Effectiveness of low-volume split-dose versus same-day morning polyethylene glycol regimen for adequacy of bowel preparation in patients undergoing colonoscopy: A single-blinded randomized controlled trial.

BACKGROUND: Successful completion of colonoscopy depends largely on the quality of bowel preparation. Polyethylene glycol (PEG) is a commonly used preparation for colonoscopy. The timing of bowel preparation has evolved from previous day evening to the currently recommended split-dose regimen. It was observed that consumption of entire or a portion of PEG on the previous day can interfere with work and sleep. Hence, we designed this single-blinded randomized controlled trial (RCT) to evaluate the efficacy, tolerability, and acceptability of the same-day PEG as compared with lowvolume split-dose PEG in patients undergoing late morning colonoscopy. METHODS: A total of 384 patients were randomized to same-day (SD group; n = 192) and split-dose (SPL group; n = 192) bowel preparation. The patients in both the groups received bisacodyl 10 mg at bedtime on the day prior to colonoscopy. The patients in the SD group took 2 L of PEG between 5:00 AM and 7:00 AM on the day of colonoscopy. The SPL group took 1 L of PEG between 6:00 PM and 7:00 PM on the preceding day and another liter between 6:00 AM and 7:00 AM on the day of colonoscopy. The adequacy of bowel preparation was assessed using the Boston Bowel Preparation Scale (BBPS). Tolerability was scored by recording symptoms such as nausea, vomiting, bloating, and abdominal pain. Acceptability was based on the overall satisfaction, willingness to repeat the same preparation, and interference with sleep on the preceding night. RESULTS: The median (interquartile range, [IQR]) BBPS in the SD group was 8 (6-9) while that in the SPL group was 6 (5-8) and this difference was statistically significant (p < 0.001). Similarly, a significantly higher proportion of patients in the SD group (86%) achieved adequate bowel preparation (BBPS score ≥ 6) when compared to those in the SPL group (73.4%) (p = 0.002). Tolerability as assessed by nausea, vomiting, bloating, and abdominal pain was similar in both the groups. There was also no significant difference with respect to overall satisfaction of taking bowel preparation (p = 0.33) or willingness to repeat the same regimen (p = 0.37) between the two groups. Patients in the SPL group had more interference with sleep on the preceding night (54% vs. 14.5%, p < 0.001). CONCLUSION: Same-day morning PEG regimen can be considered an effective, well-tolerated, and acceptable bowel preparation for colonoscopy.

Augmented Reality-Centered Position Navigation for Wearable Devices with Machine Learning Techniques.

People have always relied on some form of instrument to assist them to get to their destination, from hand-drawn maps and compasses to technology-based navigation systems. Many individuals these days have a smartphone with them at all times, making it a common part of their routine. Using GPS technology, these cellphones offer applications such as Google Maps that let people find their way around the outside world. Indoor navigation, on the other hand, does not offer the same level of precision. The development of indoor navigation systems is continuously ongoing. Bluetooth, Wi-Fi, RFID, and computer vision are some of the existing technologies used for interior navigation in current systems. In this article, we discuss the shortcomings of current indoor navigation solutions and offer an alternative approach based on augmented reality and ARCore. Navigating an indoor environment is made easier with ARCore, which brings augmented reality to your smartphone or tablet.

Esophageal squamous cell cancer in Plummer-Vinson syndrome: Is lichen planus a missing link?

This retrospective study analyzed the occurrence of esophageal squamous cell cancer (ESCC) in a cohort of patients with Plummer-Vinson syndrome (PVS) and mucosal lichen planus (LP). ESCC occurred in 6.2% cases of PVS, more than half of whom had associated oral LP. Mucosal LP and PVS together may increase the predisposition to ESCC.

On the Use of Wavelet Domain and Machine Learning for the Analysis of Epileptic Seizure Detection from EEG Signals.

Epileptic patients suffer from an epileptic brain seizure caused by the temporary and unpredicted electrical interruption. Conventionally, the electroencephalogram (EEG) signals are manually studied by medical practitioners as it records the electrical activities from the brain. This technique consumes a lot of time, and the outputs are unreliable. In a bid to address this problem, a new structure for detecting an epileptic seizure is proposed in this study. The EEG signals obtained from the University of Bonn, Germany, and real-time medical records from the Senthil Multispecialty Hospital, India, were used. These signals were disintegrated into six frequency subbands that employed discrete wavelet transform (DWT) and extracted twelve statistical functions. In particular, seven best features were identified and further fed into k-Nearest Neighbor (kNN), naïve Bayes, Support Vector Machine (SVM), and Decision Tree classifiers for two-type and three-type classifications. Six statistical parameters were employed to measure the performance of these classifications. It has been found that different combinations of features and classifiers produce different results. Overall, the study is a first attempt to find the best combination feature set and classifier for 16 different 2-class and 3-class classification challenges of the Bonn and Senthil real-time clinical dataset.

Sister Mary Joseph Nodule as an Initial Presentation of Pancreatic Adenocarcinoma.

Sister Mary Joseph (SMJ) nodule is a metastatic umbilical nodule seen in primary tumors of the gastrointestinal or genitourinary tract. The stomach and colon are the common gastrointestinal cancers associated with SMJ nodule. The pancreas is a rare primary site for umbilical metastasis. Moreover, malignant umbilical nodules as the first presentation in pancreatic cancer is rare. Pancreatic adenocarcinoma that metastasizes to umbilicus usually arise from the body or tail of the pancreas. The presence of SMJ nodule usually indicates poor prognosis. Umbilical nodule is a simple physical finding to the presence of an advanced intra-abdominal malignancy. Although rare, pancreatic cancer should be considered as one of the primary sites in such a situation.

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects.

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4'-(anthracene-9-yl)-2,2':6',2''-terpyridine and bpy = 2,2'-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 µM).

Differential coral response to algae contact: Porites tissue loss, praise for Halimeda interaction at southeast coast of India.

Worldwide, reef building corals are being degraded due to increasing anthropogenic pressure, and as a result, macroalgal cover is being increased. Hence, mechanism of coral-algal interaction, differential coral response to algal overgrowth, is critical from every geographical location to predict future coral dynamics. This paper documents the frequency of coral-algal (Halimeda) interactions, differential coral response to algal interaction. We found difference in susceptibility among coral genera to competitive effects. Out of 970 coral colonies surveyed, 36.7% were in contact with Halimeda sp. Most frequent contact was observed in Porites (57%) followed by Favites 28% (n = 60), Acropora 26% (n = 48), Platygyra 5% (n = 5) and Symphyllia 4.2% (n = 3). Frequent discoloration and tissue loss were only observed in Porites. Continuous monitoring revealed that long-term algal physical contact prevents light required for polyp for photosynthesis and stops coral feeding ability. In this study, we also found mutual exclusion between Halimeda and coral recruit. Out of 180 coral colonies (size class between 5 and 15 cm) comprised of Favites (n = 74), Acropora (n = 20), Favia (n = 79) and Porites (n = 7) surveyed, none of them were found in Halimeda-dominated sites. The documented effects of recruitment exclusion and tissue mortality followed by algal interaction on major reef building corals (Porites) could affect replenishing process and health of the remaining healthy corals in the Palk Bay reef if algal proliferation rate is not controlled through proper management strategies.

Patient Monitoring System Using Cognitive Internet of Things.

In this article, we ponder multi-user medical image transmission using Cognitive Multiple-input Multiple-output (MIMO) Multi-carrier Code-division-multiple-access (MC-CDMA) system to monitor patient information. We investigate the performance of such system in the communication layer and application layer of internet of things (IOT). Patient monitoring system plays vital role in the hospital particularly in the emergency ward to resolve certain problems such as maintaining glucose level in the body, maintaining minimum sugar levels under emergency conditions. IOT find tremendous application in the hospital to deal with certain issues such as injection of drug to the patients by doctor from remote places, monitoring patients heart beats, sugar level by the concerned doctors. MIMO finds many applications in medical field to enrich data rate while communication patient information at faster rate. We utilize MC-CDMA system to accommodate large user patients information and to transmit such information with high resolution by eliminating channel impairments. We are utilizing Cognitive spectrum for medical image transmission of higher bandwidth applications. We realize Double-space-time transmit diversity as MIMO profile to boost up throughput. We perform multi-carrier modulation using IDFT at the transmitter .we carryout demodulation employing DFT at the hospital. We introduce Multi-carrier communication to fulfil the need of bandwidth efficiency and to diminish frequency selectivity effects.In the application layer, we estimate patient's information with aid of block-nulling decoding algorithm. Moreover we analyze the quality of image of D-STTD MC-CDMA system with turbo style of channel encoder to manifest medical image with high resolution with less signal strength. We conclude that Cognitive D-STTD MC-CDMA system provides reliable communication for the application of IOT and also transfer high resolution medical image with less signal strength in order to observe patient status by doctor.

Effect of diabetes on treatment outcome of smear-positive pulmonary tuberculosis--a report from South India.

AIM: To assess the effect of diabetes on tuberculosis (TB) treatment outcome and sputum conversion among new smear-positive (NSP) cases registered under Directly Observed Treatment Short Course in South India. METHODS: Details on sputum conversion and TB treatment outcome were collected from case records of NSP cases (N = 332; M/F 247:85) registered at TB units of three districts in Tamil Nadu. Subjects were screened for diabetes and categorized as diabetic (TBDM) (n = 96; 73:23) and non-diabetic (TBnonDM) (n = 149; 109:40). RESULTS: Among 245 selected TB patients, 93.5% were cured, 1.6% completed TB treatment, 2% had TB treatment failure (TF), and 0.4% had treatment default (TD), 0.4% with MDR-TB and 2% death rate. At the end of intensive phase of TB treatment, 14.7% remained sputum positive in the TBDM group, whereas it was 3.5% in the TBnonDM group. Mean duration (days) for sputum conversion was higher in the TBDM group (64.2 ± 10.5) compared to the TBnonDM group (61.5 ± 7.5) (p<0.001). TF rate was higher (4.2% vs 0.7%) and MDR-TB (1%) was also seen in the TBDM group. No death and TD were seen among DM whereas it was 3.4 and 0.7% in TBnonDM. CONCLUSIONS: Delayed sputum conversion and high TB treatment failure rates were common in NSP cases with diabetes.

Studies on radionuclides 228Ra, 238U, 228Th and 40K in selected seaweeds of coastal Tamil Nadu, India.

Studies on natural and anthropogenic radioactivity assume greater importance in the context of human health and development. Hence two species of seaweeds viz: Gracilaria edulis and Ulva lactuca, from three high background radiation areas (Arockiapuram, Kadiapattinam and Kurumpanai) on the southwest coast of Tamil Nadu, and Mandapam as low background radiation area of the southeast coast of Tamil Nadu were studied for variations in activity concentration of 228Ra, 40K, 238U and 228Th. Among these radionuclides, 40K recorded significant inter-species variation while 238 U and 228Th showed significant association. The overall mean concentration of radionuclides was found high in G. edulis (5.31,57.49,36.05,356.55 Bq kg(-1) for 228Ra, 40K, 238U, 228Th respectively), while the mean concentrations for U. lactuca were 4.88, 42.35, 34.40,347.70 Bqkg(-1) for 228Ra, 40K, 238U, 228Th respectively. The mean concentration of radionuclides was uniformly found low during northeast monsoon season in both the seaweed species.

Transmission of 4-MeV electron beam through lead shielding.

The relative reduction in percentage transmission through lead for 4-MeV electrons produced from a linear accelerator for different field sizes has been measured both with and without buildup. For our study a parallel plate chamber with Farmer dosimeter in polymethylmethacrylate phantom was used. Lead strips were used as a shielding material. The result of this study shows that as (i) the depth of measurement in phantom, (ii) the gap width between lead shielding material and phantom increases, the lead thickness required for the same percentage of reduction in transmission decreases due to energy loss of scattered electrons and decreased scattered electrons reaching the detector. The 95% and 98% reduction in transmission was evaluated and found to increase with increasing field size due to higher lateral scattering. From our study it was concluded that the reduction in transmission with lead was found to depend upon the field size, the depth at which measurements are made, the gap width between lead shielding and phantom, and the focus to skin distances.