The effect of soil pollution with petroleum-derived substances on Porcellio scaber Latr. (Crustacea, Isopoda).

Presented research aimed at investigating the effect of short-term contact with petroleum-derived substances (PDSs) on life parameters of Porcellio scaber Latr. (Isopoda) and accumulation of polycyclic aromatic hydrocarbons (PAHs) in its body. The influence of presence of P. scaber on the total petroleum hydrocarbons (TPH) content in soil was also determined. The following objects were established: control-unpolluted soil; soil polluted with petrol; soil polluted with diesel fuel and soil polluted with used engine oil. Every pollutant was used in the amounts equal to 6000 mg of fuel/kg d.m. of soil 15 months earlier. In the laboratory, survival and body mass change of P. scaber reared in investigated soils were observed. The delivered food was not contaminated with PDSs. P. scaber reveals a considerable resistance in a short (4 weeks) contact with PDSs, evidenced as high survivability (from 68% on the soil polluted with engine oil to 77% on the soil polluted with diesel fuel) and undisturbed increase in body mass (on the level similar to control). It indicates the potential usefulness of this animal as a monitoring organism. No positive correlation was observed between TPH depletion in the soils contaminated with PDSs and P. scaber presence during 4 weeks of the experiment. PAH level in P. scaber bodies was generally very low (with the highest level of anthracene 0.40 µg/g of wet mass-after 4 weeks of rearing on the diesel fuel-contaminated soil), which may confirm the thesis about considerable abilities of isopods for biotransformation of these pollutants and low susceptibility to these xenobiotic penetration through integuments. However, a tendency for accumulation for phenanthrene and anthracene in conditions of soil polluted with diesel fuel was observed respectively 0.07 and 0.21 µg/g of wet mass for phenanthrene and 0.22 and 0.40 µg/g of wet mass for anthracene, observed successively in the 2nd and 4th week of rearing.

[HEALTH STATUS OF ELECTROTECHNICAL PERSONNEL EXPOSED TO THE COMBINED IMPACT OF ELECTROMAGNETIC FIELDS OF 50 HZ AND CHEMICALS].

There was performed an analysis of the working conditions and health status of workers of the chemical enterprise. In male electrical staff exposed to electromagnetic fields (EMF) of 50 Hz and chemicals, according to data of periodic medical examinations there was revealed statistically higher incidence of cardiovascular diseases and autonomic disorders. The obtained preliminary results allow to suggest the upsurge of the involvement of the autonomic nervous system in response to the combined effects of EMF of 50 Hz and chemicals.

Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients.

BACKGROUND: PPM1D (WIP1) negatively regulates by dephosphorylation many proteins including p53 tumour suppressor. The truncating mutations (nonsense and frameshift) in exon 6 of PPM1D were found recently in blood cells of patients with breast, ovarian or colorectal cancer. These mutants code for gain-of-function PPM1D with retained phosphatase activity. Their significance in carcinogenesis is unknown. METHODS: The exon 6 of PPM1D was sequenced in blood DNA of 543 non-small-cell lung cancer patients (NSCLC). The functional significance of selected PPM1D alterations (Arg458X, Lys469Glu) was compared with the wild-type gene and examined by recombinant DNA techniques, immunoblotting and luciferase reporter assays. RESULTS: The frameshift mutations were found in five NSCLC patients (5/543; 0.92%), all of them had squamous cell carcinomas (5/328; 1.5%). All patients with the mutations were exposed, before the blood collection, to the DNA damaging agents as a part of chemotherapeutic regimen. Functional tests demonstrated that truncating mutation Arg458X causes enhancement of dephosphorylation activity of PPM1D toward serine 15 of p53, whereas Lys469Glu version is equivalent to the wild-type. Neither version of PPM1D (wild-type, Arg458X, Lys469Glu) significantly modulated the ability of p53 to transactivate promoters of the examined p53-target genes (BAX and MDM2). CONCLUSIONS: The truncating mutations of PPM1D are present in blood DNA of NSCLC patients at frequency similar to percentage determined for ovarian cancer patients. Our findings raise a question if the detected lesions are a result of chemotherapy.

[Working conditions and professional risk for operational personnel of energy facilities].

Features of working conditions and a state of health of operation personnel of the network companies of power industry were studied for the purpose of justification and introduction of preventive actions for the decrease in influence of factors of professional risk.

[Physiologic state parameters of operative staff as predictors of occupational stress formation].

Having assessed functional state during the work, the authors revealed factors proving stress state in operative staffers of electric power stations. Features of occupational activities and workplace organization were assessed, risk factors promoting stress states were revealed, recommendations on optimizing the working process and on health preservation were specified.

Detection of early FXTAS motor symptoms using the CATSYS computerised neuromotor test battery.

BACKGROUND: Carriers of the FMR1 premutation allele are at a significantly increased risk for a late-onset neurodegenerative disorder, fragile X-associated tremor/ataxia syndrome (FXTAS). This disorder is distinct from fragile X syndrome (FXS) in its molecular aetiology and clinical presentation. The primary features of FXTAS are late-onset intention tremor and gait ataxia. Associated features include parkinsonism, neuropsychological dysfunction, autonomic dysfunction and peripheral neuropathy. AIM: To investigate the usefulness of a quantitative neurological test battery implemented through the CATSYS instrument to identify preclinical symptoms of FXTAS. METHODS: Both premutation carriers with 70-199 repeats (62 men) and their low-repeat allele carrier siblings (27 men), identified through families with an individual affected with FXS, were tested. RESULTS: As expected, because of its sensitivity, use of the instrument allowed identification of tremor in 23% of men who had not self-reported tremor, and ataxia in 30% of men who had not self-reported ataxia. Among subjects with self-reported tremor and ataxia, we found significant concordance between measures of the CATSYS system and the self-report. CONCLUSION: Rates of these traits among premutation carriers and low-repeat allele carrier siblings could be identified, and are presented in this paper, along with the minimum estimates of age-related prevalence.

Polymorphisms in TDG and MGMT genes - epidemiological and functional study in lung cancer patients from Poland.

Functional genetic polymorphisms of DNA repair genes are good candidates for cancer susceptibility markers. We studied two genes coding for proteins removing small DNA adducts by direct repair (MGMT), or mispaired DNA bases by base excision repair (TDG). The non-silent polymorphisms of MGMT (84:Phe, 143:Val, 178:Arg) and TDG (199:Ser, 367:Met), and the functional MGMT enhancer polymorphism, did not show any statistically significant association with lung cancer risk in our case-control analysis, but due to the relatively small number of individuals, strong conclusions on cancer risk association or lack thereof cannot be made. Sequencing of the TDG cDNA has not revealed any novel polymorphism, but did find an alternatively spliced mRNA missing exon 2. Our search for polymorphisms within the promoter-enhancer region of MGMT revealed three novel sequence variants. The functional significance of the previously published MGMT enhancer polymorphism (1099C->T) was assessed. The less frequent sequence variant of the enhancer was associated with a modest (16-64%), but statistically significant, increase of MGMT promoter-enhancer activity in the studied cell lines. This work points to the importance of studying the expression-regulating elements of genes, as they may contain functional polymorphisms with the potential for modulating risk of various diseases, including cancer.

Functional significance of XPD polymorphic variants: attenuated apoptosis in human lymphoblastoid cells with the XPD 312 Asp/Asp genotype.

Recent molecular epidemiological studies have identified polymorphisms in the XPD gene that are associated with increased risk of brain gliomas and head, neck, lung, and skin cancers. However, the functional significance of these polymorphic variants in altering cell processes such as cell cycle checkpoints, DNA repair, and apoptosis is uncertain. We have cloned the XPD variants Lys751Gln, Asp312Asn, and Lys751Gln-Asp312Asn into a pcDNA-3.1-expression vector. Using these constructs, we did not find any detectable difference in either in vitro binding with wild-type p53 or in DNA repair proficiency as measured by host cell reactivation assay. We then genotyped 34 different lymphoblastoid cell lines from six Centre d'Etude du Polymorphisme Humaine (CEPH)/Utah pedigree families and a CEPH/French pedigree family for polymorphisms at codons 751 and 312 and assessed their apoptotic response after either UV or ionized radiation exposure. The lymphoblastoid cell lines with homozygous or heterozygous Asp at codon 312 have similar apoptotic rates, whereas cell lines with homozygous Asn at codon 312 showed a 2.5-fold increased response to UV (P = 0.005; Student's t test). This is the first report known to us of a functional polymorphism in a gene involved in DNA damage-induced apoptosis. However, the presence of Lys or Gln at codon 751 did not influence the apoptotic response to UV. The diminished apoptotic response of cells containing the 312 Asp allele could both allow the survival and selective clonal expansion of carcinogen-damaged cells and be a mechanistic explanation for the increased risk of cancer at diverse tissue sites.

Genetic polymorphisms in DNA repair genes and risk of lung cancer.

Polymorphisms in DNA repair genes may be associated with differences in the repair efficiency of DNA damage and may influence an individual's risk of lung cancer. The frequencies of several amino acid substitutions in XRCC1 (Arg194Trp, Arg280His and Arg399Gln), XRCC3 (Thr241Met), XPD (Ile199Met, His201Tyr, Asp312Asn and Lys751Gln) and XPF (Pro379Ser) genes were studied in 96 non-small-cell lung cancer (NSCLC) cases and in 96 healthy controls matched for age, gender and cigarette smoking. The XPD codon 312 Asp/Asp genotype was found to have almost twice the risk of lung cancer when the Asp/Asn + Asn/Asn combined genotype served as reference [odds ratio (OR) 1.86, 95% confidence interval (CI), 1.02-3.40]. In light cigarette smokers (less than the median of 34.5 pack-years), the XPD codon 312 Asp/Asp genotype was more frequent among cases than in controls and was associated with an increased risk of NSCLC. Compared with the Asn/Asn carriers, the OR in light smokers with the Asp/Asn genotype was 1.70 (CI0.35 0.43-6.74) and the OR in those with the Asp/Asp genotype was 5.32 (CI0.35-21.02) (P trend = 0.01). The 312 Asp/Asp genotype was not associated with lung cancer risk in never-smokers or heavy smokers (>34.5 pack-years). The XPD-312Asp and -751Lys polymorphisms were in linkage disequilibrium in the group studied; this finding was further supported by pedigree analysis of four families from Utah. The XPD 312Asp amino acid is evolutionarily conserved and is located in the seven-motif helicase domain of the RecQ family of DNA helicases. Our results indicate that these polymorphisms in the XPD gene should be investigated further for the possible attenuation of DNA repair and apoptotic functions and that additional molecular epidemiological studies are warranted to extend these findings.

[Exposure to 50 of heart rhythm in power plants personnel]. / Vozdeistvie élektromagnitnykh polei 50 Gts na pokazateli variativnosti serdechnogo ritma personala énergoob''ektov.

The authors first revealed reliable decrease in general capacity and amplitude of electromagnetic waves in staffers subjected to occupational electromagnetic fields of 50 Hz--that proves increased risk of cardiovascular diseases dependent on vegetative matters. Present norms on electric and magnetic fields of 50 Hz should be justified and intensified.

Family with Li-Fraumeni syndrome and no evidence of a germline mutation of the p53 gene or chromosomal aberrations.

Li-Fraumeni syndrome is a rare autosomal, dominant trait of diverse types of cancers in children and young adults, with a predominance of soft tissue sarcomas, osteosarcomas, brain tumours, adrenocortical and breast carcinomas, as well as leukaemias. We present a family with an unusual cancer history fulfilling the criteria of Li-Fraumeni syndrome. Mutational analysis of the p53 gene in constitutional DNA of several affected members of the family did not show any germline p53 defect. Cytogenetic studies did not reveal any structural aberrations.

p53 gene mutation and protein expression in operable non-small cell lung cancer in Poland.

We investigated the association of p53 abnormalities (gene mutations by DNA sequencing and protein over-expression by immunostaining) with clinical data and prognosis in 74 patients with resected non-small cell lung cancer (NSCLC). DNA analysis of exons 5-8 of the p53 gene showed 34 mutations in 74 resected primary NSCLC (45.9%). Immunohistochemical study of the p53 protein revealed that 41 of 74 (55.4%) samples had positive staining. We found strong agreement between the results of the p53 protein expression test (p53-PE) and the p53 gene mutation test (p53-M) (Cohen's kappa = 0.65, 95% CI 0.48-0.82). Joint distribution of the results (analysed using the bivariate Dale model) was mainly influenced by, histological type of tumour. A positive result for the p53-PE test significantly increased (estimated odds ratio 84.5; 95% CI 8.89-803.03) the odds of observing a positive result in the p53-M test. In the univariate analysis (log rank test), positive results in the p53-M test and the p53-PE test were significantly associated with overall survival (P < 0.001 and P = 0.005, respectively). In the multivariate analysis (Cox's proportional hazard model), a positive result for the p53-M test significantly increased relative risk for overall survival (RR 9.56; 95% CI 2.62-34.87; P < 0.001). When the result of the p53-M test was accounted for, a positive result for the p53-PE test did not offer any additional prognostic information due to the strong dependence of results of the tests. However, when the result of the p53-M test was removed from the model, a positive result for the p53-PE test became a significant unfavourable prognostic factor (P = 0.009). We conclude that p53 gene mutation and protein expression analyses are in a strong agreement. Joint distribution of the results depends mainly on histological type of tumour. When considered separately, both tests are unfavourable prognostic factors in NSCLC. When the result of the p53-M test is taken into account, the p53-PE test does not offer any additional prognostic information.

Identification of four single nucleotide polymorphisms in DNA repair genes: XPA and XPB (ERCC3) in Polish population.

A deficiency in DNA repair is associated with increased cancer risk. Inter-individual variations in DNA repair capacity observed in humans may result from genetic polymorphisms in DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies on cancer susceptibility, we screened 35 individuals for polymorphisms in coding regions of XPA and XPB genes involved in nucleotide excision repair (NER). Relevant cDNA sequences were amplified by PCR, sequenced with fluorescently labeled terminators and analyzed with automated sequencer. Two polymorphisms in XPB were found: AAA-->AGA (445A>G; GenBank M31899) causing K117R substitution and GGC-->TGC (1299G>T; GenBank M31899) causing G402C exchange. Also, two polymorphisms in XPB were detected: CGA-->CAA (709G>A; GenBank D14533) causing R228Q exchange, and A-->G (23A>G; GenBank D14533) substitution in the 5' non-coding region of the gene. The three aforementioned amino acid substitutions were uncommon in this population (1.4%). In contrast, the substitution located 4 nucleotides upstream of the ATG start codon of XPB was frequent (57%). To our best knowledge this is the first report of these sequence variants. The location of these polymorphisms in evolutionary conserved regions suggest that they may be of functional significance.

Spontaneous apoptosis in ovarian carcinomas: a positive association with p53 gene mutation is dependent on growth fraction.

Changes in cell survival contribute to tumour development, influence tumour biology and its response to chemotherapy. p53 gene alterations should negatively affect apoptosis by impaired p53-dependent apoptotic response. We looked for associations between spontaneous apoptosis, p53 gene mutation, p53 protein accumulation, growth fraction, bcl-2 expression and histological parameters in 64 ovarian, four tubal and three peritoneal carcinomas. Apoptotic cells were detected with the TUNEL method. p53 gene variants were detected by the single-strand conformation polymorphism and were sequenced directly. P53, Ki-67 and bcl-2 protein expressions were detected immunohistochemically. A weighed multiple logistic regression model was applied. Apoptotic index (AI) ranged 0.02-0.18 (mean 0.11); proliferation index (PI) ranged 3-90% (mean 54%). p53 gene mutations were present in 51, p53 protein accumulation in 46, and diffuse bcl-2 expression in 29 of 71 tumours. The AI was positively associated with the presence of p53 gene mutation (P = 0.011). However, the PI included into the analysis did positively influence the AI (P = 0.02) and diminished the association with p53 gene mutation (P = 0.082). The AI was negatively associated with good histological differentiation (P = 0.0006), the serous tumour type (P = 0.002), and diffuse bcl-2 expression (P = 0.025). Strong bcl-2 expression was associated with endometrioid tumour type (P = 0.002). FIGO stage and p53 protein accumulation were the only parameters that influenced overall survival time. Thus, our results suggest that histological tumour type and grade are major determinants of spontaneous apoptosis in ovarian carcinomas; p53 alterations do not adversely but rather positively affect spontaneous apoptosis by increasing growth fraction. This, in turn, suggests p53-independency of spontaneous apoptosis in ovarian carcinomas.

High frequency of recurrent mutations in BRCA1 and BRCA2 genes in Polish families with breast and ovarian cancer.

Germ-line mutations in BRCA1 and BRCA2 genes result in a significantly increased risk of breast and ovarian cancer. Other genes involved in an increased predisposition to breast cancer include the TP53 gene, mutated in Li-Fraumeni syndrome. To estimate the frequency of germ-line mutations in these three genes in Upper Silesia, we have analyzed 47 breast/ovarian cancer families from that region. We found five different disease predisposing mutations in 17 (36%) families. Twelve families (25.5%) carried known BRCA1 mutations (5382insC and C61G), four families (8.5%) carried novel BRCA2 mutations (9631delC and 6886delGAAAA), and one family (2%) harbored novel mutation 1095del8 in the TP53 gene, which is the largest germline deletion in coding sequence of this gene identified thus far. The 5382insC mutation in BRCA1 was found in 11 families and the 9631delC mutation in BRCA2 occurred in three families. These two mutations taken together contribute to 82% of all mutations found in this study, and 30% of the families investigated harbor one of these mutations. The very high frequency of common mutations observed in these families can only be compared to that reported for Ashkenazi Jewish, Icelandic, and Russian high-risk families. This frequency, however, may not be representative for the entire Polish population. The observed distribution of mutations will favor routine pre-screening of predisposed families using a simple and cost-effective test.

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Molecular epidemiological study of non-small-cell lung cancer from an environmentally polluted region of Poland.

The p53 mutation spectrum can generate hypotheses linking carcinogen exposure to human cancer. Although it is well-documented that tobacco smoking is a major cause of lung cancer, the contribution of air pollution is less well-established. We determined the molecular and immunohistochemical changes (p53 gene mutations, p53 protein accumulation and WAF1 protein expression) and genetic polymorphisms of GSTM1, CYP1A1 and CYP2D6 genes in a case series of non-small-cell lung cancers from Silesia. This region of southern Poland is highly industrialized with considerable environmental pollution. More than 50% of lung cancers (90/164) contained p53 mutations and 75% showed the combined alteration of the p53 gene and protein accumulation. Males occupationally exposed to coal-derived substances showed a relatively high frequency of squamous and large-cell carcinomas, relatively frequent mutations in codon 298 of p53 and a low frequency of p53 immunohistochemically positive tumours. Codon 298 GAG-->TAG mutations have rarely been found in lung cancers in other populations. We found no correlation between WAF1 protein expression and mutations in the p53 gene or p53 protein accumulation. No statistically significant relationship was found between p53 mutations and GSTM1, CYP1A1, CYP2D6 genotypes. Never smokers with lung cancers from Silesia had a higher frequency of G:C-->T:A transversions than previously reported of the p53 mutation spectrum in never smokers (6/15 vs 4/34; P = 0.06 by chi2). These data are a tentative indication that occupational and environmental exposure to polycyclic aromatic hydrocarbons, such as benzo(a)pyrene, in polluted air contributes to the molecular pathogenesis of lung cancer in never smokers.

Characterization of DNA sequences localized 11 to 17.5 kb upstream of the chicken embryonic pi-globin gene.

We have analyzed the DNA fragment localized about 11 to 17.5 kb upstream of the chicken alpha-globin gene domain (the fragment was designed as alpha-0). The nucleotide sequence of its 3.3 kb-long 5' part was established and interactions with nuclear matrix proteins were studied. The DNA region localized about 16 kb upstream of the embryonic pi-globin gene showed high affinity to nuclear matrices in vitro. Two palindromes and a cluster of inverted repeats were co-localized in the same region. The whole 6.6 kb alpha-0 fragment decreased the activity of linked CAT reporter gene when transfected into chicken erythroblastoid cells.

Allelic deletion analysis of the FHIT gene predicts poor survival in non-small cell lung cancer.

The fragile histidine triad (FHIT) gene at chromosome 3p14.2 is a candidate tumor suppressor gene linked to cancers of the lung, breast, colon, pancreas, and head and neck. Reports of frequent allelic deletion and abnormal transcripts in primary lung tumors plus recent evidence that it is targeted by tobacco smoke carcinogens suggest that it plays an important role in lung carcinogenesis. Non-small cell lung carcinoma still maintains a poor 5-year survival rate with the stage of disease at presentation as a major determinant of prognosis. We examined for allelic deletion at the FHIT locus in a series of 106 non-small cell lung carcinomas for which a full clinical, epidemiological, and 5-year survival profile was available. We found an allelic deletion frequency of 38% at one or two intragenic microsatellites. Allelic deletion of FHIT was related to tumor histology with 4 of 20 adenocarcinomas (20%) displaying loss of heterozygosity (LOH) compared with 12 of 22 (55%) nonadenocarcinomas (P = 0.03). We found that 63% of tumors with LOH of FHIT also had p53 missense mutations whereas only 26% with LOH had wild type p53 negative sequence (P = 0.02). We also found a significant trend toward poorer survival in patients with LOH of at least one locus of the FHIT gene (log rank, P = 0.01). This survival correlation is independent of tumor stage, size, histological subtype, degree of differentiation, and p53 mutation status. Our data support the hypothesis that the loss of the FHIT contributes to the molecular pathogenesis of human lung cancer and is an indicator of poor prognosis.