Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 93
Filter
1.
J Pathol Inform ; 14: 100304, 2023.
Article in English | MEDLINE | ID: mdl-36967835

ABSTRACT

Strategies such as ensemble learning and averaging techniques try to reduce the variance of single deep neural networks. The focus of this study is on ensemble averaging techniques, fusing the results of differently initialized and trained networks. Thereby, using micrograph cell segmentation as an application example, various ensembles have been initialized and formed during network training, whereby the following methods have been applied: (a) random seeds, (b) L 1-norm pruning, (c) variable numbers of training examples, and (d) a combination of the latter 2 items. Furthermore, different averaging methods are in common use and were evaluated in this study. As averaging methods, the mean, the median, and the location parameter of an alpha-stable distribution, fit to the histograms of class membership probabilities (CMPs), as well as a majority vote of the members of an ensemble were considered. The performance of these methods is demonstrated and evaluated on a micrograph cell segmentation use case, employing a common state-of-the art deep convolutional neural network (DCNN) architecture exploiting the principle of the common VGG-architecture. The study demonstrates that for this data set, the choice of the ensemble averaging method only has a marginal influence on the evaluation metrics (accuracy and Dice coefficient) used to measure the segmentation performance. Nevertheless, for practical applications, a simple and fast estimate of the mean of the distribution is highly competitive with respect to the most sophisticated representation of the CMP distributions by an alpha-stable distribution, and hence seems the most proper ensemble averaging method to be used for this application.

2.
J Pathol Inform ; 13: 100114, 2022.
Article in English | MEDLINE | ID: mdl-36268092

ABSTRACT

In this work, the network complexity should be reduced with a concomitant reduction in the number of necessary training examples. The focus thus was on the dependence of proper evaluation metrics on the number of adjustable parameters of the considered deep neural network. The used data set encompassed Hematoxylin and Eosin (H&E) colored cell images provided by various clinics. We used a deep convolutional neural network to get the relation between a model's complexity, its concomitant set of parameters, and the size of the training sample necessary to achieve a certain classification accuracy. The complexity of the deep neural networks was reduced by pruning a certain amount of filters in the network. As expected, the unpruned neural network showed best performance. The network with the highest number of trainable parameter achieved, within the estimated standard error of the optimized cross-entropy loss, best results up to 30% pruning. Strongly pruned networks are highly viable and the classification accuracy declines quickly with decreasing number of training patterns. However, up to a pruning ratio of 40%, we found a comparable performance of pruned and unpruned deep convolutional neural networks (DCNN) and densely connected convolutional networks (DCCN).

3.
J Environ Manage ; 288: 112390, 2021 Jun 15.
Article in English | MEDLINE | ID: mdl-33773214

ABSTRACT

Oligotrophic waters (OW), generally favour longer food chain facilitated by the microbial loop. In such ecosystems, physical mixing (e.g. upwelling, and winter convection) inject nutrients and propagules from subsurface to the photic zone. Such events are expected to alter the food chain through shifts in the plankton community. Mesocosm experiments were carried out to evaluate the influence of nutrient enrichment from the deep (100-150 m) on the surface plankton community for the first time in the Arabian Sea, through custom-designed enclosures in OW of the central-eastern Arabian Sea (CEAS). Surface water was characterized by low nutrients and phytoplankton biomass (chlorophyll-a of <0.2 µg m-3) and upon nutrient enrichment yielded differing response. Higher abundance of picophytoplankton, bacteria and protists was noticed at a depth of ~100 m than at surface. The inoculation of such a population to the surface, resulted in a significant enhancement of autotrophic (picophytoplankton) and heterotrophic (bacteria and protists) populations. However, significant changes in the abundance of larger plankton was not evident till three days of incubation. Even though autotrophic picophytoplankton responded positively, a distinct increase in chlorophyll-a was not evident. This study points out that the lack of sufficient viable microphytoplankton propagules, neither at the surface nor at the depth (inoculum) are the possible reasons for the lack of their distinct positive response. These experiments suggest the dominance of microbial community response to physical mixing in the OW regions of the Arabian Sea and the importance of propagule diversity. The insights from this experiment will serve as a precursor for appropriate modifications in ocean modelling and forecasting studies and help in building global environmental management tools.


Subject(s)
Ecosystem , Plankton , Biomass , Heterotrophic Processes , Nutrients , Phytoplankton
4.
Oral Dis ; 23(8): 1087-1098, 2017 Nov.
Article in English | MEDLINE | ID: mdl-28580710

ABSTRACT

OBJECTIVE: To generate a nomogram for predicting the risk of neck node metastasis in pathologically node-negative patients using a combination of variables comprising of protein expression, ultrastructural alterations and clinicopathological parameters. MATERIALS AND METHODS: Surgically removed oral tumours (n = 103) were analysed for the expression of desmosomal and hemidesmosomal assembly proteins by immunohistochemistry and ultrastructural alterations by transmission electron microscopy (TEM). Protein expression, ultrastructural alterations and clinicopathological variables were used to construct nomogram from the training set in 75 patients. Clinical utility of the nomogram was validated in a discrete set of 28 patients. RESULTS: Univariate and multivariate analyses were performed on the training set, and obtained significant variables comprising of integrin ß4 expression (p = .027), number of hemidesmosomes (p = .027)/desmosomes (p = .046), tumour differentiation grade (p = .033) and tumour thickness (p = .024) were used for construction of the nomogram. The area under the curve was calculated for both training 0.821 (95% CI 0.725-0.918) and validation sets 0.880 (95% CI 0.743-1.000). The nomogram demonstrated a predictive accuracy of 73.3% and 78.6% with the sensitivity of 81.4% and 83.3% in the training and validation sets, respectively. CONCLUSIONS: The nomogram constructed on postsurgical tumour samples will be a value addition to histopathology for the detection of neck node metastasis in pathologically node-negative patients.


Subject(s)
Carcinoma, Squamous Cell/metabolism , Carcinoma, Squamous Cell/secondary , Mouth Neoplasms/metabolism , Mouth Neoplasms/pathology , Nomograms , Area Under Curve , Carcinoma, Squamous Cell/ultrastructure , Desmosomes/metabolism , Desmosomes/ultrastructure , Female , Hemidesmosomes/metabolism , Hemidesmosomes/ultrastructure , Humans , Integrin beta4/metabolism , Lymphatic Metastasis , Male , Middle Aged , Mouth Neoplasms/ultrastructure , Neck , Neoplasm Grading , Predictive Value of Tests , ROC Curve , Risk Factors
5.
Environ Monit Assess ; 188(9): 514, 2016 Sep.
Article in English | MEDLINE | ID: mdl-27518441

ABSTRACT

Road dust in industrial areas carries high levels of toxic heavy metals. Exposure to such polluted dust significantly affects the health of people residing in these areas, which is of major concern. The present study was taken up with an aim to highlight the magnitude and potential sources of accumulation of heavy metals in 32 road dust samples collected from six industrial areas of Hyderabad. Acid-digested sample solutions were analyzed by ICP-MS for Cu, Zn, Cr, Co, Pb, Ni, V, Zr, Ce, Y, and Hf. The road dusts exhibit significantly high mean metal levels which are much above their crustal abundances. The relative ordering of mean metal contents is Zr > Zn > Pb > Cr > Ce > Cu > V > Ni > Y > Co > Hf. Elevated pollution indices (I geo, EF, C (i) f, and C deg) reveal that the road dusts are pollution impacted showing varying degree of heavy metal contamination. Strong positive correlations exhibited by metal pairs Cu-Zn, Cr-Ni, Ce-V, Y-Ce, and Hf-Zr imply their origin from common anthropogenic sources. Principal component analysis grouped the metals according to the sources which contributed to their accumulation. The present study confirms to an intensive anthropogenic impact on the accumulation of heavy metals in the studied road dusts attributable mainly to strong influences of vehicular and industrial activity and partly to domestic and natural processes. The results obtained imply the need for further investigations to assess their ecological implications and human health risks.


Subject(s)
Dust/analysis , Metals, Heavy/analysis , Soil Pollutants/analysis , Environmental Monitoring/methods , Environmental Pollution/analysis , India , Industry
6.
Urol Ann ; 8(4): 464-467, 2016.
Article in English | MEDLINE | ID: mdl-28057993

ABSTRACT

OBJECTIVE: To demonstrate the new technique of Spiral-cap ileocystoplasty for bladder augmentation and simultaneous ureteric reimplant. MATERIALS AND METHODS: Seven patients with small capacity bladder and simultaneous lower ureteric involvement operated in single tertiary care institute over the last 5 years were included in this study. Spiral-cap ileocystoplasty was used in all the patients for bladder augmentation. Proximal part of the same ileal loop was used in isoperistaltic manner for ureteric reimplantation. Distal end of this ileal loop was intussuscepted into the pouch to decrease the incidence of reflux. Detubularized distal portion of the loop was reconfigured in spiral manner to augment the native bladder. Patients were analyzed for upper tract changes, serum creatinine, bladder capacity, and requirement of clean intermittent self-catheterization in follow-up over 5 years. RESULTS: There was no evidence of any urinary or bowel leak in the postoperative period. Recovery was equivalent with those treated with other methods of bladder augmentation. Follow-up ultrasonography showed good capacity bladder. Upper tracts were well preserved in follow-up. Urinary bladder and lower ureter pathologies were addressed simultaneously. CONCLUSION: Spiral-cap ileocystoplasty is a useful technique in patients who require simultaneous bladder augmentation and ureteric reimplant.

7.
Mol Oncol ; 10(2): 303-16, 2016 Feb.
Article in English | MEDLINE | ID: mdl-26590090

ABSTRACT

Periampullary adenocarcinomas can be of two histological subtypes, intestinal or pancreatobiliary. The latter is more frequent and aggressive, and characterized by a prominent desmoplastic stroma, which is tightly related to the biology of the cancer, including its poor response to chemotherapy. Whereas miRNAs are known to regulate various cellular processes and interactions between cells, their exact role in periampullary carcinoma remains to be characterized, especially with respect to the prominent stromal component of pancreatobiliary type cancers. The present study aimed at elucidating this role by miRNA expression profiling of the carcinomatous and stromal component in twenty periampullary adenocarcinomas of pancreatobiliary type. miRNA expression profiles were compared between carcinoma cells, stromal cells and normal tissue samples. A total of 43 miRNAs were found to be differentially expressed between carcinoma and stroma of which 11 belong to three miRNA families (miR-17, miR-15 and miR-515). The levels of expression of miRNAs miR-17, miR-20a, miR-20b, miR-223, miR-10b, miR-2964a and miR-342 were observed to be higher and miR-519e to be lower in the stromal component compared to the carcinomatous and normal components. They follow a trend where expression in stroma is highest followed by carcinoma and then normal tissue. Pathway analysis revealed that pathways regulating tumor-stroma interactions such as ECM interaction remodeling, epithelial-mesenchymal transition, focal adhesion pathway, TGF-beta, MAPK signaling, axon guidance and endocytosis were differently regulated. The miRNA-mRNA mediated interactions between carcinoma and stromal cells add new knowledge regarding tumor-stroma interactions.


Subject(s)
Adenocarcinoma/genetics , Common Bile Duct Neoplasms/genetics , MicroRNAs/genetics , Pancreatic Neoplasms/genetics , RNA, Messenger/genetics , Stromal Cells/metabolism , Adenocarcinoma/metabolism , Adenocarcinoma/pathology , Adult , Aged , Common Bile Duct Neoplasms/metabolism , Common Bile Duct Neoplasms/pathology , Female , Gene Expression Profiling , Gene Expression Regulation, Neoplastic , Humans , MAP Kinase Signaling System , Male , MicroRNAs/metabolism , Middle Aged , Pancreatic Neoplasms/metabolism , Pancreatic Neoplasms/pathology , RNA, Messenger/metabolism , Transforming Growth Factor beta , Tumor Microenvironment
8.
Med Vet Entomol ; 28(4): 345-54, 2014 Dec.
Article in English | MEDLINE | ID: mdl-24805263

ABSTRACT

Flesh flies of the genus Sarcophaga (Diptera: Sarcophagidae) are carrion-breeding, necrophagous insects important in medical and veterinary entomology as potential transmitters of pathogens to humans and animals. Our aim was to analyse the diversity of gut-associated bacteria in wild-caught larvae and adult flesh flies using culture-dependent and culture-independent methods. Analysis of 16S rRNA gene sequences from cultured isolates and clone libraries revealed bacteria affiliated to Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes in the guts of larval and adult flesh flies. Bacteria cultured from larval and adult flesh fly guts belonged to the genera Acinetobacter, Bacillus, Budvicia, Citrobacter, Dermacoccus, Enterococcus, Ignatzschineria, Lysinibacillus, Myroides, Pasteurella, Proteus, Providencia and Staphylococcus. Phylogenetic analysis showed clone sequences of the genera Aeromonas, Bacillus, Bradyrhizobium, Citrobacter, Clostridium, Corynebacterium, Ignatzschineria, Klebsiella, Pantoea, Propionibacterium, Proteus, Providencia, Serratia, Sporosarcina, Weissella and Wohlfahrtiimonas. Species of clinically significant genera such as Ignatzschineria and Wohlfahrtiimonas spp. were detected in both larvae and adult flesh flies. Sequence analysis of 16S rRNA gene libraries supported culture-based results and revealed the presence of additional bacterial taxa. This study determined the diversity of gut microbiota in flesh flies, which will bolster the ability to assess microbiological risk associated with the presence of these flies. The present data thereby establish a platform for a much larger study.


Subject(s)
Bacteria/genetics , Bacteria/isolation & purification , Diptera/microbiology , Gastrointestinal Tract/microbiology , Animals , Larva/microbiology , Phylogeny
9.
J Obstet Gynaecol ; 34(5): 412-4, 2014 Jul.
Article in English | MEDLINE | ID: mdl-24649874

ABSTRACT

Early pregnancy complication remains a significant cause of maternal morbidity and mortality. Despite the paucity of evidence to support consultant-led early pregnancy unit over nurse- or sonographer-led services, hospitals have devoted scarce resources to appoint consultants to lead their early pregnancy units. We compared the management and outcomes of confirmed and suspected ectopic pregnancy 1 year before and one year after the transition from a nurse-led to a consultant-led early pregnancy unit in a London hospital. Our study showed improvements in the rates of negative laparoscopy, ruptured ectopic pregnancy during follow-up, need for laparotomy, ITU admission and length of stay and statistically significant reduction in operative intervention, without concomitant rise in morbidity or mortality in women with confirmed or suspected ectopic pregnancies.


Subject(s)
Gynecology , Obstetrics , Outcome and Process Assessment, Health Care , Physician's Role , Pregnancy, Ectopic/surgery , Prenatal Care/organization & administration , Adult , Female , Hospitals, District/organization & administration , Humans , London , Male , Pregnancy , Pregnancy, Ectopic/diagnosis , Prenatal Care/methods , Time Factors , Young Adult
10.
Oral Dis ; 20(5): 453-65, 2014 Jul.
Article in English | MEDLINE | ID: mdl-23865921

ABSTRACT

OBJECTIVE: To investigate the clinical significance of vimentin expression at early and late events of tobacco/areca nut-associated oral tumorigenesis. MATERIALS AND METHODS: Immunohistochemistry (IHC) was carried out on paraffin-embedded tissues of oral mucosa normal (n = 10), inflammatory lesions (n = 19), leukoplakia (n = 52), submucous fibrosis (n = 71) and tumours/cut margins (n = 227 each), using anti-vimentin antibody, and the expression profile was correlated with patients' clinical parameters. Immunofluorescence, Western blot and RT-PCR analysis were also carried out wherever adequate and fresh tissues were available. RESULTS: Aberrant vimentin expression was seen in hyperplastic, dysplastic and fibrotic tissues, which showed statistically significant correlation with the histopathological grade of dysplasia (P = 0.001) and fibrosis (P = 0.009). Vimentin expression also showed statistically significant correlation with tumour size (P = 0.048), clinical stage (P = 0.013), regional lymph node metastases (P = 0.001), local recurrence (P = 0.001) and survival (P = 0.021) of patients with oral squamous cell carcinoma (OSCC). Its expression in invasive fronts statistically correlated with development of nodal metastasis and local recurrence. CONCLUSIONS: Our results suggest possible role of vimentin in early events of tobacco/areca nut-associated oral tumorigenesis, which may prove useful to predict the malignant potential of high-risk oral lesions. Further, association between vimentin expression in invasive fronts and aggressive phenotype of tumours may help clinicians to choose the appropriate treatment modality for OSCC management.


Subject(s)
Mouth Neoplasms/chemistry , Precancerous Conditions/chemistry , Vimentin/analysis , Adolescent , Adult , Aged , Blotting, Western , Carcinoma, Squamous Cell/chemistry , Carcinoma, Squamous Cell/pathology , Female , Fluorescent Antibody Technique , Humans , Immunohistochemistry , Male , Middle Aged , Mouth Mucosa/chemistry , Mouth Neoplasms/pathology , Precancerous Conditions/pathology , Reverse Transcriptase Polymerase Chain Reaction
11.
Eur J Med Chem ; 63: 279-89, 2013 May.
Article in English | MEDLINE | ID: mdl-23501113

ABSTRACT

In the present study, novel spiro derivatives of α-santonin were prepared and tested for their anticancer activity against a panel of six human cancer cell lines. Spiro-isoxazoline and spiro-isoxazolidine derivatives have been generated on C-ring of α-santonin (α-methylene-γ-butyrolactone) by the 1,3-dipolar cycloaddition of α-santonin derivative 6 with nitrile oxides 7 and nitrones 9 respectively. Among all, compound 10b″ had shown IC50 of 0.01, 0.5 and 0.3 µM against PC-3, THP-1 and MCF-7 cell lines respectively. Further, flow cytometry studies showed that PC-3 cells treated with the spiro-isoxazolidine derivative 10b″ were arrested in the sub G1 phase of the cell cycle in a concentration dependent manner. The spiro-isoxazolidine derivative 10b″ also showed concentration dependent inhibitory activity against NF-κB, p65 with 57% inhibition in 24 h at 10 µM.


Subject(s)
Antineoplastic Agents/chemical synthesis , Isoxazoles/chemical synthesis , Santonin/chemical synthesis , Antineoplastic Agents/chemistry , Antineoplastic Agents/pharmacology , Cell Cycle Checkpoints/drug effects , Cell Line, Tumor , Cell Survival/drug effects , Crystallography, X-Ray , Dose-Response Relationship, Drug , Drug Screening Assays, Antitumor , Flow Cytometry , G1 Phase/drug effects , Humans , Inhibitory Concentration 50 , Isoxazoles/chemistry , Isoxazoles/pharmacology , MCF-7 Cells , Models, Chemical , Molecular Conformation , Molecular Structure , Santonin/chemistry , Santonin/pharmacology , Stereoisomerism , Transcription Factor RelA/antagonists & inhibitors , Transcription Factor RelA/metabolism
12.
Mutat Res ; 752(2): 99-118, 2013.
Article in English | MEDLINE | ID: mdl-23262374

ABSTRACT

Genetic toxicity testing is used as an early surrogate for carcinogenicity testing. Genetic toxicity testing is also required by regulatory agencies to be conducted prior to initiation of first in human clinical trials and subsequent marketing for most small molecule pharmaceutical compounds. To reduce the chances of advancing mutagenic pharmaceutical candidates through the drug discovery and development processes, companies have focused on developing testing strategies to maximize hazard identification while minimizing resource expenditure due to late stage attrition. With a large number of testing options, consensus has not been reached on the best mutagenicity platform to use or on the best time to use a specific test to aid in the selection of drug candidates for development. Most companies use a process in which compounds are initially screened for mutagenicity early in drug development using tests that require only a few milligrams of compound and then follow those studies up with a more robust mutagenicity test prior to selecting a compound for full development. This review summarizes the current applications of bacterial mutagenicity assays utilized by pharmaceutical companies in early and late discovery programs. The initial impetus for this review was derived from a workshop on bacterial mutagenicity screening in the pharmaceutical industry presented at the 40th Annual Environmental Mutagen Society Meeting held in St. Louis, MO in October, 2009. However, included in this review are succinct summaries of use and interpretation of genetic toxicity assays, several mutagenicity assays that were not presented at the meeting, and updates to testing strategies resulting in current state-of the art description of best practices. In addition, here we discuss the advantages and liabilities of many broadly used mutagenicity screening platforms and strategies used by pharmaceutical companies. The sensitivity and specificity of these early mutagenicity screening assays using proprietary compounds and their concordance (predictivity) with the regulatory bacterial mutation test are discussed.


Subject(s)
Bacteria/genetics , Drug Evaluation, Preclinical/methods , Drug Industry , Mutagenicity Tests , Mutagens/toxicity , Mutation/genetics , Anti-Bacterial Agents/pharmacology , Bacteria/drug effects , Humans
14.
Plant Physiol Biochem ; 61: 131-41, 2012 Dec.
Article in English | MEDLINE | ID: mdl-23137727

ABSTRACT

Efficacy of artificial synthetic expression modules was compared with native CaMV35S and DECaMV35S promoter in transgenic tomato developed by Agrobacterium-mediated transformation. The promoters under trial were CaMV35S-mec (PcamI), CaMV35S (PcamII), DECaMV35S (PcamIII), synthetic minimal expression cassette (Pmec), complete expression cassette (Pcec), double enhancer expression cassette (Pdec) and triple enhancer expression cassette (Ptec) for driving the uidA gene for ß-glucuronidase (GUS) activity. The promoter efficiency based on average of GUS expression in T(0) and T(1) transgenic tomato was in the order Pcec > Pdec > PcamIII > PcamII > PcamI > Ptec > Pmec. The two promoters Pcec and PcamIII were deployed for development of insect-resistant transgenic tomato with optimal expression of modified cry1Ac insecticidal toxin gene from Bacillus thuringiensis (Bt). The transgenic status and copy number of the cry1Ac in T(0) transgenic tomato was confirmed through PCR, Southern hybridization, RT-PCR and Western immunoassay, while toxin expression was monitored by DAS-ELISA. The expression level of Cry1Ac toxin driven by Pcec in T(0) population ranged from 0.08 to 0.8% of total soluble protein (TSP) that was significantly higher to PcamIII which ranged from 0.02 to 0.13% of TSP. The outcome of insect mortality bioassay with Helicoverpa armigera correlated well with the results of DAS-ELISA. The higher expression of cry1Ac gene driven by Pcec promoter in transgenic tomato did not show any yield penalty and reflected complete protection, while low recovery of promising transgenics expressing Cry1Ac toxin driven by PcamIII was a major limitation for complete protection against the fruit borer insect.


Subject(s)
Bacterial Proteins/genetics , DNA Primers , Endotoxins/genetics , Hemolysin Proteins/genetics , Pest Control, Biological , Plants, Genetically Modified/genetics , Solanum lycopersicum/genetics , Transformation, Genetic , Transgenes , Animals , Bacillus thuringiensis , Bacillus thuringiensis Toxins , Bacterial Proteins/metabolism , Endotoxins/metabolism , Gene Expression , Genes, Bacterial , Hemolysin Proteins/metabolism , Solanum lycopersicum/metabolism , Moths , Plants, Genetically Modified/metabolism
15.
Indian J Cancer ; 49(1): 119-24, 2012.
Article in English | MEDLINE | ID: mdl-22842179

ABSTRACT

AIMS AND OBJECTIVES: Pulmonary embolism (PE) is rare in the Indian population and is under-reported in patients with malignancy. We studied the clinical profile and outcome of patients with PE and cancer in the Indian population. MATERIALS AND METHODS: Data of cancer patients with PE, admitted in a tertiary cancer centre, was analyzed. The prevalence of PE was calculated as the number of patients with PE per 10,000 hospital admissions. The demographic data, details of cancer, co-morbidities, details of PE, and treatment given for PE and their outcomes were recorded and analyzed. RESULTS: There were 56,425 hospital admissions in the study period. The prevalence of PE was 6.4 per 10,000 hospital admissions .Thirty-six cancer patients were diagnosed to have PE. In females, gynecological malignancies (36.84%) and in males gastrointestinal, head and neck cancers, and hematological malignancies were the most common sites (17.7% each). PE was associated with DVT in 41.7%. Dyspnea was the most common presenting symptom. Five patients (13.88%) were asymptomatic and were incidentally detected to have PE . The most common echocardiographic finding was right ventricular dysfunction (55.55%). Mortality among the treated patients was 22% (7 / 31) and in untreated patients it was 80% (4 / 5). The factors that had an impact on a three-month survival were, the presence of massive PE (P = 0.019) and the presence of RV dysfunction at presentation (P = 0.005). CONCLUSION: The prevalence of PE and mortality due to PE is high in cancer patients. Risk stratification for venous thromboembolism (VTE) should be done in all cancer patients and thromboprophylaxis should be optimally used.


Subject(s)
Neoplasms/complications , Pulmonary Embolism/complications , Pulmonary Embolism/diagnosis , Ventricular Dysfunction, Right/complications , Adolescent , Adult , Aged , Echocardiography , Female , Humans , Male , Middle Aged , Neoplasms/drug therapy , Pulmonary Embolism/mortality , Pulmonary Embolism/therapy , Retrospective Studies , Ventricular Dysfunction, Right/diagnostic imaging
16.
Plant Dis ; 96(12): 1828, 2012 Dec.
Article in English | MEDLINE | ID: mdl-30727276

ABSTRACT

Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.

17.
Indian J Microbiol ; 52(3): 495-9, 2012 Sep.
Article in English | MEDLINE | ID: mdl-23997346

ABSTRACT

The yeast has important role in fermentation of wine grapes and wine quality. The fermentation of wine grapes affect by efficiency of particular yeast strain, sugar content, pH, available temperature, etc. To evaluate the efficiency of yeast strains (Premier Cuvee, RS-1, RS-2, RS-3 and natural), present study was conducted on two wine grape varieties viz.; Sauvignon Blanc (White) and Cabernet Sauvignon (Red). Efficiency of yeast strains was evaluated in terms of conversion rate of sugar into alcohol. As per recorded data, strain RS-3 (Pichia kudriavzevii) was found more efficient than other strains in fermentation of Cabernet Sauvignon with efficiency of 84.4 per cent but in case of Sauvignon Blanc, the commercial culture Premier Cuevee was found superior over RS-3. The quality parameters of young wines of both the varieties were also affected by the used strains. Considering the efficiency and impact on various parameters of wines, local strain, i.e., RS-3 was found at par with commercial culture (Premier Cuvee). The RS-3 strain has potential to produce quality wines. However, studies on effects of RS-3 strain on some specific quality parameters of wines like varietal aroma compounds, flavours etc. are needed.

18.
Mar Pollut Bull ; 62(6): 1233-44, 2011 Jun.
Article in English | MEDLINE | ID: mdl-21489565

ABSTRACT

Phytoplankton assemblages from tropical (Goa) and temperate (UK) locations were exposed to a 28 day dark period, followed by a period of re-exposure to light. During this time phytoplankton survival and changes in nutrient concentrations were mapped. The tropical plankton water samples showed high nutrient levels after the dark period which were utilised by cells during the re-exposure period. UK experiments looked at the effect of three different water types on population recovery after the 28 day dark period, and differences due to seasonal effects. The population growth observed during the re-exposure period in the tropical population was comparable to that of the temperate population. Water type affected recovery and of the three tested media fresh seawater promoted the highest levels of growth. Seasonality had a significant influence on species survival. Understanding the effects of all these factors can aid the development of effective risk assessments in ballast water management.


Subject(s)
Darkness , Phytoplankton/physiology , Ships/methods , Environmental Monitoring , India , Introduced Species/statistics & numerical data , Photosynthesis , Phytoplankton/classification , Risk Management , Seawater/chemistry , Tropical Climate , United Kingdom , Water Pollutants, Chemical/analysis
19.
Int J STD AIDS ; 21(10): 714-7, 2010 Oct.
Article in English | MEDLINE | ID: mdl-21139151

ABSTRACT

We carried out a phase 1 trial of a candidate vaginal microbicide gel against HIV-1 and other sexually transmitted diseases, which contained cellulose acetate 1,2-benzenedicarboxylate (also known as cellulose acetate phthalate) in a glycerol-based vehicle. We had to terminate the study after five women had completed dosing, due to all women experiencing unacceptable vulvo-vaginal side-effects. Further investigations showed that the gel had a very high osmolality, which we believe led to excessive fluid transudation across the vaginal mucosa and acute mucosal dysfunction. We also showed that the rheology of the gel changed dramatically on fluid dilution. The osmolality and rheology of candidate microbicides and other genital mucosal products should therefore be analysed and considered at an early stage of product development.


Subject(s)
Anti-Infective Agents/administration & dosage , Anti-Infective Agents/adverse effects , Cellulose/analogs & derivatives , Sexually Transmitted Diseases/prevention & control , Vaginal Creams, Foams, and Jellies/administration & dosage , Administration, Intravaginal , Adolescent , Adult , Anti-Infective Agents/chemistry , Cellulose/administration & dosage , Cellulose/adverse effects , Female , Humans , Middle Aged , Osmolar Concentration , Vaginal Creams, Foams, and Jellies/chemistry , Young Adult
20.
Environ Monit Assess ; 163(1-4): 583-9, 2010 Apr.
Article in English | MEDLINE | ID: mdl-19357981

ABSTRACT

Ships have been identified as one of the important vectors in the translocation of organisms from one bioregion to another leading to bioinvasion. In this context, harbours serve as a gateway for the introduction of alien species. Surveys were carried out in the vicinity of ports of Mumbai for macrobenthic fauna, zooplankton and hard substratum community on three different occasions during 2001-2002. The study shows that 14 polychaete species are recently introduced to this area. Mytilopsis sallei, a bivalve, which is an invasive species in the Indian context continued to be present but was restricted to enclosed docks, indicating preference for embayed water bodies. The polychaete Protula tubularia was abundant in the hard substratum community and is being reported as a possible ship-mediated introduction.


Subject(s)
Marine Biology , Polychaeta/classification , Animals , India , Zooplankton/classification
SELECTION OF CITATIONS
SEARCH DETAIL
...