathogen of Brassica crops, and mainly oilseed brassicas (oilseed rape, canola), causing the devastating 'stem canker' or 'blackleg'. This review summarizes our current knowledge on the pathogen, from taxonomic issues to specific life traits. It mainly illustrates the importance of formal genetics approaches on the pathogen side to dissect the interaction with the host plants. In addition, this review presents the main current research topics on L. maculans and focuses on the L. maculans genome initiative recently begun, including its main research issues. TAXONOMY: Leptosphaeria maculans (Desm.) Ces. & de Not. (anamorph Phoma lingam Tode ex Fr.). Kingdom Fungi, Phylum Ascomycota, Class Dothideomycetes (Loculoascomycetes), Order Pleosporales, Genus Leptosphaeria, Species maculans. HOST RANGE: cultivated Brassicas such as Brassica napus (oilseed rape, canola), B. rapa, B. juncea, B. oleracea, etc., along with numerous wild crucifers species. Arabidopsis thaliana was recently reported to be a potential host for L. maculans. Primary disease symptoms are greyish-green collapse of cotyledon or leaf tissue, without a visible margin, bearing tiny black spots (pycnidia). The fungus then develops an endophytic symptomless growth for many months. Secondary symptoms, at the end of the growing season, are dry necroses of the crown tissues with occasional blackening (stem canker or blackleg) causing lodging of the plants. Pseudothecia differentiate on leftover residues. Seedling damping-off and premature ripening are also reported under certain environmental conditions. USEFUL WEBSITES: Leptosphaeria maculans sequencing project at Genoscope: http://www.genoscope.cns.fr/externe/English/Projets/Projet_DM/organisme_DM.html; the SECURE site: http://www.secure.rothamsted.ac.uk/ the 'Blackleg' group at the University of Melbourne: http://www.botany.unimelb.edu.au/blackleg/overview.htm.

A Cluster of Major Specific Resistance Genes to Leptosphaeria maculans in Brassica napus.

ABSTRACT Two types of genetic resistance to Leptosphaeria maculans usually are distinguished in Brassica napus: qualitative, total resistance expressed at the seedling stage and quantitative, partial resistance expressed at the adult plant stage. The latter is under the control of many genetic factors that have been mapped through quantitative trait loci (QTL) studies using 'Darmor' resistance. The former usually is ascribed to race-specific resistance controlled by single resistance to L. maculans (Rlm) genes. Three B. napus-originating specific Rlm genes (Rlm1, Rlm2, and Rlm4) previously were characterized. Here, we report on the genetic identification of two novel resistance genes, Rlm3 and Rlm7, corresponding to the avirulence genes AvrLm3 and AvrLm7. The identification of a novel L. maculans- B. napus specific interaction allowed the detection of another putative new specific resistance gene, Rlm9. The resistance genes were mapped in two genomic regions on LG10 and LG16 linkage groups. A cluster of five resistance genes (Rlm1, Rlm3, Rlm4, Rlm7, and Rlm9) was strongly suggested on LG10. The relation between all these specific resistance genes and their potential role in adult-plant field resistance is discussed. These two Rlm-carrying regions do not correspond to major QTL for Darmor quantitative resistance.

A synthetic aragonite-based bioceramic: influence of process parameters on porosity and compressive strength.

We investigate the influence of process parameters such as weight fraction and particle size of pore-former, and isostatic pressure, on porosity and compressive strength of non-sintered porous calcium carbonate biomaterials compacted at high pressure in uniaxial or isostatic mode. Experiment design and results analysis are performed according to a two-level 2k factorial design method (FDM). Results indicate that only the weight fraction of pore-former (wt fpf) influences significantly the porosity and the compressive strength. The porosity P, is described by a linear function of wt fpf, and the compressive strength sigma(comp), by an exponential one. For materials compacted under uniaxial pressing: P (vol%) = 33.7 + 85.4 (wt fpf) and sigma(comp) (MPa) = 28.8e(-9.2(wt fpf)) with 0.1 < or = wt fpf < or = 0.3. For materials compacted in isostatic mode: P (vol%) = 33.9 + 82.1 (wt fpf) and sigma(comp) (MPa) = 24.0e(-7.0(wt fpf)) with 0.15 < or = wt fpf < or = 0.35. The pore-former particle size has no significant influence on both properties. The increase in isostatic pressure provides slightly lower porosity and better compressive strength. For a fixed fraction of pore-former, isostatic pressing leads to a better compressive strength than uniaxial pressing. This study indicates that, for a constant amount of pore former, the size of macropores can be adjusted to reach optimal bone-ingrowth without change in compressive strength.

New Avirulence Genes in the Phytopathogenic Fungus Leptosphaeria maculans.

ABSTRACT Leptosphaeria maculans, the causal agent of stem canker of oilseed rape (Brassica napus), develops gene-for-gene interactions with oilseed rape, and four L. maculans avirulence (AVR) genes (AvrLm1, AvrLm2, AvrLm4, and alm1) were previously genetically characterized. Based on the analysis of progeny of numerous in vitro crosses between L. maculans isolates showing either already characterized or new differential interactions, this work aims to provide an overview of the AVR genes that may specify incompatibility toward B. napus and the related species B. juncea and B. rapa. Two novel differential interactions were thus identified between L. maculans and B. napus genotypes, one of them corresponding to a complete resistance to European races of L. maculans. In both cases, a single gene control of avirulence was established (genes AvrLm3 and AvrLm7). Similarly, a single gene control of avirulence toward a B. rapa genotype, also resistant to European L. maculans isolates, was demonstrated (gene AvrLm8). Finally, a digenic control of avirulence toward B. juncea was established (genes AvrLm5 and AvrLm6). Linkage analyses demonstrated that at least four unlinked L. maculans genomic regions, including at least one AVR gene cluster (AvrLm1-AvrLm2-AvrLm6), are involved in host specificity. The AvrLm3-AvrLm4-AvrLm7 region may correspond either to a second AVR gene cluster or to a multiallelic AVR gene.

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Genetic Control and Host Range of Avirulence Toward Brassica napus Cultivars Quinta and Jet Neuf in Leptosphaeria maculans.

ABSTRACT Leptosphaeria maculans causes blackleg of oilseed rape. Gene-for-gene interactions between race PG3 and Brassica napus cv. Quinta were related to interaction between the fungal avirulence (Avr) gene AvrLm1 and the corresponding resistance gene Rlm1. AvrLm1 isolates were aviru-lent on cvs. Doublol, Vivol, Columbus, and Capitol, and no recombinant phenotypes were observed in the progeny of two AvrLm1 x avrLm1 crosses, suggesting that all of these cultivars may possess Rlm1 or genes displaying the same recognition spectrum, or that a cluster of Avr genes is present at the Avrlm1 locus. In one cross, segregation distortion was observed at the AvrLm1 locus that could be explained by interaction between AvrLm1 and one unlinked deleterious gene, termed Del1. Incompatibility toward cvs. Jet Neuf and Darmor.bzh was governed by a single gene, unlinked to AvrLm1 or Del1. This avirulence gene was termed AvrLm4. Preliminary plant genetic analysis suggested the occurrence of a corresponding dominant resistance gene, termed Rlm4, present in the Quinta line analyzed and linked to Rlm1.

Conidia as a Substrate for Internal Transcribed Spacer-Based PCR Identification of Members of the Leptosphaeria maculans Species Complex.

ABSTRACT The blackleg disease of oilseed rape is caused by an ascomycete species complex termed Leptosphaeria maculans (anamorph Phoma lingam). L. maculans isolates collected worldwide were gathered in the International Blackleg of Crucifers Network (IBCN) collection. Representative IBCN isolates, along with one P. nigrificans isolate, were further analyzed using polymerase chain reaction (PCR) amplification of the internal transcribed spacer (ITS) region. ITS size polymorphism discriminated three groups: (i) P. nigrificans, (ii) Tox(+) and 'Lepidium' isolates, and (iii) NA1, NA2, NA3, 'Thlaspi', and 'Erysimum' isolates. Digestion of the ITS region with 19 selected endonucleases showed restriction site polymorphism between the different subgroups: digestion with RsaI could discriminate Tox(+) from 'Lepidium' isolates, whereas digestion with four enzymes, i.e., HaeIII, EcoRII, RsaI, and AluI, was needed to discriminate between NA1, NA2, NA3, 'Thlaspi', and 'Erysimum' isolates. No restriction site polymorphism was observed between isolates within the 'Thlaspi', Tox(+), NA1, and NA2 subgroups. Direct amplification of the ITS region could be achieved using intact conidia, collected either in axenic cultures or on leaf lesions, with only a 4-min 95 degrees C denaturation step prior to PCR reaction. A routine identification protocol requiring no DNA extraction and a sequential use of a few restriction enzymes following PCR has been used successfully for large-scale identification of French field isolates.