Reliability of the International Spinal Cord Injury Musculoskeletal Basic Data Set.

STUDY DESIGN: Psychometric study. OBJECTIVES: To determine the intra- and inter-rater reliability and content validity of the International Spinal Cord Injury (SCI) Musculoskeletal Basic Data Set (ISCIMSBDS). SETTING: Four centers with one in each of the countries in Australia, England, India and the United States of America. METHODS: A total of 117 participants with a C2 to S1 neurological level and American Spinal Injury Association Impairment Scale A to D injury were recruited. The median (interquartile range) time since injury was 9 years (2-29). Fifty-seven participants were assessed by the same assessor, and 60 participants were assessed by two different assessors on two different occasions to determine the intra- and inter-rater reliability, respectively. Kappa statistics or crude agreement was used to measure reliability. Content validity was assessed through focus group interviews of people with SCI and health-care professionals. RESULTS: The intra-rater reliability ranged from κ=0.62 to 1.00 and crude agreement from 75% to 100% for each of the variables on the ISCIMSBDS. The inter-rater reliability ranged from κ=-0.25 to 1.00, with a diverse crude agreement ranging from 0% to 100%. The inter-rater reliability was unsatisfactory for the following variables: 'Date of fracture', 'Fragility fractures', 'Scoliosis, method of assessment', 'Other musculoskeletal problems' and 'Do any of the above musculoskeletal challenges interfere with your activities of daily living (transfers, walking, dressing, showers, etc.)?'. Results from validity discussions implied no major suggestions for changes. CONCLUSION: Overall, the ISCIMSBDS is reliable and valid, although 5 of the 12 variables may benefit from further refinement.

Human milk bile-salt-stimulated lipase is extremely reactive with the monoclonal antibody 1CF11 which recognizes a human-specific carbohydrate antigen.

1CF11 (Kanamaru, Y. et al.; Biochem. Biophys. Res. Commun., 249, 618-623, 1998) is a monoclonal antibody obtained after being raised in a mouse by injection of human milk MUC1 mucin as the antigen. Its reactivity was found to be unique in that it only reacts with a carbohydrate epitope shared by glycoproteins in human secretions, while its chemical nature is still unknown. Since a glycoprotein of Mr 135,000 (135K) in human milk was found to react extremely strongly with this antibody, we intended in this study to isolate the glycoprotein by a combination of various chromatographic techniques and identify it. It is a human milk bile-salt-stimulated lipase. By comparison of its immunoreactivity and glycan structures so far reported with those of lactoferrin from human milk, it is suggested that the epitope recognized by mAb ICF11 could be a human-specific novel glycan.

Unique occurrence of the 1CF11 carbohydrate epitope in primate saliva.

We examined a large number of individual human and animal saliva samples for the reactivity with ICF11, a mouse monoclonal antibody previously produced for the characterization of human milk mucin and apparently recognizing a certain carbohydrate antigenic structure shared by various human glycoproteins in secretions. The results obtained here confirm the unique occurrence of ICF11 epitope in each and every saliva sample from humans and Old world monkeys as well, though a vast variety was observed among individual saliva samples in the immunological reactivity with ICF11.

Review of the Fifth American College of Chest Physicians Consensus Conference on Antithrombotic Therapy: outpatient management for adults.

The recommendations of the Fifth American College of Chest Physicians (ACCP) Consensus Conference on Antithrombotic Therapy are reviewed, with a focus on outpatient anticoagulation management in adults. Numerous therapeutic recommendations have changed since the Fourth ACCP Consensus Conference on Antithrombotic Therapy. The system of grading recommendations has been modified to emphasize clinically important differences and to take into account the benefit-risk ratio of each treatment option. The International Normalized Ratio (INR) goal is now expressed as a specific target value within a range rather than simply an INR range. The recommendations of the fifth conference cover initiation of warfarin therapy, hemorrhagic complications, management of excessive anticoagulation, interruption of warfarin therapy for patients requiring surgery, nonvalvular atrial fibrillation, cardioversion in patients with atrial fibrillation, valvular heart disease, mechanical and biological prosthetic heart valves, coronary artery disease, saphenous vein and internal mammary artery bypass grafts, peripheral arterial occlusive disease, prevention of venous thromboembolism, treatment of venous thromboembolism, stroke prevention in patients with cerebrovascular disease, and pregnancy. Since the fourth consensus conference, new anticoagulation therapies and indications have emerged; the recommendations of the Fifth ACCP Consensus Conference on Antithrombotic Therapy have provided practitioners with a resource of immense value.

Evidence of mucin secretion in human lung adenocarcinoma cell lines NCIH650 and NCIH2077 and effect of select secretagogues on mucin secretion.

Mucins comprise an important class of tumor-associated antigens. The objectives of the present study were (a) to establish an in vitro model system using human non-small cell lung adenocarcinoma cell lines NCIH650 and NCIH2077 (b) provide evidence that these cell lines secrete mucin in culture conditions and (c) investigate the effects of select secretagogues on mucin secretion. The cell lines were established in ACL-4 medium containing several growth factors and retinoic acid and 5% fetal calf serum. The high molecular weight glycoconjugates secreted in the culture medium were purified by ammonium sulfate precipitation and Superose 6 and Superose 12 FPLC chromatography. The purified high molecular weight glycoconjugate fraction and the carcinoma cells were shown to have mucin by dot blot, Western blot and immunohistochemical analysis, respectively, using specific antibodies to purified major mucin, HTM-1. Also, incorporation experiments with mucin precursor 3H-glucosamine demonstrated that the cells indeed synthesize high molecular weight mucins. The effects of secretagogues such as, 8-bromocyclic AMP, ionomycin, phorbol-12-myristate-13-acetate and neutrophil elastase on mucin secretion were also investigated. Only 8-bromocyclic AMP and neutrophil elastase influenced mucin secretion. These studies provided strong evidence that the lung adenocarcinoma cell lines secrete high molecular weight mucins in culture conditions and only two of the four tested secretagogues significantly increased mucin secretion. Thus, this in vitro model system may be useful in determining alterations in mucin structure, if any, in lung adenocarcinomas as well as in studying the regulation of mucin gene expression.

A monoclonal antibody that recognizes a common carbohydrate epitope shared by various glycoproteins in human secretions.

A monoclonal antibody (mAb; a mouse IgM referred to as 1CF11) recognizing various human glycoproteins was obtained. While the immunoreaction of glycoproteins from human secretions including milk, saliva, and bronchus was demonstrated as a typical dose-responded S-shaped reaction curve on ELISA, no reaction was detected with milks and sera of animal origin as well as human serum. In the constituting polypeptides of the human milk secretory IgA molecule, only the secretory component was recognized by this mAb. Among various chemical treatments of the purified human milk lactoferrin (Lf), only either periodate or mild alkaline treatment abolished the immunoreactivity of the glycoprotein. A recombinant human Lf was not immunoreactive. Finally, the immunoreactive fragments were isolated from human milk Lf, which remained reactive with PAS reagent while lacking the previously reported N-glycans. These results strongly suggest that the mAb 1CF11 recognizes a new glycan O-glycosidically linked to glycoproteins in human secretions.

Colonic involvement in patients with amebic liver abscess: endoscopic findings.

BACKGROUND: Amebic liver abscess is the most common form of extraintestinal amebiasis. Although the parasite enters the liver via the portal vein after invading large bowel mucosa, only 15% to 30% of patients have diarrhea. This study was done to evaluate colonic involvement in patients with amebic liver abscesses. METHODS: In a prospective study, colonoscopy was performed in 50 patients with amebic liver abscesses and 15 control patients with acute amebic colitis. The findings were correlated with clinical features and ultrasonographic appearances. RESULTS: Most patients with amebic liver abscesses presented with fever and abdominal pain. Complete examination of the colon was possible in 45 patients. Twenty six (58%) had evidence of lesions in the colon. Twenty-three of 45 (51%) patients had a few discrete, small ulcers restricted to the right side of colon. Three of 45 (7%) patients with liver abscesses, who also had diarrhea at presentation, had larger and more numerous ulcers with inflammation of the surrounding mucosa of the left colon. Control patients with amebic colitis presented with diarrhea. Endoscopically, they all had multiple large ulcers with diffuse inflammation of the intervening mucosa of the left colon, similar to that seen in patients with liver abscess having diarrhea. CONCLUSIONS: Colonic involvement is common in patients with amebic liver abscess but most patients do not suffer from diarrhea, possibly because of very limited extent of the pathology that is confined mainly to the right side of colon.

Chromosomal localization of a human mucin gene (MUC8) and cloning of the cDNA corresponding to the carboxy terminus.

A partial cDNA (pAM1) encoding a major airway mucin glycoprotein with novel tandem repetitive sequence has recently been cloned (Shankar, V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. Biochem. J. 300:295-298). In this article, we report additional new sequence derived by 3'-rapid amplification of cDNA ends technique. The sequence corresponds to a stop codon, 3'-untranslated region of 458 bp, a polyadenylation signal, and poly A+ tail, and represents the extreme carboxy terminus of MUC8. A plasmid construct (pAM3) in pBluescript was generated by in-frame ligation of pAM1 to the 479-bp 3'UTR of MUC8. A 5'-end 325-bp fragment of this cDNA subcloned into the protein fusion and expression vector pET28b(+) was used to generate fusion protein under the control of T7 promoter. The purified fusion protein as well as synthetic peptide corresponding to the MUC8 repeat sequence (TSCPRPLQEGTPGS) were used to raise polyclonal antibodies in rabbits. The antiserum to the fusion protein and to the synthetic peptide reacted with the deglycosylated major tracheobronchial mucin. Immunohistochemical studies using the above antibodies localized the MUC8 protein product to submucosal glands in human tracheal epithelium. Furthermore, the gene from which this cDNA is derived, was mapped to chromosome 12 using DNA from a panel of human-mouse somatic cell hybrids. Fluorescence in situ hybridization was used to assign the regional localization to 12q24.3. Since the eight known human mucin genes map to other chromosomes, we have named this gene MUC8, in accordance with mucin gene nomenclature.

Ulcerative colitis in Oman. A prospective study of the incidence and disease pattern from 1987 to 1994.

OBJECTIVE: Inflammatory bowel disease has been reported to have varying frequencies in different parts of the world, and there seem to be significant differences in the disease pattern and clinical course in cases of ulcerative colitis (UC). The aim of the present study was to assess the incidence and disease pattern of UC in Oman. METHOD: A prospective study, over a period of 8 years (1987-1994), was performed to study 108 patients found to have UC. RESULTS: The annual incidence of UC was 1.35/100,000. The disease was mainly seen in the middle and upper middle class group, and the majority were nonsmokers or exsmokers. There was no significant difference in the incidence of the disease between nationalities or sexes. Total colitis was seen in 18%, and a significant number had disease extending up to the splenic flexure. Proctitis was seen in 8%. Although, the extent of the disease was similar to reports from the West, these patients had fewer hospital admissions, blood transfusions and none of them suffered local complications such as toxic dilatation, perforation or severe bleeding. Sclerosing cholangitis occurred in 2 patients. Patients were followed up for a maximum period of up to 7 years after diagnosis and none developed dysplasia or cancer. Three patients had surgery mainly for failure of medical treatment. CONCLUSIONS: From this report it seems that UC occurs in Oman at a lower frequency compared to the West. Although, the extent of the disease was similar to Europeans, these patients had less severe disease with fewer complications.

Antigenic cross-reactivity of human tracheal mucin with human sperm and trophoblasts correlates with the expression of mucin 8 gene messenger ribonucleic acid in reproductive tract tissues.

OBJECTIVE: To test whether autoimmunity to sperm in men with cystic fibrosis (CF) is a result of cross-reactivity between sperm and carbohydrate sequences of the abnormal CF mucins, we investigated the possible epitope sharing between sperm surface antigens and CF mucin antigens using specific monoclonal antibodies (mAbs) directed to purified CF tracheobronchial mucin-1 (HTM-1) and the expression of tracheal mucin 8 gene (MUC8) mRNA in normal male and female reproductive tract tissues by Northern blot analysis. DESIGN: A panel of mAbs directed to HTM-1 subspecies (types I to V) and polyclonal antibodies (pAb) to native and deglycosylated HTM-1 were tested for their ability to agglutinate motile sperm. An indirect immunofluorescence assay was used to detect expression of cross-reactive HTM-1 epitopes on sperm, term placenta (n = 3), and purified trophoblasts (n = 9). Northern blot analysis was used to detect MUC8 messenger RNA (mRNA) in male and female reproductive tract tissues. SETTING: University of Oklahoma Health Sciences Center, a tertiary care referral center. MAIN OUTCOME MEASURES: The demonstration of cross-reactive mucin at the protein and mRNA levels in reproductive tract tissues. RESULTS: Of the five mucin subspecies, type II, IV, and V mucin-specific mAbs (21.3, 33.3, and 54.1) induced head-to-head agglutination of motile sperm; pAb to deglycosylated mucin had no effect. Sperm agglutination mediated by type IV mucin mAb 33.3 was abrogated completely by D-mannose. Within the term placental villi, type II mucin, was localized to fetal endothelium, type IV mucin was localized to syncytiotrophoblast, and type V mucin was localized to cytotrophoblasts. Immunologic studies correlated with the results of Northern blot analysis, which revealed strong MUC8 mRNA expression in the human testis, placenta, endometrium, and cervix and weak or undetectable levels in the human epididymis, seminal vesicle, ovary, fallopian tube, and uterus. CONCLUSIONS: Both male and female reproductive tract tissues synthesize tracheal MUC8 mucin. Monoclonal antibodies specific to human tracheal mucin subtypes induced "immune-type" agglutination of motile sperm. Therefore, expression of cross-reactive MUC8 mucin epitopes in reproductive tract tissues may contribute to the development of low affinity, carbohydrate-specific, agglutinating antisperm antibodies in the genital tract.

Biophysical characterization of mucin components HTM-1 and HTM-2 from tracheobronchial secretions of cystic fibrosis patients.

Mucins present in the tracheobronchial secretions are responsible for the viscoelastic properties of the mucus. Any changes in the mucin structure may alter the physical properties of mucus and hence its function. Previous studies from this laboratory have reported the isolation and characterization of a major mucin component (HTM-1) and a minor, novel mucin component (HTM-2) from the tracheobronchial secretions of cystic fibrosis (CF) individuals. In the present study, the macromolecular properties of the CF mucin components HTM-1 and HTM-2 were further investigated using biophysical methods. Dynamic light scattering studies showed that CF HTM-1 and HTM-2 had a greater extended structure in buffer containing 0.10 and 0.15 M NaCl than that observed in the presence of 0.03 M NaCl. Also, CF HTM-1 had a compact configuration in the presence of 5 and 10 mM Ca2+, while under similar experimental conditions, the structure of CF HTM-2 was unaffected, indicating differences in the macromolecular properties of CF mucin components. Fluorescent probe binding studies revealed that CF HTM-1 had more hydrophobic probe binding domains than those observed for CF HTM-2. In summary, both biochemical and biophysical characterization suggests structural differences between the CF HTM-1 and HTM-2 components.

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Peptide mapping reveals differences in the non-glycosylated domains of cystic fibrosis and normal tracheobronchial mucins.

Tracheobronchial mucins from lung mucus secretions of healthy individuals and from patients with cystic fibrosis (CF) were purified according to a protocol established in our laboratory. Following digestion of the purified, reduced-alkylated mucin (free of 118 kDa and 70 kDa components) with trypsin-L-1-tosylamido-2-phenylethyl chloromethyl ketone, three fractions (TR-1, TR-2 and TR-3) were observed upon chromatography on a Superose 6 column using FPLC. TR-1 (glycosylated fraction) contained all of the carbohydrate, while TR-2 and TR-3 fractions had no detectable sugars. Comparison of the amino acid composition of TR-1 fractions from normal and CF individuals revealed no significant differences, while the TR-2 fractions from these mucins showed noticeable differences. Peptide mapping of TR-2 fractions from normal and CF mucins was performed on a C18 reverse phase column using FPLC. The peptide maps of normal mucins were markedly different from CF mucins. A greater number of peptides were seen in the TR-2 fractions of normal mucins when compared to CF mucin TR-2 fractions. In addition, normal TR-2 fractions appeared to be comprised of more hydrophobic peptides when compared to CF TR-2 fractions. These data provide evidence of possible structural differences in the non-glycosylated regions of CF and non-CF mucins, since the TR-2 fractions are essentially derived from the T-domains in the "naked" stretches of the mucin polypeptide backbone.

Antigenic similarities between respiratory and reproductive tract mucins: heterogeneity of mucin expression by human endocervix and endometrium.

OBJECTIVES: To determine whether common epitopes are shared by respiratory and reproductive tract mucins and to compare the expression of cross-reactive mucin subtypes in human endocervix and endometrium. DESIGN: An immunohistochemical study of mucin expression using a panel of monoclonal and polyclonal antimucin antibodies and timed endocervical and endometrial biopsies. SETTING: University of Oklahoma Health Sciences Center, a tertiary care referral center. PATIENTS: Twenty-eight women who underwent laparoscopy, laparotomy, or hysterectomy. MAIN OUTCOME MEASURES: The expression of human tracheal mucin subspecies (types I to V) in endocervix (n = 3) and endometria (n = 25). RESULTS: Of the five mucin subspecies, type I mucin was localized to the squamous epithelium of endocervix and both glands and stroma of endometrium. Both tissues failed to react with type II mucin. Type III mucin was localized to differentiated cells of the squamous epithelium of endocervix and the glandular endometrium. Type IV mucin was specific to endometrium and was localized both in endometrial glands and stroma with no reactivity with endocervix. Type V mucin was expressed in both cervical and endometrial stroma and glands. CONCLUSIONS: Human respiratory and reproductive tract mucins share common peptide and carbohydrate epitopes. Human endocervix and endometria express a unique pattern of mucin antigens. Because of their restricted specificity, these monoclonal antibodies could provide new tools to investigate normal and aberrant expression of reproductive tract mucin subtypes in tissues and secretions.

Human colonic intraepithelial lymphocytes from patients with inflammatory bowel disease fail to down-regulate proliferative responses of primed allogeneic peripheral blood mononuclear cells after rechallenge with antigens.

Human colonic intraepithelial lymphocytes from control subjects down-regulate the proliferative responses of primed allogeneic peripheral blood mononuclear cells on rechallenge with antigens or phytohaemagglutinin (PHA). In contrast, human colonic intraepithelial lymphocytes from patients with inflammatory bowel disease fail to down-regulate the proliferative responses of primed allogeneic peripheral blood mononuclear cells on rechallenge with antigens. These findings may be important in the development and maintenance of the mucosal immunological activation of inflammatory bowel disease.

Monoclonal antibodies reacting with the MUC2 mucin core protein.

This study sought to produce monoclonal antibodies (MAbs) which reacted with the MUC2 core protein. Two MAbs [3A2 (IgG1) and 4F1 (IgM)] were produced by immunising female BALB/c mice with gel-formed mucin from the LS174T colon cancer cell line followed by a KLH conjugate of a 29 amino acid synthetic peptide whose sequence was derived from the variable number of tandem repeats (VNTR) region of a MUC2 cDNA clone. The MAbs reacted with synthetic MUC2 VNTR peptides but not synthetic MUC1 or MUC3 VNTR peptides, and showed specific reactivity in Western blotting with a high molecular weight protein produced by the LS174T colon carcinoma cell line. The use of shorter peptides indicated that the minimum peptide epitopes for these MAbs were different. Mab 3A2 reacted with amino acids 5-19 of the MUC2 VNTR by inhibition ELISA but not by direct ELISA, while 4F1 reacted with this peptide in both assays. Furthermore, 4F1 reacted in direct ELISA when a larger (29 amino acid) MUC2-derived peptide was coated onto the assay plate by incubating in carbonate buffer or by drying the peptide onto the assay plate, while 3A2 only reacted when this peptide was coated in carbonate buffer. The different specificity of the MAbs was also illustrated by the reactivity of 4F1 but not 3A2 with partially deglycosylated cystic fibrosis mucin. Immunohistochemical analysis with these MAbs revealed a strong reactivity with lung, gastric and colon tumours relative to normal tissue, with some breast and ovarian tumours also reacting. Both MAbs stained some normal goblet cells in the perinuclear region but not the mucin droplet or secreted mucin, indicating a reaction with immature (poorly glycosylated) mucin in the endoplasmic reticulum and/or golgi, but not with mature (fully glycosylated) mucin. In contrast, tumours showed strong diffuse cytoplasmic staining. 4F1 also showed weak apical cytoplasmic staining in some goblet cells and stained some tumours which showed no reactivity with 3A2. These antibodies should prove useful in the study of MUC2 structure and function, and in the diagnosis of some tumours.

Evaluation of radionuclide gastroesophagography as a suitable screening test for detection of gastroesophageal reflux.

Thirty cases of recurrent pulmonary infection and ten control cases underwent radionuclide gastroesophagography endoscopy, histopathology and barium esophagography to evaluate the clinical efficacy of scintigraphic technique in, detection of gastroesophageal reflux. After ingesting 500 micro curie of Tc-Sulphur colloid mixed in milk, patients esophageal activity was monitored using the gamma camera for forty-five minutes continuously. By using histopathology as standard of comparison, the sensitivity and specificity of radionuclide esophagography was 78.54 and 81.25%, respectively. Because of its physiologic nature, low radiation exposure and convenience, radionuclide esophagography is recommended as a suitable screening test for detecting gastroesophageal reflux where available.

Purification and characterization of monkey (Macaca nemestrina) tracheobronchial mucin.

A major mucin glycoprotein was purified from monkey (Macaca nemestrina) bronchoalveolar lavages by gel filtration, delipidation, and a series of density gradient centrifugations in cesium trifluoroacetate/guanidinium chloride. Lipids noncovalently associated with the mucin amounted to 24-36% by weight and consisted primarily of phospholipids and glycolipids. The mucin preparation was free of low-molecular-weight protein/glycoprotein contaminants, glycosaminoglycans/proteoglycans, and nucleic acids. The weight-average molecular weight and radius of gyration of the mucin in buffer containing 6 M guanidinium chloride was estimated to be approximately 1.56 x 10(6) and 100 nm, respectively, by laser light scattering technique. When the mucin was dissolved in 0.15 M NaCl, a considerably higher molecular weight of approximately 5.05 x 10(6) and a larger radius of gyration of approximately 127 nm were observed suggesting aggregation of the mucin molecules. Amino acid composition of the glycoprotein was characteristic of mucins with threonine, serine, glutamic acid, proline, glycine, and alanine comprising 63%. The total carbohydrate content was 71.5% and consisted of GalNAc, GlcNAc, Gal, sialic acids, and fucose in the molar ratio of 1.0:2.2:2.4:1.4:1.2 with no detectable mannose. Alkaline borohydride treatment indicated that 65% of the threonine and 27% of the serine are substituted by saccharides via GalNAc residues. An antisera produced against the purified mucin was found to react well with the native and weakly with the deglycosylated mucins and will be useful for immunoassays. A second, minor, mucin glycoprotein obtained during the purification was also partially characterized.