Dataset from transcriptome profiling of Musa resistant and susceptible cultivars in response to Fusarium oxysporum f.sp. cubense race1 and TR4 challenges using Illumina NovaSeq.

In this investigation, the study focused on the RNAseq data generated in response to Fusarium oxysporum f.sp. cubense (Foc) race1 (Cavendish infecting strain VCG 0124), targeting both resistant (cv. Rose, AA) and susceptible cultivars (Namarai, AA), and Tropical Race 4 (TR4, strain VCG 01213/16), involving resistant (cv. Rose, AA) and susceptible cultivars (Matti, AA). The respective contrasting cultivars were independently challenged with Foc race1 and TR4, and the root and corm samples were collected in two replications at varying time intervals [0th (control), 2nd, 4th, 6th, and 8th days] in duplicates. The RNA samples underwent stringent quality checks, with all 80 samples meeting the primary parameters, including a satisfactory RNA integrity number (>7). Subsequent library preparation and secondary quality control steps were executed successfully for all samples, paving the way for the sequencing phase. Sequencing generated an extensive amount of data, yielding a range of 10 to 31 million paired-end raw reads per sample, resulting in a cumulative raw data size of 11-50 GB. These raw reads were aligned against the reference genome of Musa acuminata ssp. malaccensis version 2 (DH Pahang), as well as the pathogen genomes of Foc race 1 and Foc TR4, using the HISAT2 alignment tool. The focal point of this study was the investigation of differential gene expression patterns of Musa spp. upon Foc infection. In Foc race1 resistant and susceptible root samples across the designated day intervals, a significant number of genes displayed up-regulation (ranging from 1 to 228) and down-regulation (ranging from 1 to 274). In corm samples, the up-regulated genes ranged from 1 to 149, while down-regulated genes spanned from 3 to 845. For Foc TR4 resistant and susceptible root samples, the expression profiles exhibited a notable up-regulation of genes (ranging from 31 to 964), along with a down-regulation range of 316-1315. In corm samples, up-regulated genes ranged from 57 to 929, while down-regulated genes were observed in the range of 40-936. In addition to the primary analysis, a comprehensive secondary analysis was conducted, including Gene Ontology (GO), euKaryotic Orthologous Groups (KOG) classification, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and investigations into Simple Sequence Repeats (SSRs), Single Nucleotide Polymorphisms (SNPs), and microRNA (miRNA). The complete dataset was carefully curated and housed at ICAR-NRCB, Trichy, ensuring its accuracy and accessibility for the duration of the study. Further, the raw transcriptome read datasets have been successfully submitted to the National Center for Biotechnology Information - Sequence Read Archive (NCBI-SRA) database, ensuring the accessibility and reproducibility of this valuable dataset for further research endeavors.

Occurrence of Banana bract mosaic virus on Musa ornata Roxb based hybrids in India.

Musa ornata, wild species of banana is being used as a cut flower, potted plants and for landscape gardening etc., They are also being utilized in banana hybridization programmes for introgressing pest and disease tolerant traits into banana cultivars in addition to the development of inter specific ornamental banana hybrids. Symptoms of banana bract mosaic virus (BBrMV) was observed in the bracts of interspecific M. ornata based hybrid developed using another wild species i.e., Musa rubra Kurz at ICAR-National Research Centre for Banana (NRCB), Tiruchirapalli. Presence of the virus in the bracts, leaves and roots of symptomatic plants was confirmed through triple antibody sandwich enzyme linked immunosorbent assay with BBrMV monoclonal and polyclonal antibodies. BBrMV HC-Pro (1370 bp), CP (900 bp) and VPg (570 bp) genes were amplified from the infected bracts using reverse transcriptase polymerase chain reaction with BBrMV respective gene primers. The amplicons of these three genes were cloned and sequenced. Blastn analysis revealed that HC-Pro, VPg and CP gene sequences has 97.67%, 97.72% and 99.67% similarity with the respective gene sequences of BBrMV infecting banana. Phylogenetic analysis clustered the test isolate with other BBrMV isolates of banana and other hosts based on CP and HC-Pro and VPg gene sequences. The virus is transmitted through Pentalonia nigronervosa and the transmitted plants expressed symptoms under glass house conditions. To the best of our knowledge, this is the first report of BBrMV on ornamental M. ornata hybrid in India and its transmission occurs through Pentalonia nigronervosa. Supplementary Information: The online version contains supplementary material available at 10.1007/s13337-022-00788-6.

Characterization of Mungbean yellow mosaic India virus genome with a recombinant DNA-B in Southern Peninsular India.

BACKGROUND: Mungbean yellow mosaic India virus (MYMIV) is a representative of the genus begomovirus/Begomoviridae, which is prevalent in the northern part of Indian subcontinent causing yellow mosaic disease (YMD). This virus is rapidly evolving and breaking the resistance in the advanced lines causing huge economic losses in the pulse production. In this context, the present investigation on characterization of the causal organism of YMD was undertaken METHODS AND RESULTS: A novel recombinant isolate (YMV-BG-BPT) causing YMD was identified from blackgram in Andhra Pradesh, southern peninsular region of India. The association of a bipartite begomovirus with the disease was done by sequence analyses of the cloned full-length genome. The full length genome sequences were submitted in NCBI GenBank with accession numbers MZ235792 (DNA-A) and MZ356197 (DNA-B). The sequence analysis of DNA-A of YMV-BG-BPT showed maximum of 99.12% similarity at nucleotide level with Mungbean yellow mosaic India virus (MYMIV) isolate reported from Tamil Nadu (KC911719), India which is also confirmed by clustering pattern in phylogenic analysis and DNA-B showed 95.79% with Mungbean yellow mosaic virus (MYMV) isolate reported from Tamil Nadu (KP319016) and 95.05% with MYMIV isolate reported from Karnataka (MT027037). The huge variation in DNA-B lead us to suspect a recombination in DNA-B, where a recombination event in the CR, region coding for nuclear shuttle protein and movement protein of DNA B was detected in which MYMV-BG-AP-IND (KF928962) and MYMIV-GG-CH-IND (MN020536) have been identified as major and minor parents, respectively. CONCLUSION: Overall, the present study revealed occurrence of MYMIV with recombinant DNA B component in southern peneinsular India.

New record of mungbean yellow mosaic India virus in Desmodium laxiflorum and association of bhendi yellow vein mosaic betasatellite in Abelmoschus moschatus in Andhra Pradesh, India.

Mungbean yellow mosaic India virus (MYMIV) is one of the most serious commonly occurring yellow mosaic virus (YMV's) group in majority of the pulses especially black gram and green gram in southern India compared to previously reported mungbean yellow mosaic virus. In January 2020 Desmodium laxiflorum and Abelmoscus moschatus showing mosaic symptoms and vein yellowing were collected from Guntur and Prakasam districts respectively in Andhra Pradesh. PCR analysis using MYMIV and betasatellite specific primers gave desired expected amplification from the infected samples of A. moschatus (YMV-ABEL) whereas only MYMIV specific amplification was obtained in D. laxiflorum (YMV-DES). However, no PCR amplification was obtained in respective healthy leaf samples of both plants. Sequence analysis showed that the CP sequence of YMV-ABEL and YMV-DES showed a similarity of 99.19% with MYMIV (KP677496) and 99.75% with MYMIV (JN181003) respectively. The full-length betasatellite (1356 bp) showed highest identity of 90% with bhendi yellow vein mosaic betasatellite (BYVMB) (GU111977). Phylogenetic analysis clustered the test isolates with south Indian isolates of MYMIV whereas the betasatellite sequence clustered with various isolates of BYVMB, tomato leaf curl New Delhi virus betasatellite and okra leaf curl betasatellite reported from India and Pakistan. To the best of our knowledge, this is the first report of a MYMIV in D. laxiflorum and A. moschatus and MYMIV betasatellite complex in A. moschatus.

Evidence of viral genome linked protein of banana bract mosaic virus interaction with translational eukaryotic initiation factor 4E of plantain cv. Nendran based on yeast two hybrid system study.

Banana bract mosaic virus (BBrMV), belongs to the genus Potyvirus and it is an important viral pathogen of bananas and plantains. The eukaryotic translation initiation factor, eIF4E, and its isoform play key roles during the virus infection in plants, particularly Potyvirus. The present study was undertaken to determine the role of BBrMV-viral protein genome-linked (VPg) in virus infectivity by analyzing the interaction with the eukaryotic translation initiation factor eIF4E through yeast two-hybrid system. The results suggest that plantain cv. Nendran eIF4E plays an essential role in the initiation of the translation of capped mRNAs and its association with VPg would point to a role of the viral protein in the translation of the virus and may potentially contribute to BBrMV resistance.

Recent advances in understanding the replication initiator protein of the ssDNA plant viruses of the family Nanoviridae.

The families of viruses possessing single-stranded (ss) circular genome employ a dedicated replication initiator protein (Rep) for making copies of their genome through the process of rolling circle replication. The replication begins at conserved nonanucleotide sequence at the intergenic region. The Rep protein seems to be the most conserved amongst the available proteins of the nanovirids and comprises of the N-terminal endonuclease domain and the C-terminal helicase domain. The structural studies of Faba bean necrotic yellows virus endonuclease domain suggests a α + ß fold comprising of central ß sheet built from five antiparallel ß strands surrounded by outer short α helices. The catalysis is mediated by a conserved Tyr residue and employs divalent metal ions (Mn2+). On one hand, the Reps associate with each other and oligomerize and on the other hand interact with varied host and vector associated proteins for successful infection. The sequence analysis of Reps from previously known nanovirids and the newly found ones from metagenomics data shed light on the evolutionary pattern of nanovirids in comparison to other plant infecting ssDNA viruses.

Complete genome sequence of sacbrood virus isolated from Asiatic honey bee Apis cerana indica in India.

We determined the complete genome sequence of a sacbrood virus (SBV) infecting Indian honey bee (Apis cerana indica) from Tamil Nadu, India named as AcSBV-IndTN1. The genome of AcSBV-IndTN1 comprised of 8740 nucleotides, encoding a single large ORF containing 2849 amino acids flanked by 5' and 3' untranslated regions. Results of phylogenetic tree analysis based on complete genomes of SBV isolates indicated that the virus isolates from India isolated from the Asiatic honey bee A. cerana (AcSBVs) formed a separate group along with six Vietnam isolates and three Chinese isolates. The AcSBV-IndTN1 isolate showed closer genetic relationship with other isolates from India. The second major group had both AcSBVs and AmSBVs (virus isolated from European honey bee, Apis mellifera SBV) of Korea, China and Vietnam. The third and a distantly related group had AmSBVs of Australia, UK, USA and Korea. The results obtained from phylogenetic analysis were further supported with evolutionary distance analysis. AcSBV-IndTN1 isolate open reading frame had 95-99% amino acid sequence similarity with other Indian isolates and 92-96% with AcSBVs and AmSBVs of other geographical locations. In addition, sequence difference count matrix ranged from 154 to 907 nt among all the SBV isolates. This suggests that the virus isolates have evolved significantly in different geographical locations but isolates on different hosts in a given location/country are closely related. The high similarity in the genome among the AcSBV and AmSBV isolates indicate possible cross-infections and recombination of SBV isolates in Asian continent where both the honey bee species are reared in close proximity. Gene flow between SBV population indicating that an infrequent gene flow occur between them. The pattern of molecular diversity in SBV population revealed that the occurrence of recent population expansion of SBV. To the best of our knowledge this is the first report of the complete nucleotide sequence of AcSBV from Tamil Nadu, India. This study provided an opportunity to establish the molecular evolution of SBV isolates and shall be useful in the development of diagnostics and effective disease control strategies.

Production of polyclonal antibodies for Capsicum chlorosis virus (CaCV) infecting chilli in India through recombinant nucleocapsid protein expression and its application.

Bud necrosis and chlorotic spots causing virus affecting chilli crop in Tamil Nadu (India) was identified as Capsicum chlorosis virus (CaCV). Specific primers were used for amplification and sequencing of the nucleocapsid protein (NP) gene. Polyclonal antibody against the bacterially expressed NP from the CaCV-TN-CBE isolate was produced using recombinant DNA technology. NP gene was subcloned into the pET-28a (+) vector and expressed by transformation in BL21 (DE3) pLysS. The expressed protein was about ∼34 kDa and was confirmed through western blot analysis using Groundnut bud necrosis virus (GBNV) polyclonal antiserum from ICRISAT, India. The purified recombinant protein was used to immunize rabbits to generate CaCV-specific polyclonal antiserum. The sensitivity levels of polyclonal antiserum thus raised was assayed through indirect ELISA or direct antigen coating (DAC)-ELISA using the recombinant protein as antigen. The recombinant antiserum produced in this study successfully detected the natural infection of CaCV on chilli plants collected from the field as well as on cowpea plants artificially inoculated with CaCV by using DAC-ELISA, DIBA and western blotting.

Substantivity of hypochlorous acid-based disinfectant against biofilm formation in the dental unit waterlines.

OBJECTIVE: The purpose of the study was to examine the substantivity of a new disinfectant against biofilm formation in the dental unit waterlines. MATERIALS AND METHODS: Twenty dental units were selected for the study and divided into two groups: Group A (dental unit waterlines treated with the disinfectant) and Group B (untreated dental unit waterlines). Biofilm formation was monitored in both groups by removing the one dental unit waterline from each group for the period of 10 days. One inch of the dental unit waterline tube was cut at random site, and the inner lumen of the cut sections was analyzed using the scanning electron microscope (SEM) (TESCAN VEGA3 SBU). RESULTS: On examination, SEM images showed that there was no slime layer or bacterial cells seen in cut section for the period of 7 days in the treated dental waterlines, which means that there is no evident of biofilm formation. In the untreated dental unit waterline cut section, slime layer was observed from day 1. CONCLUSION: Disinfectant solution was proved to be effective for 7 days against biofilm formation. This technique could be used as a valid method for disinfection of dental unit waterlines.

Dental unit waterlines disinfection using hypochlorous acid-based disinfectant.

OBJECTIVE: The purpose of the study was to investigate the efficacy of a new disinfectant to disinfect the dental unit waterlines. MATERIALS AND METHODS: New dental unit waterlines were installed in 13 dental chairs, and biofilm was allowed to grow for 10 days. Disinfection treatment procedure was carried out in the 12 units, and one unit was left untreated. The dental unit waterlines were removed and analyzed using the scanning electron microscope (SEM) (TESCAN VEGA3 SBU). RESULT: On examination, SEM images showed that there was no slime layer or bacterial cells seen in any of the 12 cut sections obtained from the treated dental waterlines which mean that there was no evident of biofilm formation. Untreated dental unit waterlines showed a microbial colonization with continuous filamentous organic matrix. There was significant biofilm formation in the control tube relative to the samples. CONCLUSION: The tested disinfectant was found to be effective in the removal of biofilm from the dental unit waterlines.

Genetic diversity and recombination analysis in the coat protein gene of Banana bract mosaic virus.

Banana bract mosaic virus (BBrMV), a member of the genus Potyvirus, family Potyviridae, is the causal agent of the bract mosaic disease (BBrMD) that causes serious yield losses in banana and plantain in India and the Philippines. In this study, global genetic diversity and molecular evolution of BBrMV based on the capsid protein (CP) gene were investigated. Multiple alignments of CP gene of 49 BBrMV isolates showed nucleotide (nt) and amino acid (aa) identity of 79-100 and 80-100 %, respectively. Phylogenetic analysis revealed that except two Indians isolates (TN14 and TN16), all isolates clustered together. Eleven recombination events were detected using Recombination Detection Program. Codon-based maximum-likelihood methods revealed that most of the codons in the CP gene were under negative or neutral selection except for codons 28, 43, and 92 which were under positive selection. Gene flow between BBrMV populations of banana and cardamom was relatively frequent but not between two different populations of banana infecting isolates identified in this study. This is the first report on genetic diversity, and evolution of BBrMV isolates based on recombination and phylogenetic analysis in India.

Population structure of Banana bract mosaic virus reveals recombination and negative selection in the helper component protease (HC-Pro) gene.

Banana bract mosaic virus (BBrMV) is a serious constraint in the production of banana and plantain in India. In this study, we have cloned, sequenced and analyzed the helper component proteinase (HC-Pro) gene of 22 isolates from India and compared with previously reported BBrMV isolates. Sequence identity of BBrMV isolates encoding HC-Pro gene, were 92-100 % both at the nucleotide (nt) and amino acid level. Phylogenetic analysis based on nt sequences of non recombinant isolates showed that TN15, TN9 and TN24 formed one cluster and all the remaining isolates formed into another cluster. Different functional motifs in the central region of HC-Pro gene of BBrMV isolates were found conserved. Four potential recombinants with a total of 15 breakpoints were mostly observed at the N and a few from C terminal regions. The codon based selection analysis revealed that most of the codons were under purifying or negative selection except a codon at position 74 which was under positive selection. It is likely that recombination identified in Indian BBrMV isolates, along with strong purifying selection, enhances the speed of elimination of deleterious mutations in the HC-Pro gene. This study suggested that negative selection and recombination were important evolutionary factors driving the genetic diversification and population structure of Indian BBrMV isolates. To the best of our knowledge, this is the first report on the diversity analysis and occurrence of recombination in the HC-Pro gene of BBrMV.

Complete genome sequence of a banana bract mosaic virus isolate infecting the French plantain cv. Nendran in India.

The first complete genome sequence of an Indian isolate (TRY) of Banana bract mosaic virus (BBrMV) was determined following virus RNA extraction from the French plantain cv. Nendran (AAB). The complete genome was 9711 nucleotides excluding the poly(A) tail and had a genome organization similar to that of a Philippine (PHI) isolate characterized earlier. When compared to BBrMV-PHI, the complete genome sequence of BBrMV-TRY was 94% identical at the nucleotide level and its ten mature proteins had amino acid sequence identities ranging from 88 to 98%. Phylogenetic analysis suggests that the BBrMV-TRY isolate is closely related to the BBrMV-PHI isolate.

Molecular Characterization of Geographically Different Banana bunchy top virus Isolates in India.

Banana bunchy top disease (BBTD) caused by Banana bunchy top virus (BBTV) is one of the most devastating diseases of banana and poses a serious threat for cultivars like Hill Banana (Syn: Virupakshi) and Grand Naine in India. In this study, we have cloned and sequenced the complete genome comprised of six DNA components of BBTV infecting Hill Banana grown in lower Pulney hills, Tamil Nadu State, India. The complete genome sequence of this hill banana isolate showed high degree of similarity with the corresponding sequences of BBTV isolates originating from Lucknow, Uttar Pradesh State, India, and from Fiji, Egypt, Pakistan, and Australia. In addition, sixteen coat protein (CP) and thirteen replicase genes (Rep) sequences of BBTV isolates collected from different banana growing states of India were cloned and sequenced. The replicase sequences of 13 isolates showed high degree of similarity with that of South Pacific group of BBTV isolates. However, the CP gene of BBTV isolates from Shervroy and Kodaikanal hills of Tamil Nadu showed higher amino acid sequence variability compared to other isolates. Another hill banana isolate from Meghalaya state had 23 nucleotide substitutions in the CP gene but the amino acid sequence was conserved. This is the first report of the characterization of a complete genome of BBTV occurring in the high altitudes of India. Our study revealed that the Indian BBTV isolates with distinct geographical origins belongs to the South Pacific group, except Shervroy and Kodaikanal hill isolates which neither belong to the South Pacific nor the Asian group.

Molecular Detection of 16SrXI Group Phytoplasma Associated with Root (Wilt) Disease of Coconut (Cocos nucifera) in India.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev-3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.

Regulation of herpes simplex virus thymidine kinase in cells treated with a synergistic antiviral combination of alpha interferon and acyclovir.

Alpha interferon (IFN-alpha) and acyclovir (ACV) are synergistic in their anti-herpes simplex virus activities. IFN-alpha treatment reduced the herpes simplex virus thymidine kinase (TK) activity present in cells 6 h postinfection, while steady-state levels of TK mRNA remained at or above the amount in infected, untreated cells. The inhibition of TK production by IFN-alpha treatment appeared to be transient and translational, not transcriptional.